HBVdb

Dataset for nucleotide sequence Genomes of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                                                      *  **    * *  ***     
TTCCACtGCcTTCCACCAAGCTCTGCAgGATCCCAGAGTCAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGAA
c     aa t  t  t   a g  aa a       ag    a   c      c c                a        
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * **        * *   *  *              *     * *   * ** *  **     *     *  
CAgTaAACCCTGcTCCgAATATTGCCTCTCACATCTCGTCAATCTCCgCGAGGACTGGGGACCCTGtgaCGAACATGGAG
t c c g     t  aa c  c  ta        a  a    c    t   c  t           cact  c       
  t             c                                  a               tt           
                                                                    g           

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       **       *  *   * **  *     * **  * **  * **  * **    ** * ***  * *** **
AACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
               c     a                                          a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *** ***   ** ** **    **    *  **       *         * *** * *** ***  *****    **
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGatCACCCGTGTGTCTTGGCCAAAATTCGCAGTCCC
                              g           acc ta         g                    
                                             gg                                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****   ******** ** ***      * *        **  *** * **    ***      *   * ** *  **  
CAACCTCCAATCACTCACCAACCTCCTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATA
                         t          c         c     t       a                   
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***** ** *** *    ** *** *  * **     * **       *       *   *              *  
TTCCTCTTCATCCTGC---TGCTATGCCTCATCTTCTTATTGGTTCTTCTGGATTAtCAAGGTATGTTGCCCGTTTGTCC
                                      g     a  g     c gc  g          g         
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         * **         *     **             *  ****        ** *     *   ***   * *
TCTAATTCCAGGATCaACAACAACCAGtACGGGACCaTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTTTC
    c        a c     c     c      a c    gg          g                          
               t                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** ** ****    *  *  **  *  *   **** * *    *  ****    ** ***  ** ** **  * *
CCTCATGTTGCTGTACAAAACCTACGGATGGAAATTGCACCTGTATTCCCATCCCATCgTCcTGGGCTTTCGCAAAATAC
    c     t     c       t   c           t                 a  t                t 
                                        a                                       
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*******  *  * ***** ** * **** ** * ** **  ** *   * * *  **  *  *  * *        ** 
CTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCC
                 c         a                                     c            
                             c                                                  
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *  ***  ** **  *  *  ****    **     *  *     **    * ** *  *      ***   *   
CACTGTTTGGCTTTCAGcTATaTGGATGATGTGGTAtTGGGGGCCAAGTCTGTACAgCATCgTGAGtCCCTTTATACCGC
  t        c  t    g        a c  tc          aa       a  c   ag      t      
                              t                                                 
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     ***** *     *  ****  * **  * *       *** *         **** **  *  *        
TGTTACCAATTTTCTTTTGTCTcTGGGTATACATTTAAACCCTAACAAAACAAAaAGATGGGGTTATTCCCTaAAcTTCA
      t               t         c    t           t  g  g     c      gc t  t 
                                                   c                    t       
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  **    * *      ****   *  * **  *    *  *        *   * *     ** **          
TGGGtTAcaTAATTGGAAGTTGGGGaACaTTGCCACAgGATCATATTGTACAAAAgATCAAAcACTGTTTTAGAAAACTT
    a  tg       c        tt tc a     a  g      a g     ac t   agt     cc g     g
    g                    g                                  t a               
    c                                                       g                 

