HBVdb

Dataset for nucleotide sequence P of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ****** ****      ***  *      * **  * **                    *     *     * * 
ATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGgGACCG---AGGCAGGTCCCCTAGAAGAAGA
                                        t ta a g a       tc              c  
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  ** * ***   *           ** **   ** *     * *   *  *  *          **   * *  
ACTCCCTCGCCTCGCAGACGcAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGTATTC
                    a           a                              c c              
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** *   ***  ** *        ** ** ** **           *    *   *       ***      ** 
CTTGGACTCATAAGGTGGGAAAcTTtACtGGGCTTTATTCcTCTACaGTaCCTATCTTTAATCCTGAATGGCAAACTCCT
                      t  c  g  a  c  c  t   t t  c   gat     c  c  c     g  c  c
                                                 g    g            t            
                                                 t                              

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ** *     ** *   *    *  *   *          **  *    *  *  **  *           * ** * 
TCcTTTCCTAAgATTCATTTACAaGAgGACATTatTAATAGGTGTCAaCAATTTGTgGGCCCTCTcACTGTAAATGAAAA
  t     a  a  c        t  a  t   gccg c  a   g g     c  a      t  a cg        
        g              c         t  c                            a              
                       g                                                        

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *      *   *** *   * *  *  *           *  **     *  *  * *   * **  *  
gAGAAGAtTgAAATTAATTATGCCTGCTAGaTTcTATCCTAcCcaCACtAAATATTTgCCctTAGACAAAGGaATTAAAC
a      c a  g  g  c     c     g  t  c    atagt  c  g  cc a  tc gc t     g     
                                                a        c                    
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * **               * **** ** **  *  *    ** **  *  * *  **  **      **  *  * 
CTTATTATCCaGATCAgGTAGTTAATCATTACTTcCAaACCaGACATTATTTACATACTCTTTGGAAGGCTGGtATTCTA
          t  a  ta g           t  ta gg tc                        g     
             c  a                                                           
                c                                                               

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*            *  *     *  * **       *  **    **     ******* *    *              
TATAAGAGGGAAACcACACGTAGCGCaTCATTTTGCGGGTCACCATATTCTTGGGAACAAGAGCTACAgCATGGGAGGTT
      c a   t  t        c     c  t              c                 t   --------
                          t                                                     
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *      *   * *    **             *  *    **  *   *  **   *   *  **
GGTcAtCAAAACCTCGCAAAGGCATGGGGACGAAtCTTTCTGTTCCCAAcCCTCTGGGATTCTTTCCCGATCATCAGTTG
--at-c-c cg                       c  a     ct a  t  g         c               
  -- g -                             g                                          
     - g                                                                        

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  *  **    *  **  *          **  ** *    **      **        **             * 
GACCCTGCATTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCATCAAGGACCACTGGCCAgcAGCCAAcCA
  t  g                                       a gc   a  t         ca      t  
     c                                                               a          
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *       *         * **  *     * ** **    **  *  *    *        *  **  *        
GGTAGGAGTGGGAGCATTCGGGCCAGGGtTCACcCCtCCACACGGcGGTgTTTTGGGGTGGAGCCCTCAGGCTCAGGGCA
                  t  c      c    t  c          a cc                           
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                *       ****                                    
TATTGaCcACAGTGtCAaCAaTTCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACTCCCATCTCTCCA
cgc  g tc tt  c ggt g g     ca        g           c     c a     c  a     t      
       a                                          a                             
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CCTCTAAG------AGACAGTCATCCTCAGGCCATGCAGTGGAAtTCCACtGCcTTCCACCAAGCTCTGCAgGATCCCAG
     c              c           agca     ---c     aa t  t  t   a g  aa a  c    a
                                           c                                    
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                      *  **    * *  **             ** ** *      * *   *  * *   *
AGTCAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGAACAgTaAACCCTGcTCCgAATATTGCCTCTCACATCT
g    a   c      c c                a        t c c       t  aa c  c  ta        a 
                                              t             c                   
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *     * *   * ** *  **     *     *  *       **       *      * **  *     
CGTCAATCTCCgCGAGGACTGGGGACCCTGtgaCGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTG
 a    c    t   c  t           cacta c                      c     a              
                               tt                                               
                                g                                               

