HBVdb

Dataset for nucleotide sequence P of genotype RF

[Download (right click)] [Alignment] [Repertoires]

928 sequence(s)

>gnl|hbvcds|AB031265_P_P-RF-CB Feature FT:CDS AB031265_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV VietF-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacatacatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcacaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacag
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctactagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctamttccaggawcatcaacyaccagcacsggaccatgcarracctgcacgay
tcctgctcaaggaacctctatgtttccctcwtgttgctgtacaaaacctwcggacggaaaytgcacytgtattcccatcc
catcatcttgggctttcgcaaratwcctatgggagtgggcctcagtccgtttctcytggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgactccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaccaaaaccaa
acgttggggctacacccttaactttatgggatatgtaattggaagttggggcaccttaccacaggaacatattgtacaca
aaatcaaacactgttttcggaaacttcctattaatagacctattgattggaaagtatgtcaacgcattgtggggcttctg
ggatttgccgctccttttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaarcaggcttt
yactttctcgccaacttacaaggcctttctgwrtmaacartatctgaacctttaccccgttgctcggcaacggtcwggtc
twtgccaagtgtttgctgacgcaacccccactggytggggcttggccataggccatcagcgcatgcgyggaacctttgtg
kctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctgtcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033557_P_P-RF-CB Feature FT:CDS AB033557_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IWK146). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttcttccgtacctgtctttaatcctgattggcaaactccctcctttcct
catattcatttacaggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaataatgcctgctaggttctaccctaacattaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacgacattccaccaagctctgctagatcccagagtgaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcatcgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacctcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggccttcagctatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaa
acgttggggctactccctcaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactca
aaatcaaacaatgttttcggaaactgcctgttaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgccaggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagctgcttgtttcgctcgcagccggtctggagcgaatcttatcggcac
tgacaactctgttgtcctgtctcggaaatacaccgccttcccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033558_P_P-RF-DE Feature FT:CDS AB033558_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate JYW796). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttcttctgtacctgtatttaaccctcattggaaaacaccaacttttcct
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttacggtcaatgagaaaagaagatt
gcaattgataatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcccctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctaagagacgctcatcctcaggccatgcagtggacttcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccttgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccattgtt
tggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaacgaaaagatggggttattctcttcacttcatggggta
tgtcattggtagttggggatccttaccacaagatcacattgtacacaagctaaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtgggtat
cctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctata
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggctatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctcttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB033559_P_P-RF-DE Feature FT:CDS AB033559_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate PYW310). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
ggtggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB048702_P_P-RF-DE Feature FT:CDS AB048702_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtcttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgacagtcaggacggcagcctaccccgctgtcgccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtttctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggaagttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
acaggcctattgattggaaagtgtgccaacgaattgtgggtcttctgggttttgctgcccctttcacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccacactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggccctgtcgtcctcttctccgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB048703_P_P-RF-DE Feature FT:CDS AB048703_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtcttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgacagtcaggacggcagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggaagttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
acaggcctattgattggaaagtgcgccaacgaattgtgggtctaccgggttttgctgcccctttcacgcaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccacactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggccctgtcgtcctcttctccgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB049609_P_P-RF-CB Feature FT:CDS AB049609_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV AN28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccc
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatc
ctgaacaggcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcaattggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcacgtaggagc
gggagcattcgggccagggttcaccccaccacacgggggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttctacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactga
aaatcaagcaatgttttcggaaactgcctgtaaataggcctattgattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttttgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaagtctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccatctcgtctccc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB105172_P_P-RF-CB Feature FT:CDS AB105172_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hawaii 2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacccgtctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattatcaatagatgtcagcaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaatcatgcctgctaggttctatcctaatcttaccaaatacttgccattagataagggcattaaaccttattatc
ctgatcatgcagttaatcattacttcaaaactagacattatttacatactctatggaaggctggtattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaacccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggaac
gggagcattcgggccagggttcacacccccacacggaggtcttttggggtggagccctcaggctcagggcatagtgacga
cagtgccagcagtgcctcctcctgcctcaaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaatttccaccaagctctgctagatcccagagtgagaggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccctgccacaggaacatattgtactaa
aaatcaaacagtgttttcgaaaacttcctgtaaatcggcctattgattggaaggtgtgtcaaagaattgtgggacttttg
ggatttgctgctcctttcacacaatgtgggtatcctgctctcatgcctttgtatgcatgtatacacactaaacaggcttt
cactttttcgccaacttacaaggcctttctgtatcaacaatatctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctttaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaattctgttgtcctctctcggaaatacacctcctttccatggctgctaggttgtgctgccaactggatactgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
ctacttcgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB188243_P_P-RF-DE Feature FT:CDS AB188243_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate KAMCHATKA27). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacgggactttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcca
aatatacatttacaccaagacattatcaaaaaatgtgagcagtttgtaggtccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattatttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggccgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgcaaacaaatccgcctcctgcctctacca
atcgcaagttgggaaggcagcctaccccgctgtctccaccattgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
aatctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaat
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtc
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttactcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcctgcgtggaacctttcgggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactcggttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB188245_P_P-RF-DE Feature FT:CDS AB188245_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ALTAY136). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccttcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacatactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttctggggtggagccctcaggctcagggcatactacaaacgttgccagcaaatccacctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacagtacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttggggatctctcgtccccttctctgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB194949_P_P-RF-AE Feature FT:CDS AB194949_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate CMR151). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtggggaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaacagcaccaaatatttgccactagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttcgt
caccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggactacaaccccatcaaagaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacggtgccagcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacct
ctaagagacagtcatccgcaggccgtgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccatgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgcttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttatgtaattggaagttgggggtcattacctcaggaacacatca
gaatgaaaatcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggt
cttttgggctttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttat
cgggactgataattctgtcgtcctttcccggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctat
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195939_P_P-RF-CB Feature FT:CDS AB195939_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatacctctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aactcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195940_P_P-RF-CB Feature FT:CDS AB195940_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatacctctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aactcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195941_P_P-RF-CB Feature FT:CDS AB195941_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatacctctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aactcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195950_P_P-RF-CB Feature FT:CDS AB195950_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcgaagcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcccttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgtcaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactcagttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggcctaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195951_P_P-RF-CB Feature FT:CDS AB195951_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcgaagcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcccttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgtcaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactcagttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggcctaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195955_P_P-RF-CB Feature FT:CDS AB195955_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aaatcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195956_P_P-RF-CB Feature FT:CDS AB195956_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaatatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aaatcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaggcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195957_P_P-RF-CB Feature FT:CDS AB195957_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaatatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aaatcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatccaggcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198084_P_P-RF-CB Feature FT:CDS AB198084_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
cggaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctgtattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcgagaacatattgtaatga
aaatcaagcaatcttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcctgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205152_P_P-RF-CB Feature FT:CDS AB205152_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HB-JFH7-99). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacgsaaactgcacttgtattcccatcc
catcrtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaatyggaagttggggtactttaccacaggaacatattgtattaa
aaattaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgctttgatgcctttgtatgcatgtatacaatctaagcaggcctt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB210819_P_P-RF-DE Feature FT:CDS AB210819_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtggggaattttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttctggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgacgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB222708_P_P-RF-AD Feature FT:CDS AB222708_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate UZBV74). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcc
tttcctaagatycatttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaggag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcctttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattactttcaagccagacattatttgcatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatctttttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttactctttacatttcatgggctatgtcattggatgttatgggtcattgccacaagatcacatca
tacaaaaaatcaaasaatgctttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaacgtattgtgggt
cttttgggttttgctgccccttttacacaatgtggttatcctgctttaaagcccttgtatgcatgtattcagtcgaagca
ggcttttactttctcgccaacttacaaggcctttctatgtaaccaatacctgaacctttaccccgttgcccggcaacggc
caggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacc
ttcttggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattct
cgggacggataactcggttgttctctcccgcaaatatacatcgtatccatggctgctaggctstgctgccaactggatcc
tgcgcgtaaattggtctgttaacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgaacctctctttacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB241109_P_P-RF-CB Feature FT:CDS AB241109_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate PhCH24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttacggggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcct
gatatacatttgcaggaggacattattaatagatgtcaacaatttgtgggtccgcttactgtaaatgaaaaaaggagact
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgagcatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
tggagcattcgggccagggttcacaccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaagatcatattctactaa
aaatcaagcaatgttttcgaaaactccctgttaatcgaccgatagattggaaagtatgccaaagaattgtgggtcttttg
ggctttgttgccccttttacacaatgtggttatcctgcattactgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaagacttttctgtgtaaacaatatctgaccctttaccccgttgcccggcaacggccaggtc
tatgccaagtatttgctgacgcaacccccactggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcataggaac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggtcgcttggggctctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB270535_P_P-RF-DC Feature FT:CDS AB270535_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate MGL50F). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaagtaggagc
gggagcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagrgtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggcactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgaagcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggtctctaccgtccc
cttcttcctctgccgttccggccacccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctacacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB270538_P_P-RF-DE Feature FT:CDS AB270538_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MGL231F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtgggcccactaacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggaattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagccgaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggcccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacagaaaatcaaagattgctttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtggatat
cctgctctaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttataaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcctgttttgctcgcagcaggtctggagcaaacattctcgggactgacaattcagttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgttccgcccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB300369_P_P-RF-CB Feature FT:CDS AB300369_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttctatcctaaacttacaaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcaattaatcattacttcaaaactaggcattatttacatactctgtgggaggctggcattctatataagaga
gaaactacacacagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtgggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactcaacaacattccaacaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccacattgtttggctttcagttatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggttattcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcatagcggcttgttttgctcgcagccggtctggagcgaaacttattgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctttctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB330368_P_P-RF-DA Feature FT:CDS AB330368_P_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate TAJ54HBV). Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttct
tttcctaatatacatttacaccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagttaatgagaaaag
aagactgcaattgattatgcctgctagattttatccaaatgtcaccaaatatttgccattggataagggtattaaaccct
attatccagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatat
aagagagaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatc
tttccaccagcaatcctctgggagtctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagat
tgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagccttcgggccgggattcacccc
accgcacggaggccttttagggtggagccctcaggctcagggcatgctactaaccttgccagcaaatccgccgcctgcct
ccaccaatcgccagtcagggaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtgg
aactccacagccttccaccaagctctgcaggatcccagagtgagaggcctgtatttccctgctggtggctccagttcagg
aacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatgg
agaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccgcagagtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatcc
ctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcc
tatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgct
gttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcat
gggctatgtcattggatgttatggctcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttc
ctgttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgt
ggttatcctgctttaaagcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaagacctt
tctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccc
ccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcagaa
ctcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaa
atttacatcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgg
cgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgacc
acggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctct
gcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367393_P_P-RF-CB Feature FT:CDS AB367393_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 2/Adefovir-treated Pt. 2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
agacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggccctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367400_P_P-RF-CB Feature FT:CDS AB367400_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 9). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattga
aaatcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcaccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367419_P_P-RF-CB Feature FT:CDS AB367419_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctagattctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcagatcaggtgggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggaggagccctcaggctcagggcatattgacaa
cagtgccagctgcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttctctttgggtatacatttgaaccctaataaaaccaa
acgctggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367800_P_P-RF-CB Feature FT:CDS AB367800_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ADVT Pt. 24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttagaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcaggtctttcccccactgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
agatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacccaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacgtacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB453985_P_P-RF-AC Feature FT:CDS AB453985_P_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate JPN_CH7). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgacaggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatcctgatcaggtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacaggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcaaaa
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacgtaattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgctttgctcgcagccggtctggagcaaagatcat
cggaactgacaactctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB493837_P_P-RF-CB Feature FT:CDS AB493837_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 03UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatgcagtggaactccacagcattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtacaccctgttccgactattgcctctcccatctcgtcaatcttcttga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cggcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaatcctaacaaaactaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaccatattgtactaa
aaatcaagcagtgttttcggaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtctggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggcattaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaattccgttgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgactggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493838_P_P-RF-CB Feature FT:CDS AB493838_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 06UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatgctgagtggcaaactccctcttttcct
gacattcatttgaaggaggacattatccataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaacccagattgggacttcaaccccaacaaggaccattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctgaca
gacagtcaccctcaggccatgcagtggaactccacagcattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctcacccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaa
acgatggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtattaa
aaatcaagcagtgttttcgaaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacgtacaaggccttcctgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctttaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatacggcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaattctgttgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgcttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493840_P_P-RF-CB Feature FT:CDS AB493840_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 16UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactcaacctgtctttaatactgagtggcaaactccttcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaagcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatgcagtggaactccacagcattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggattggggaccctgcacagaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacctcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctcacaaaactaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtattaa
aaatcaagcagtgttttcggaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgcccctttcacacaatgtgggtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
cgacaattctgttgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493842_P_P-RF-CB Feature FT:CDS AB493842_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 31UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaaccccctcttttcct
gacattcatttgaaggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagatt
aaaattaattatgcctgcccggttctatcctaaccttaccaagtacttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaacaagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacgttccaccaagctctgttagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacggggccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctata
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaactaa
acggtggggatactcccttcacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactta
aaatcaagcagtgttttcgaaaacttcctgtaaatagacctattgattggaaggtgtgtcaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatccaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgtggtcctctctcggaaatacacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccaactacggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgcc
gacccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493847_P_P-RF-CB Feature FT:CDS AB493847_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 05UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatgctgagtggcaaactccctcttttcct
gacattcatttgaaggaggacattatccataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaacccagattgggacttcaaccccaacaaggaccattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatgcagtggaactccacagcattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctcacccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaa
acgatggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtattaa
aaatcaagcagtgttttcgaaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacgtacaaggccttcctgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctttaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatacggcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaattctgttgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgcttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB583679_P_P-RF-DE Feature FT:CDS AB583679_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Pkst8134). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacccacttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagatt
gcaattgattatgcctgctaggttctatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctgaattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgcaccctttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccctgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttaaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactgtcacgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB642096_P_P-RF-CB Feature FT:CDS AB642096_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BFJT2000-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttactatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccataytcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaaaaaggatcactggccagrggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttktggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagacaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
rcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccttcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670303_P_P-RF-CB Feature FT:CDS AB670303_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Non-HCC pt No.30). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggaaaaaggcattaaaccatattatc
cggaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttgggggggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctyccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttcacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatccggccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtg
tctgccaagtgtttgctgacgcaacccccactggttggggcttggctattggccatcagcgcatgcgtggaaccttcgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB674432_P_P-RF-DE Feature FT:CDS AB674432_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD90). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactaacaaccgtgccaacaaatccgcctcccgcctctacca
atcgccagtcaggaaggcagcctacgccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagattgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgaagcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccgtcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtgctttcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674433_P_P-RF-DE Feature FT:CDS AB674433_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD37). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcccgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaacattccaccaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacacatcatcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctttcccgcaaatatac
atcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674436_P_P-RF-DE Feature FT:CDS AB674436_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaactctcattggaaaacaccctcttttcct
aatatacatttacaccaagaccttatcaaaaaatgtgaacgatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcggactgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttccacca
atcgccagtcaggacggcagcctaccccgctgtcgccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgcacaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgtcatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgttc
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gttggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagctggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674504_P_P-RF-DC Feature FT:CDS AB674504_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 11B18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcggaccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctaaga
gacactcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccatttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaataaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggaaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcggaaacttcctacaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaggcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctttctcggaaatacaccgcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
gaacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB933279_P_P-RF-AG Feature FT:CDS AB933279_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2008). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatct
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgagga
ctggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccat
cgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattgtacaaaaga
tcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgctccttttacccaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB933280_P_P-RF-AG Feature FT:CDS AB933280_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Tk/JP/2009). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatct
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgagga
ctggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccat
cgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattgtacaaaaga
tcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgctccttttacccaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB933281_P_P-RF-AG Feature FT:CDS AB933281_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2010). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatct
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgagga
ctggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccat
cgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattgtacaaaaga
tcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgctccttttacccaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB933282_P_P-RF-AG Feature FT:CDS AB933282_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2011). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaacccctaacaa
aacaaaagatgggggttattccctaaacttcatgggttacataattggaagttggggaagtttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB933283_P_P-RF-AG Feature FT:CDS AB933283_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2013). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacsggaccgasgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcasaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggaytggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
akyrcccgtgtgtcytggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttrttggttctt
ctggaytatcaaggtatgttgcccgtttgtcctctrattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtwtccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtytggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcktgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaackttgccacaggatcatattg
tacaaaagatcaaacactgtttyagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctckcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccakccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AF233236_P_P-RF-CB Feature FT:CDS AF233236_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV334). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtaccccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
ggaactacacgaagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccagggtatgttgcccgtttgtcctctacttccaggaacctcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactta
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AF297619_P_P-RF-DA Feature FT:CDS AF297619_P_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 41). Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatggggacgaatc
tttcaccaggcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagat
tgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggcctggtttcacccc
accgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcct
ccaccaatcgccagtcaggaaggcagcctactcccatgtctccacctttgagaaacactcatcctcaggccatgcagtgg
aattccactgccttgcaccaagctctgcaggatcccagagacaggggtctgtatttccctgctggtggctccagttcagg
aacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatgg
agaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttcc
ctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacc
tatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgct
gttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcat
gggttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttc
ctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgt
ggatatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctt
tctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccc
ccactggctggggcttagccatagaccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaa
ctcctagccgcttgttttgctcgcagccggtctggggcaaagctcatcggaactgacaattctgtcgtcctctcgcggaa
atatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcgg
cgctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgacc
acggggcgcacctctctttacgcagactccccgtctgtgccttctcatctgccggaccgtgtacacttcgcttcacctct
gcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF297620_P_P-RF-DA Feature FT:CDS AF297620_P_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 57). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggca
tggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaca
acaaatccagattgggacttcaatcccaacaaggaccactggccagaagccaacaaggtaggagttggagcatttcgggc
tggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatc
cgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcag
gccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtgg
ctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctg
cgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttcttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcatgactactgctcaaggaac
ctctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctt
tcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtcc
ctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattc
cctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgtt
ttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctcca
tttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaac
ttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttagccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgt
cctctcgcggaaatatacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF330110_P_P-RF-CB Feature FT:CDS AF330110_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 975484). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaatatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgay
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactctcttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF411409_P_P-RF-CB Feature FT:CDS AF411409_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaagctactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaacgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaaccacacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtcca
aacctcgacacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggaaccctcaggctcagggcatattgaaaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
cctccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggctgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccagtttacaaggcctttctatgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461361_P_P-RF-CB Feature FT:CDS AF461361_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate FH3Q). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactnttcctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattctggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccaccacattccaccaagctctgctagaccccagagtgaggggccttcc
tgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactg
gggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtg
tcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccag
ggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgc
tcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcat
cctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttttacctctattaccaattttcttttgtctttgggtatacagttgaaccctaataaaaccaaacgttg
gggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatca
agcaatgttttcgcaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgcc
aagtgtttgctgatgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcggaacttatcggaaccgacaa
ctctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgt
cctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctt
cgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AJ344117_P_P-RF-DE Feature FT:CDS AJ344117_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacatcatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cacaacatctagttaatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccctttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627217_P_P-RF-DE Feature FT:CDS AJ627217_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 20953). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagatt
gcaattgatcatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatatccttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagccaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccacctca
cggaggccttytggggtggagcccgcaggctcagggcataatacaaacgttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcaccataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaagcgatggggttattccctaaattttatgggtta
tgtcattggatgttatggatcattgccgcaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627221_P_P-RF-DE Feature FT:CDS AJ627221_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 30125). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttagtattccttggactc
ataaggtggggaactttactggtctttattcttctaatgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtrtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccacagtgagaggcctgaatttccctgctggtggctccagttcaggagcagt
aaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatmttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggaccatgccgaacctgcatgactactgctcacggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatrtggtattgggggccaagtctgtatcccatcttgaggccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcagacacaaaatcaaagaatgtttcagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgcg
tcaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccaaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AM494716_P_P-RF-DE Feature FT:CDS AM494716_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate CAR175). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgcacctgtctttaaccctcagtggaaaacaccctcttttcca
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
aaaattgattatgcctgctaggttctatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggatacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctactccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactct
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttatcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcaggggaccatgcagaacctgcacgactcctgctcaaggaacctctatgcatccctcttg
ttgctgtacaaaactttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaacttcctatggg
tgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaagagatggggttattctctacatttcatgggtta
tgtcattggatgttggggatcattgccgcaagatcatatcatacacaaaatcaaagaatgtttccgtaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtattctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgccattatatgcatgtattcaatcaaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctccgcctgccgttccgaccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AP011102_P_P-RF-CB Feature FT:CDS AP011102_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccttcttttcct
gacattcatttacaggaggatataatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagatt
aaaattaattatgcctgctaggttctatcctaacctcaccaaatacttaccgttagacaagggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaacgaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatccgctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaaacaagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcatttgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagctgcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttcttga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccaccacaggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactga
aaatcaaacattgttttcgaaaacttcctgtaaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatatcagctaagcaggcttt
cactttctcgccaacttacaaggccttcctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtctggtt
tctgccaagtgtttgctgacgcaacccccactggctggggcttggcattaggccagcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattatcggtac
cgacaactctgttgtcctctctcgcaaatacacctcatttccatggctgctaggctgtgctgccaactggatactgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggggtctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011103_P_P-RF-CB Feature FT:CDS AP011103_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcatttacaggaagacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaagcgaagatt
aaaattaattatgcctgctaggttctttcccaaccttactaaatacttgccattagataaaggcattaaaccttattatc
cagaacatgcagttaatcattacttcaaaactaggcattatttacatactctctggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggcgcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgcacaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgatggggctacacccttaacttcatgggatatgtaattggaagttgggggaccttaccacaggaacatattgtacaaa
aaattaagcagtgttttcgaaaacttcctgtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctcttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaggctaagcaggcttt
cactttctcgccaacctacaagacctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tatgccaagtgtttgctgatgcaacccccactggctggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcgggac
cgacaattctgtggtcctctctcggcgatacacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011104_P_P-RF-CB Feature FT:CDS AP011104_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
gacatacatttgcgggaggacattattaacaaatgtcaacaatatgtaggccctcttacagtcaatgagaaaagaagatt
atccttaattatgccggctaggttttatcctaatataaccaaatatttgcccttagataaaggcattaaaccttattatc
ctaaccatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gagactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcgttcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttctgacttctgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
gcgatggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccgcaagatcatattgtagaaa
agatcaagcattgttttcgaaaacttcctgttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttg
ggctttgctgccccttttactcagtgtgggtatccagccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttttaagcaaacaatatctgaacctttaccccgttgcccggcaacggcctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011105_P_P-RF-CB Feature FT:CDS AP011105_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
gacatacatttgcgggaggacattattaacaaatgtcaacaatatgtaggccctcttacagtcaatgagaaaagaagatt
atccttaattatgccggctaggttttatcctaatataaccaaatatttgcccttagataaaggcattaaaccttattatc
ctaaccatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gagactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcgttcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttctgacttctgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
gcgatggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccgcaagatcatattgtagaaa
agatcaagcattgttttcgaaaacttcctgttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttg
ggctttgctgccccttttactcagtgtgggtatccagccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttttaagcaaacaatatctgaacctttaccccgttgcccggcaacggcctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011108_P_P-RF-CB Feature FT:CDS AP011108_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcctttcct
aacattcacttgcaggaggacattatcaatagatgtcaacaatatgtgggtcctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctgaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcaccgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgct
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcgatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctcctcacggaggtcttttggggtggagccctctggctcagggcatattgacaa
ccgtgccagcagcacctcctcctgcttccaccaatcggcagtcaggaagacagccaactcccatctcaccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacgataaaccctgttccgactactgcctctcccgtatcgtcaatcttctcga
agactggggaccctgcatcgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaa
aagatggggttactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgttatga
aaatcaaacaatgttttagaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctgtaccccgttgcccggcaacggtcagggc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgtcgttctctcccgcaaatacacctcgtttccatggctgctaggttgtgctgccaactggatacttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgtgcctctaccgtcct
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY040627_P_P-RF-CB Feature FT:CDS AY040627_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgccattggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgcggaaggctggcattctatataagagg
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgct
ctcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaa
cagtgccagcagcacctcctcctgcctccacctatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccactttccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctctgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttgccacaggaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacatccttcccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctttctctgccgttccgaccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY057948_P_P-RF-DC Feature FT:CDS AY057948_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet127). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccatttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtcagagc
