HBVdb

Dataset for nucleotide sequence PreS2 of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                   *    **    * 
ATGCAGTGGAATTCCACtGCcTTCCACCAAGCTCTGCAgGATCCCAGAGTCAGGGGtCTGTATtTTCCTGCTGGTGGCTC
gca---    cc     aa t  t      a g  aata  c    ag    a   c      c c              
---                                                                             
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *              **  *        *        *     *        *       *   * *  *   *   
CAGTTCAGGAACAgTaAACCCTGcTCCgAATATTGCCTCTCACATCTCGTCAATCTCCgCGAGGACTGGGGACCCTGtga
           t c c       t   a c  c  ta        a       c    t   c  t           cac
             t                                                                tt
                                                                               g

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  *       **       *      *  *  *     * **  *     *     * **    ** * **
CGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATC
ta c                      c     a                              c                
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*      *      *        *  *         *   **                      *  *     ** * * 
CTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAG-GGGGatCACCCGTGTGTCTTGGCCAAA
           a                               g            acc t        g        
                                                         gg                     
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **    *** *    *** * ** **  **        *        **  * * *  *    * *      *   
ATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGG
                                     t          c         c     t               
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** *  **    ** ** ** *** *    ** *** *             *        *           *     
CGTTTTATCATATTCCTCTTCATCCTGC---TGCTATGCCTCATCTTCTTATTGGTTCTTCTGGATTATCAAGGTATGTT
                                                  g     a        c gc  g        
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                     *                         *                * **        *  *
GCCCGTTTGTCCTCTAATTCCAGGATCa------ACAACAACCAGtACGGGACCaTGCAAAACCTGCACGACTCCTGCTC
                           c      g    c     c      a c    gg                   
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *   ***     *  ** *     **         *  **  *  *   ****           ***      * 
AAGGCAACTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGAtGGAAATTGCACCTGTATTCCCATCCCATCgTCc
      c       a       c     t     c       t  cc         t                 a  t
                                                          a                     
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  *  **  * * ******  *  * *  ** *    **      * ** *   *  *     *     * ** 
TGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTG
                t                  c         a                                
                                               c                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    *         * *        *  *  *   *     * * *    *     *  *     *            
GTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGcTATaTGGATGATGTGGTAtTGGGGGCCAAGTCTGTACAgCATCg
     c   c              c       t  t   g        a t   c          aa   ct  a  c t
                                                t c                             
                                                                                

       810       820       830       840       850      
....:....|....:....|....:....|....:....|....:....|....:.
                                                        
TGAGtCCCTTTATACCGCTGTTACCAATTTTCTTTTGTCTcTGGGTATACATTTAA
    g                   t         a t   t    c      c   
                                                        
                                                        
© 1998-2020Legal notice