HBVdb

Dataset for nucleotide sequence Genomes of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                         *          * *             * *  **    * *  ***     
TTCCACtGCcTTCCACCAAGCTCTGCAgGATCCCAGAGTCAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGAA
c     aa t  t  t   a g  aa a       ag    a   c      c c                a        
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       ** ** *      * *   *  * *   *    *  **     * *   * ***** **     *     *  
CAgTaAACCCTGcTCCgAATATTGCCTCTCACATCTCGTCAATCTCCgCGAGGACTGGGGACCCTGtgaCGAACATGGAG
t c c g     t  aa c  c  ta        a  a    c    t   c  t           cact  c       
  t             c                                  a               tt           
                                                                    g           

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**      **       *  *   * **  *     ****  * **  * **  * **    ** * ***  * *** **
AACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
               c                                                a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *** *** * ** ** ** *****   **  **       **        * *** * *** ***  *****    **
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGatCACCCGTGTGTCTTGGCCAAAATTCGCAGTCCC
                              g           acc ta         g                    
                                             gg                                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****   ******** ** *** *   **** *  *  ***  *** * **    ****  ******** ** *  *** 
CAACCTCCAATCACTCACCAACCTCCTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATA
                                            c     t       a                   
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******** *** *    ** *** * ********  ****   *   **  *  **   * * **   *** * * *
TTCCTCTTCATCCTGC---TGCTATGCCTCATCTTCTTATTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGTTTGTCC
                                      g     a  g     c gc  g     a              
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         * ** *     * *     **        **   *  ****    * **** *     *   ***   * *
TCTAATTCCAGGATCaACAACAACCAGtACGGGACCaTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTTTC
             a c     c     c      a c    gg          g                          
               t                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** ** ****    *  *  **  *  *   **** ***    *  ****    ** ***  ** ** **  * *
CCTCATGTTGCTGTACAAAACCTACGGATGGAAATTGCACCTGTATTCCCATCCCATCgTCcTGGGCTTTCGCAAAATAC
    c     t     c       t   c           t                 a  t                t 
                                        a                                       
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*******  * ** ***** **** **** ** * ** **  ** *   * * ** ** **  ** * *       *** 
CTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCC
                 c         a                                     c            
                             c                                                  
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *  ***  ** ** **  * ******   **   ***  *     **    * ** *  *      ***   *   
CACTGTTTGGCTTTCAGcTATaTGGATGATGTGGTAtTGGGGGCCAAGTCTGTACAgCATCgTGAGtCCCTTTATACCGC
  t        c  t  t   g t      a c  tc          aa       a  c   ag      t      
                              t                                                 
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     ***** *     *  ****  * **  * *       *** **       ***** **  *  *       *
TGTTACCAATTTTCTTTTGTCTcTGGGTATACATTTAAACCCTAACAAAACAAAaAGATGGGGTTATTCCCTAAAcTTCA
      t               t         c    t           t  g        c      gc t  t 
                                                   c                    t       
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  **    *****  * ****   *  * **  * *  *  *        **  * *     ** **          
TGGGtTAcaTAATTGGAAGTTGGGGaACaTTGCCACAgGATCATATTGTACAAAAgATCAAAcACTGTTTTAGAAAACTT
    a  tg              tt tc a     a  g      a g     ac t   agt     cc g     g
    g                    g                                  t a               
    c                                                       g                 