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *  *     *    *******     ** **     * *   *  *    **  * *      * *   * ** **
CCTGTtAAcaGgCCTATTGATTGGAAAGTATGTCAaAGaATTGTGGGTCTTTTGGGCTTTGCtGCtCCATTTACACAATG
  ca  tc a   g c           g     gc g     a              c  c  a  c  c        
                           c                                a  c              
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** ** ** ** *  **  * **  *    ** **  * *    * * *     *  ** *     *      ** 
TGGaTAtCCTGCcTTAATGCCTTTGTATGCATGTATACAAGCtAAACAGGCTTTcACTTTCTCGCCAACTTACAAGGCCT
   t  c  g  a        cc a               g gg        t     t                   
   g        t                             a                                     
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *          **       * * *  * * * *  * ** **    *     ** *****  * ** **  ***  
TTCTAAGTAAACAGTAcATGAACCTTTACCCCGTTGCtCGGCAACGGCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACC
    gca ccc  a  tc  g                        t    c  a                     t
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***   ** ***** **  *  * ** *  * **** **   *      *   * **  *      ** ***** ** **
CCCACTGGcTGGGGCTTGGCcATaGGCCATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGA
        t            c  a              c                                      
                     t                                                        
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *  *  *   *  * ** ***    *    ** *      * **  *     * ** *  *         *     
ACTCCTAGCcGCTTGTTTTGCTCGCAGCCGGTCTGGAGCAAAgCTCATcGGaACTGAcAATTCTGTCGTCCTcTCgCGGA
         t  c               a       g  g ca      g     t              t  t    
         a                                c      c                            
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *  *  * **        *  * ***  *  ***   *** ** *   * **                 * ** 
AATATACATCgTTTCCATGGCTGCTAGGcTGTACTGCCAACTGGATcCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCG
                        t               t        a           c     t     a
                          g                 a                                 
                                                                              

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ******   * ** ** ** **       *   *     * *  ** ** ** **  * *   * *  *       
GCGCTGAATCCCGCGGACGACCCCTCtCGgGGCCGCTTGGGaCTCTcTCGTCCCCTTCTCCGTCTGCCGTtCCagCCGAC
           t           t  ga a  t  t     ga g                       at gt     
                          a  c           c                                a     
                          c              t                                      

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   *   *    * ***    ** **    *  *   **                    **** 
CACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCATCTGCCGGtCCGTGTGCACTTCGCTTCACCTC
                          a                             a              a        
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**   *   * ***    *  *   *       *              ** **   * **  * *      *        
TGCACGTTGCATGGAGACCACCGTGA------ACGCCCATCAGATCCTGCCCAAGGTCTTACATAAGAGGACTCTTGGAC
              ca                       c  agg t              t     c            
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  ************* *  ******  *  * * * **   **** **                
TCCCAGCAATGTCAACGACCGACCTTGAGGCCTACTTCAAAGACTGTGTGTTTAAgGACTGGGAGGAGcTGGGGGAGGAG
  t                            t             a   a     a           atc          
                               a                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                 **     **        **            
ATTAGGTTAAaGgTCTTTG------------T------------ATTAGGAGGCTGTAGGCA---tAAATTGGTCTGCGC
 cg   c   t a t a                            c                   g           tt 
 a                                                                              
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *  *    *  **  ***** * *  ****** 
ACCAgCAcCATGCAACTTTTTCACCTCTGCCTAATCATCTCTTGTaCATGTCCCACTgTTCAAGCCTCCAAGCTGTGCCT
    ttct c                               c   t       t   t                      
      t                                                  c                      
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *  ** ***  * ****    * ***     * *  * *  **  *          **       *** *  *    *
TGGgTGGCTTTGGGGCATGGACATTGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCgTTTTTGCCTTCTG
          a         c     g                  t   c   a     t  a         ca  
                                                                t         g   
                                                                            a   

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  **           *  *       **        *           *     *          *  **    
ACTTCTTTCCTTCcGTCaGaGATCTcCTaGAcACcGCCTCAGCTCTgTATCGgGAAGCCTTAGAGTCTCCTGAGCATTGC
 t  t      a cac g     a  t  t  a  a      t a t   a     ac g  a  a  g        t
                t        t  g        t                                          
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     * **  * **     **             * ****   *           *       **** **     **
TCACCTCACCATACtGCACTCAGGCAAGCCATTCTCTGCTGGGGGGAATTgATGACTCTAGCTACCTGGGTGGGTAATAA
a c  g  t     a   a           g  g a       t   tg a c  a     gct t        c c   
  t           c                    t           gc                               
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *             **     *  *     ** * **           **  * *      *          
TTTGgAAGATCCAGCATCcAGGGATCTAGTAGTcAATTATGTTAATACT-AACATGGGttTAAAgATcAGgCAACTATTG
    c c  c at     a  a   ta      a        c         t     cc    a  t  a   t g   
                  t              t                         a                    
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **    *    ** *        ** ** *        *      * *  ** **    *  ** *  *** * *    
TGGTTTCATATaTCTTGCCTTACTTTTGGAAGAGAgACtGTaCTTGAaTATTTGGTCTCTTTcGGAGTGTGGATTCGCAC
          ct  c  ta c     c      c agtg  c     g     a  t  c  t  g        a     
           c                       t     g              a                       
                                   c     t                                      