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **  * *   * **  * **    ** * ***  * ***  *  ***   *   ** ** **  * **   **     
TTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTT
                          a                                             g   
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                * *** * *** ***  *****    ******   ******** ** ***        *     
TCTAGGGGGatCACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAA
        acc ta         g                                             t          
         gg                                                                     
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **  *** * **    ***      *   * ** *  **  * ******** *** *    ** *** *  *  *  
TTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGC---TGCTATGCCTCATCTTC
c         c     t                                                               
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * **       *       *   *              *           * **         *     **      
TTATTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCaACAACAACCAGtACGGGACC
  g     a  g     c gc  g                                 a c     c     c      a 
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  * **       *** *     *   ***     ** ** ** ** ***     *  *  **  *  *   
aTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGAtGGAAATT
c    gg          g              c               c     t     c       t   c       
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** * *       ****    ** ***  ** ** **  * * ******  *  * *  ** *    ** *    * *
GCACCTGTATTCCCATCCCATCgTCcTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTC
    t                 a  t                t        gc          c         a      
                                                                         c      
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *   ** *   * * *  **  *  *    *        ** *      * *  *  *   *     *****    * 
AGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGcTATaTGGATGATGTGGTA
                               c   c              c       t  t   g        a c   
                                                                          t     
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *  *     **                    **   *     *     ***** *     *  ****  * **  *
tTGGGGGCCAAGTCTGTACAgCATCgTGAGtCCCTTTATACCGCTGTTACCAATTTTCTTTTGTCTcTGGGTATACATTT
c          aa   c   a  c t   ag      t            t           t   t         c 
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *       *** **       ***** **  *  *         **   *    ***    * ****      * **  
AAACCCTAACAAAACAAAaAGATGGGGTTATTCCCTAAAcTTCATGGGtTAcaTAATTGGAAGTTGGGGaACaTTGCCAC
   t           c  g        c      gc t  t     a  tg       c        tt tc a    
               t                    t           g                    g  g       
                                                c                               

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    *  *        *   * *     **  *          **  *  *     *    ** ****     ** ** 
AgGATCATATTGTACAAAAgATCAAACACTGTTTTAGAAAACTTCCTGTtAAcaGgCCTATTGATTGGAAAGTATGTCAa
 a         a g     ac t   agt     cc g     g  ca cg tc a   g c           g     g
                          t a                                          c      
                          g                                                   

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * *   *  *    *   * *      * *   * *  *  *  ** ** ** *  *  **  * **  *    **
AGaATTGTGGGTCTTTTGGGCTTTGCtGCtCCATTTACACAATGTGGaTAtCCTGCcTTAATGCCTTTGTATGCATGTAT
c g     a           a     c  a  c  c  c        t  c  g  a        cc a           
                          a  c  t              g        t                       
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  * *      * *        ** *     *      ** *  *          **       * *      * * 
ACAAGCtAAACAGGCTTTcACTTTCTCGCCAACTTACAAGGCCTTTCTAAGTAAACAGTAcATGAACCTTTACCCCGTTG
      g gg        t     t                       gca ccc  a  tc  g               
      a                                                                         
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** **    *   * ** *****    ** **  **   ***   ** * * *     *  * **    *   **
CtCGGCAACGGCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGcTGGGGCTTGGCcATaGGCCATCAGCGC
         t       a        a            t     g  t            c  a         
                   t                                             t            
                                                                              

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   *      *     **  *    * ** ***   *   ***  *            * *  * **   *   ***
ATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCcGCTTGTTTTGCTCGCAGCCGGTCTGG
     c                                               t  c     c         a       
                                                     a                          
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * **       ** ** *  *         *       *   *  *  * **        *  *  **  * 
AGCAAAgCTCATcGGaACTGAcAATTCTGTCGTCCTcTCgCGGAAATATACATCgTTTCCATGGCTGCTAGGcTGTACTG
g  g ca     a  g     t              t  t                                
      c     t  c                                                            
                                                                              

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***   *** ** *   * **                   **     * ****   *  *  * ** **       *  
CCAACTGGATcCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCtCGgGGCCGC
          t        a           c     t     a           t           t  ga a  t   
          a                                                           a  c      
                                                                      c         

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * *  *  **                                                       * ***   
TTGGGaCTCTcTCGTCCCCTTCTCCGTCTGCCGTtCCagCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTC
     ga g                       at gt                               a         
     c                                a                                         
     t                                                                          

      2490      2500      2510      2520      2530      2540      2550
....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  **    *  *   **                    ***  *                         
TGTGCCTTCTCATCTGCCGGtCCGTGTGCACTTCGCTTCACCTCTGCACGTTGCATGGAGACCACCGTGA
                    a              a                      ca          
                                                                      
                                                                      
© 1998-2020Legal notice