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *  *  * **    *******   * ** **     * *   *  *  ****  * *  *   * *   * ** **
CCTGTtAAcaGgCCTATTGATTGGAAAGTATGTCAaAGaATTGTGGGTCTTTTGGGCTTTGCtGCtCCATTTACACAATG
  ca  tc a   g c           g     gc g     a              c  c  a  c  c        
                           c                                a  c              
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** ** ** ** *  **  * **  *    ** **  * *    *** *     *  ** *     *      ** 
TGGaTAtCCTGCcTTAATGCCTTTGTATGCATGTATACAAGCtAAACAGGCTTTcACTTTCTCGCCAACTTACAAGGCCT
   t  c  g  a        cc a             g gg        t     t                   
   g        t                             a                                     
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *          **       * ***  * * * *  * *****    *   * ** *****  **** **  ***  
TTCTAAGTAAACAGTAcATGAACCTTTACCCCGTTGCtCGGCAACGGCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACC
    gca ccc  a  tc  g                        t    c  a                     t
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***   ** ***** **  *  * ** *  * **** **   *      *   * **  *    * ** ***** ** **
CCCACTGGcTGGGGCTTGGCcATaGGCCATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGA
        t            c  a              c         a                            
                     t                                                        
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *  *  *  **  * ** ****   *   *** *      * ** ** ** ** ** *  **        *  *  
ACTCCTAGCcGCTTGTTTTGCTCGCAGCCGGTCTGGAGCAAAgCTCATcGGaACTGAcAATTCTGTCGTCCTcTCgCGGA
         t  c               a       g  g ca     a  g     t              t     
         a                                c     t  c                            
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *  *  * **  ** *  *  * ***  *  ***  **** ** *   * **                 * ** 
AATATACATCgTTTCCATGGCTGCTAGGcTGTACTGCCAACTGGATcCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCG
                        t               t        a           c     t     a
                          g                 a                                 
                                                                              

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ******  ** ** ** ** **       *   *     * *  ** ** ** **  * *   * *  *       
GCGCTGAATCCCGCGGACGACCCCTCtCGgGGCCGCTTGGGaCTCTcTCGTCCCCTTCTCCGTCTGCCGTtCCagCCGAC
           t           t  ga a  t  t     ga g                       at gt     
                          a  c           c  a                             a     
                          c              t                                      

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  **   *    * ***    ** **  * *  *   **                    **** 
CACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCATCTGCCGGtCCGTGTGCACTTCGCTTCACCTC
                          a                             a              a        
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**   *   * ***   **  *   *       *              ** **   * **  * *      *        
TGCACGTTGCATGGAGACCACCGTGA------ACGCCCATCAGATCCTGCCCAAGGTCTTACATAAGAGGACTCTTGGAC
              ca                       c  agg t              t     c            
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  ************* ** ******  *  * * * **   *******                
TCCCAGCAATGTCAACGACCGACCTTGAGGCCTACTTCAAAGACTGTGTGTTTAAgGACTGGGAGGAGcTGGGGGAGGAG
  t                            t             a   a     a           atc          
                               a                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                         **  *  **        **                                    
ATTAGGTTAAaGgTCTTTGTATTAGGAGGCTGTAGGCA---tAAATTGGTCTGCGCACCAgCAcCATGCAACTTTTTCAC
 cg   c   t a t a    c                   g           tt     t ct c              
 a                                                                              
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                       *  *    *  *** ***** * *  ****** * *  ** ***  * ****    *
CTCTGCCTAATCATCTCTTGTaCATGTCCCACTgTTCAAGCCTCCAAGCTGTGCCTTGGgTGGCTTTGGGGCATGGACAT
                 c   t       t   t                                a         
                                 c                                              
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***     ***  * *  **  *          **    *  *** *  *    *  *  *  **          **  
TGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCgTTTTTGCCTTCTGACTTCTTTCCTTCcGTCaGaGATC
c     g                  t   c   a     t  a         g    t  t      a cac g    
                                          t         c                   t       
                                                    a                           

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       **        *           *     *          *  **     *     * ** ** **     **
TcCTaGAcACcGCCTCAGCTCTgTATCGaGAAGCCTTAGAGTCTCCTGAGCATTGCTCACCTCACCATACtGCACTCAGG
 a  t  t  a  a        a t   g     ac    a  a  g        ta c  g  t     a   a     
 t  g        t                                                        c         
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *          * ****   *  *        *       **** **     **  *     *        *    **
CAAGCCATTCTCTGCTGGGGGGAATTgATGACTCTAGCTACCTGGGTGGGTAATAATTTGgAAGATCCAGCATCcAGGGA
      g  g a       t   tg a c  a     gct t        c c       c c  c at     a  a  
           t           gc                                                 t     
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *  *     ** * **           **  * *      *           **    *    ** *        
TCTAGTAGTcAATTATGTTAATACT-AACATGGGttTAAAgATcAGgCAACTATTGTGGTTTCATATaTCTTGCCTTACT
 ta      a        c         t     cc    a  t  a   t gc            ct     ta c   
         t                         a                               c            
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** *        *      * *  ** **    *  ** ** *** * *  ** ** *     **  *       **
TTTGGAAGAGAgACtGTaCTTGAaTATTTGGTCTCTTTcGGAGTGTGGATTCGCACTCCTCCAGCCTATAGACCACCAAA
  c      c agtg  c     g     a  t  c  t  g        a     a      c t        t   
           t     t              a                                a              
           c     g                                                              