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **       **          ** ********* ****    ***** **      * **  * **             
TCCTCCAGCCTATAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGgGACCG--
a      c t  c       t                                  g         t ta a g a   
         a                                                                      
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *     *     * * ** **  **** ***   *           ** **   ** *     * **  ****
-AGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGcAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCT
    tc              c                      a           a                        
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **          ***  * * ** ** ** *   ***  ** *        ** ** ** **          **    *
CGGGAATCTCAATGTTAGTATTCCTTGGACTCATAAGGTGGGAAAcTTtACtGGGCTTTATTCcTCTACaGTaCCTATCT
      c c            c                    g  t  c  g  a  c  c  t     t  c   gat 
                                                                        g    g  
                                                                        t       

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *       ***      **    ** *     ** **  *    *      *          **  *    *     
TTAATCCTGAATGGCAAACTCCTTCcTTTCCTAAgATTCATTTACAaGAgGACATTatTAATAGGTGTCAaCAATTTGTg
    c     c     g  c  c  t     a  a  c        t  a  t   gccg c  a   g g     c  a
          t           g        g  c           c         t                       
                               c              g                                 

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *  *        * ** *           *      *   *** *   * *  *  *        *  *  **   
GGCCCTCTcACTGTAAATGAAAAgAGAAGAtTgAAATTAATTATGCCTGCTAGaTTcTATCCTAcCcaCACtAAATATTT
      t  c cg        a  g   c a  g  g  c     c     g  t  c    atagt  c  g  c  
        a                                                           a  a        
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  * *   * ** **     *  *               * * ** **  *  *  *    ** *** *  * *
gCCctTAGACAAAGGaATTAAACCTTATTATCCaGATCAgGTAGTTAATCATTACTTcCAaACCaGACATTATTTACATA
 tc gc t     g     g           t  a  ta g            ta gg tc             
                                c  a                                        
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  **      **  *  * *            *  *     *  * **       *  **    **     *****
CTCTTTGGAAGGCTGGtATTCTATATAAGAGGGAAACcACACGTAGCGCaTCATTTTGCGGGTCACCATATTCTTGGGAA
           g           c a   t  t        c     c  t           c  c      
                                               t                              
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *    *                            * *    *   * *    **             *  *    **
CAAGAGCTACAgCATGGGAGGTTGGTCAtCAAAACCTCGCAAAGGCATGGGGACGAAtCTTTCTGTTCCCAAcCCTCTGG
           t   ----------at-c-c c                        c  a  g  ct a  t  g    
                         -- g g                             g                   
                            - -                                                 

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *   * ***   *  **  ***  *  *  **    *  **  *     *    **  ** *    **      **  
GATTCTTTCCCGATCATCAGTTGGACCCTGCATTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCATCAAG
     c             ac    t  g                     c               t a gc   a
                            c                                                   
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **  *          *   *   *   *         * **  *     * ** **    **  *       * 
GACCACTGGCCAgcAGCCAAcCAGGTAGGAGTGGGAGCATTCGGGCCAGGGtTCACcCCtCCACACGGcGGTgTTTTGGG
  t  t      cag     t     g              t  c      c    t  c          a cc    
            a                                                                   
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *    *  **  *    *                                   *       *****            
GTGGAGCCCTCAGGCTCAGGGCATATTGaCcACAGTGtCAaCAaTTCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAA
                       cgc  g t  tt  c ggt g g     ca        g           a     c
                              a                                                 
                                                                                

      3210      3220      3230      3240      3250      3260       
....:....|....:....|....:....|....:....|....:....|....:....|....:..
     ** ** * * *     *                      *  **                  
GGCAGCCTACTCCCATCTCTCCACCTCTAAG------AGACAGTCATCCTCAGGCCATGCAGTGGAA
 a     c  a     t           c              c           agca     ---
                                                                   
                                                                   
© 1998-2022Legal notice