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ********* ****    ***** **      * **  ****                   **     * *   * * *
TGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGgGACCG---AGGCAGGTCCCCTAGAAGAAGAA
                               g         t ta a g a       tc              c   
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *** **** ***  **  *       *** **   ****   *** **  **** **         ***** * * **
CTCCCTCGCCTCGCAGACGcAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGTATTCC
                   a           a                              c c            c  
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** *   ***  ** *        ** ** ** **          **    **  *       ***      **  
TTGGACTCATAAGGTGGGAAAcTTtACtGGGCTTTATTCcTCTACaGTaCCTATCTTTAATCCTGAATGGCAAACTCCTT
                  g  t  c  g  a  c  c  t     t  c   ggt     c   c c        c  
                                                g    a            t           
                                                t                               

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** **    ** **  *    *  *   *          **  *    ** *  **  *  *        * ** *  
CcTTTCCTAAgATTCATTTACAaGAgGACATTatTAATAGGTGTCAaCAATTTGTgGGCCCTCTcACTGTAAATGAAAAg
 t     a  a  c        t  a  tg  gccg c  a   g g     c  a      t    cg        a
       g  c           c         t                               a               
       c              g                                                         

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *   *  *   *** **  * *  *  *        *  *  **     *  *  * *   * ** **   
AGAAGAtTgAAATTAATTATGCCTGCTAGaTTcTATCCTAcCcaCACtAAATATTTgCCctTAGACAAAGGaATTAAACC
  g   c a  g   c     c     g  t  c    atagt  c  g  c  a  tc gc t     g        
                                               a        c                     
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * **               * **** ** **  *  *    ** *** *  * *  **  **      **  *  * *
TTATTATCCaGATCAgGTAGTTAATCATTACTTcCAaACCaGACATTATTTACATACTCTTTGGAAGGCTGGtATTCTAT
         t  a  ta g           t  ta gg tc                    g   g      
            c  a                                                              
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *          *  *     *  * **       *  **    **     ******* *    *               
ATAAGAGGGAAACcACACGTAGCGCaTCATTTTGCGGGTCACCATATTCTTGGGAACAAGAGCTACAgCATGGGAGGTTG
     c a   t  t        c     c  t           c  c                 t            
                         t                                                      
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             * *    *   * *    **             ** *    *** *   * ***   *  **  ***
GTCAtCAAAACCTCGCAAAGGCATGGGGACGAAtCTTTCTGTTCCCAAcCCTCTGGGATTCTTTCCCGATCATCAGTTGG
 at c c c                     a  c  a  g  ct a  t  g         c             ac   
    g g                             g                                           
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  *** * *  **  *    **    **  ** *    **      **        **  *          *  
ACCCTGCATTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCATCAAGGACCACTGGCCAgcAGCCAAcCAG
 t  g                     c                 a gc   a  t  t      ca      t  a
    c                                              a                a           
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *   *     *   * **  *     * ** **    ** **  *    *   **   *  **  *    *    
GTAGGAGTGGGAGCATTCGGGCCAGGGtTCACcCCtCCACACGGcGGTgTTTTGGGGTGGAGCCCTCAGGCTCAGGGCAT
  g              t  c      c    t  c        a   a cc                      a    c
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                               *      ******                 ** ** *****     *  
ATTGaCcACAGTGtCAaCAaTTCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACTCCCATCTCTCCAC
gc  g t  tt  c ggt g g     ca        g           a     c a     c  a     t       
      a                                                                         
                                                                                

      3210      3220      3230      3240   
....:....|....:....|....:....|....:....|...
                    *  ** *             *  
CTCTAAG------AGACAGTCATCCTCAGGCCATGCAGTGGAA
    c              c           agca        
                                           
                                           
© 1998-2020Legal notice