gggagcattcgggccagggttcaccccaccacactgcagtcttttggggtggagccctcaggctcagggcatattgacaa
cggtgccagcagcacctcctcctgcctcctccaatcggcagtcaggaaaacagcctactcccatctctccacctttaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagaatgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttg
ggttttgctgccccttttacacaatgtggctatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
catattctcgccaacttacaaggcctttctgtgtcaacaatacatgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctttgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY123041_P_P-RF-CB Feature FT:CDS AY123041_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtccttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaatcaaggtaggagc
gggagacttcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgtttccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gttcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcgaccggtctggagcaaaacttatcgggac
tgacaactcggttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
ttgctttctctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY123424_P_P-RF-CB Feature FT:CDS AY123424_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacgcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaagaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctattcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY161140_P_P-RF-AD Feature FT:CDS AY161140_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcc
tttcctaaaattcatttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcaaagccaattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattctcctgctggtggctccagttcaggaacactcaaccctgttccaattattgcccctctcatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtatagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtgctccaatttgtactg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcctgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaatcgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacgaagagatggggttattccctgaatttcatgggttatgtaattggaagtaggggacataagccacaggatcatattg
tacaaaacaacaaacactgttttagaaaacttcctgccaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgttcgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggttcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtcgggttctccgtctgccgtaccggtcgaccacggggagcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY161141_P_P-RF-AD Feature FT:CDS AY161141_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcc
tttcctaaaattcatttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcaaagccaattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatctccttgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattccatggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtatagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtgctccaatttgtactg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcctgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaatcgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacgaagagatggggttattccctgaatttcatgggttatgtaattggaagtaggggacataagccacaggatcatattg
tgcacaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgttcgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggttcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctact
cggaactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtcgggttctccgtctgccgtaccggtcgaccacggggagcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY161145_P_P-RF-AD Feature FT:CDS AY161145_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggccttattcttcatctgtccctatctttaatcctgaatggcaaaccccttcgtttcct
aaaattcatttacatgaagatattatcaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagact
aaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaccttattatc
ctgatcaggtatttaatcattactttcaagcccgacattatttatatactctttggaaggctgggattctatataagagg
gaaactacacgtagcgcttcattttgcgggtcactatattcttgggaacaagagctacatcatgggaggttggacatcaa
aacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagt
gggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcca
cagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcga
ggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagcttcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatatacctcttcatcctgcatgcatgcctcatcttcttattagttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgta
caacatcttgagtccctttatatcgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
gagatggggttattccctgaatttcatggggtatgtaattggaagttggggaacattgccacaggatcatattgtacaaa
aaatcaaaaattgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttatatgcatgcatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaggtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgttcgctgacgcaacccccactggctggggcttggccatcggccatcagtgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgataattctgtcgttctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggatacttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtccc
cttctccgtctgccgtacccgccgaccacggggcgcacctctctttacgaggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY161146_P_P-RF-AD Feature FT:CDS AY161146_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggccttattcttcatctgtccctatctttaatcctgaatggcaaaccccttcgtttcct
aaaattcatttacatgaagatattatcaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagact
aaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaccttattatc
ctgatcaggtatttaatcattactttcaagcccgacattatttatatactctttggaaggctgggattctatataagagg
gaaactacacgtagcgcttcattttgcgggtcactatattcttgggaacaagagctacatcatgggaggttggacatcaa
aacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagt
gggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcca
cagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcga
ggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagcttcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatatacctcttcatcctgcatgcatgcctcatcttcttattagttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgta
caacatcttgagtccctttatatcgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
gagatggggttattccctgaatttcatggggtatgtaattggaagttggggaacattgccacaggatcatattgtacaaa
aaatcaaaaattgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttatatgcatgcatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaggtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgttcgctgacgcaacccccactggctggggcttggccatcggccatcagtgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgataattctgtcgttctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggatacttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtccc
cttctccgtctgccataccgtccgaccacggggtgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY167095_P_P-RF-CB Feature FT:CDS AY167095_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IIc). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctactagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206374_P_P-RF-CB Feature FT:CDS AY206374_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggcaactttactgggctttattctcctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
cacgtacatttgaaggaggacattatcgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaataatgcctgctaggttctatcccaaccttaccaaatatttgccattagataaaggcatcaaaccttattatc
ctggacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtccccatattcttgggaacacgagctacatcatgggaggttggtctgcca
aacctcggaaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaactttcctccaaactctgctagatcccaaagtaaggggccttta
ctttcctgttggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacatgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaacctccggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccccaataaaacaaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattatactaa
aaatcaaacaatgttttcggaaacttcctgtaaataggccaattgattggaaggtatgtcagagaattgtgggtcttttg
ggctttgctgcaccttttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
tgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggatctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY233277_P_P-RF-AC Feature FT:CDS AY233277_P_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate 1848). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccct
ggactcataaggtgggaacttttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaataggtgtcagcaatttgtaggccctttaactgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaagcctt
attatccagatcaagtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatat
aagtgggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
caacaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccaacagttcctcctcctgcctccaccaatcggctgtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttacccattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtgtgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatcaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccaccagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AY233293_P_P-RF-DE Feature FT:CDS AY233293_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 12). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaacaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtactgggggccaagcctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctactctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaacaatgttttcgaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagccggctttcactttctcgccaatttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
ggcatggagaccaccgtga
>gnl|hbvcds|AY233295_P_P-RF-DE Feature FT:CDS AY233295_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttcaactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccatca
atcggcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcccatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttctgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgcaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taagcaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggtctctctcgtccccttctccgtctgccgtaccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY236161_P_P-RF-DA Feature FT:CDS AY236161_P_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 12A). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacactatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccggattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagattcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctg
ttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatggg
agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatattgtattgggggccaagtctgtacagcatcgggagtccctttataccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgggtta
cataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtggatat
cctgccttaatgcctttgtatgccagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctacg
tcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccnctg
ggtgggggttggccataggccatcagggcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtttggagcaaagctcatcggaactgacaattntgttgtcctttcgcggaaatatac
atcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacgtcgcttcacctctgcacgt
tgcatggagaccaccgtga
>gnl|hbvcds|AY247030_P_P-RF-CB Feature FT:CDS AY247030_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate KUHB81). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgtagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggcagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccatcaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtgctaa
aactcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccgacttacaaagcctttttgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgag
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY341335_P_P-RF-DE Feature FT:CDS AY341335_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatccagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattccttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggaactggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttaccagcaaatccgcctcctgcatcttcca
atcgccagtcaggaaggcagcccaccccgccgtctccacctttgagaaacactcatcctcaggccatgaagtggaattcc
acaactttccgccaaattctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacggt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcataaactgcacgactactgctcaaggaacctctatgcatccctcctg
ttgctataccaaaccttcgggcagaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttattccttaaatttcatgggcta
tgtcattggctgttatgggtccttgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaagctaagcaggctttcactttctcgccaacttacaaggtctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctgtcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY373430_P_P-RF-DE Feature FT:CDS AY373430_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagtgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcacgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctagtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggaattgggggccaagtctgtacagcaacttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctacatttcatgggcta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatacagcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaagcttatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY800249_P_P-RF-DC Feature FT:CDS AY800249_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaatacgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacag
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccgggatcttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaca
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaacccaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggccgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcttctgccgttccggccaccctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817509_P_P-RF-DC Feature FT:CDS AY817509_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L28). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagatgaagaactctctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcacgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggctaagtctata
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
ccgttggggctactcccttaacttcatgggatatataattggaagttggggcactttaccacaggaacatattgtacaca
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817510_P_P-RF-DC Feature FT:CDS AY817510_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L45). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtgtcccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaatcgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgttggtggctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaccctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggttctttaccacaggaacatattgtacaca
aaatcaaggactgttttcgaaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccgacaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcacagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgttgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817511_P_P-RF-DC Feature FT:CDS AY817511_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L49). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatagtgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaaaactaa
aagatggggttattctctaaatttcacgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaga
aaatcaaagattgttttagaaaactccctgtcaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtattcaatcccgacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgtacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccaatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactcagttgttctcgcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817512_P_P-RF-DC Feature FT:CDS AY817512_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L53). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggctggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcataaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcactttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccaggtttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcaatggaactccacaaccttccaccaaactctgcaagatcccagggtgggaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatacaattggaagttggggtgctttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatacatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggccttcctgtatacacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggagcctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctggggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttgctctgccgttccggcccaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817513_P_P-RF-DC Feature FT:CDS AY817513_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L66). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcgtctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacat
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagttcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaacctttggacagaaattgcacatgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaactaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatcgacctgttgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgcgtacacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcacagccggtctggagcgaaacttatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY817515_P_P-RF-DC Feature FT:CDS AY817515_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L80). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctctcacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacacgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacag
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttagaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggctataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgtggtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccatcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcttctgccgttccggccaacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY862864_P_P-RF-DC Feature FT:CDS AY862864_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggacgaatctttctg
ttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaactcaaacaatccagattgggac
ttcaaccccaacaaggatcactggccggaggcaaatcaggtaggagcgggagcattcgggccagggttcactccaccaca
cggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcctgcctccacca
atcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactcttcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggcacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgggata
tataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcctgtaa
atcgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtggatat
cctgctttgaagcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactg
gatggggcttggccttaggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaatacac
ctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccacccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY862865_P_P-RF-DC Feature FT:CDS AY862865_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3-2nd). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactcttcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggcacagtaaaccctgttccgactactgcctctcccatatcgtcaaccttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggcctaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaacagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggatatcctgctttgaagcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccttaggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccacccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY862866_P_P-RF-DC Feature FT:CDS AY862866_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3-2nd). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcaggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtggatcaccatattattgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggtagacagcctactcccatctctccacctctgaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactcttcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggcacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgagcatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcggttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataataggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgaagcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccttaggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccacccacggggcgcgcctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacctcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089798_P_P-RF-CB Feature FT:CDS DQ089798_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HK477). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggatcctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcacttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccagggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtacattaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggcttt
tacgttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacctccgtga
>gnl|hbvcds|DQ111987_P_P-RF-DE Feature FT:CDS DQ111987_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MMU36). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataaaaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacccgaacaaaacaaagagatggggttattctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagactgctttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgccgcaccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactcagttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ315779_P_P-RF-DE Feature FT:CDS DQ315779_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EI0399). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaactttccca
aatatacatttacaccaagacatcatttacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaacgaagatt
gcaattgattatgcctgctaggttttaccctaacgttaccaaatatttacccttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaactagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaagacgaaaagatggggttattctctacatttcatggggta
tgtcattgattgttggggatcattaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttatatgcatgtattcaagctaaacgggctttcactttctcgccaacttacaaggcctttctctg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttaggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464164_P_P-RF-DE Feature FT:CDS DQ464164_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgaagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggtcaccaaatatttacctttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttcccagctagacactatttactctctctatggaaggcgggtatattatataagaga
gaaacaactcatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagcaggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagccaaccccgctgtctccacctttgagagacactcatcctcacatacagtggaactccaca
acattctaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagtaaa
ccctgttccgactactgcctctccctcatcgtcaatctcctcgaggattggggaccctgcgctgaacatggagaacatca
catcaggattcctacaaccccttctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatattcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaattcca
ggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacaacacctggaggccttttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttactctctgaattttatgggttatgt
cattggatgtcatgggtccctgccacaagaacacatcgtacgaaaaatcaaagaatgtttcagaaaacttcccattaaca
ggcctattgattggaaagtttgtcagagaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcct
gctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctggcc
gcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatacacctc
gtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggtcgcttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgc
atggaaaccaccgtga
>gnl|hbvcds|DQ464165_P_P-RF-DE Feature FT:CDS DQ464165_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacgtttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggtcactaaatatttacctttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagctagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaagggcacctggccagatgccaacaaggtaggagcaggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggtagccaaccccgctgtctccacctttgagagacactcatcctcacatacagtggaactcaaca
acattcaaacaaactctacaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaagaacagtaaa
ccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatca
catcaggattcctacaaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatattcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaattcca
ggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacaacacctggaggccttttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttactctctgaattttatgggttatgt
cattggatgtcatgggtccctgccacaagaacacatcgtacgaaaaatcaaagaatgtttcagaaaacttcccattaaca
ggcctattgattggaaagtttgtcagagaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcct
gctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctggcc
gcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatacacctc
gtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggtcgcttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgc
atggaaaccaccgtga
>gnl|hbvcds|DQ464166_P_P-RF-DE Feature FT:CDS DQ464166_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacgtttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggtcactaaatatttacctttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagctagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaagggcacctggccagatgccaacaaggtaggagcaggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggtagccaaccccgctgtctccacctttgagagacactcatcctcacatacagtggaactcaaca
acattcaaacaaactctacaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaagaacagtaaa
ccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatca
catcaggattcctacaaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatattcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgcgggtcctctaattcca
ggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaagaacctctatgtatccctcctgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacaacacctggagtccctttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttactctctgaattttatgggttatgt
cattggatgtcatgggtccctgccacaagaacacatcgtacgaaaaatcaaagaatgtttcagaaaacttcccattaaca
ggcctattgattggaaagtttgtcagagaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcct
gctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctggcc
gcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatacacctc
gtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggtcgcttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgc
atggaaaccaccgtga
>gnl|hbvcds|DQ464167_P_P-RF-DE Feature FT:CDS DQ464167_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcccagacgaagatctcaatcgccgcgtcccagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaagtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacgtttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgatcatgcctgctaggttttatccaaaggtcaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagctagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcac
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagcaggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagccaaccccgctgtctccacctttgagagacactcatcctcacatacagtggaactccaca
gcattcaaacaaactctacaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaagaacagtaaa
ccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagagcatca
catcaggattcctacaaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtgctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatattcctct
tcatcctgccggtatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgcgggtcctctaattcca
ggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaagaacctctatgtatccctcctgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacaacacctggagtccctttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttactctctgaattttatgggttatgt
cattggatgtcatgggtccctgccacaagaacacatcgtacgaaaaatcaaagaatgtttcagaaaacttcccattaaca
ggcctattgattggaaagtttgtcagagaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcct
gctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctggcc
gcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatacacctc
gtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggtcgcttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgc
atggaaaccaccgtga
>gnl|hbvcds|DQ478886_P_P-RF-DC Feature FT:CDS DQ478886_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggtctc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattatgaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattccc
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggaaccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaacctcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
ctccttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ478887_P_P-RF-DC Feature FT:CDS DQ478887_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatttgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagtcctcaggctcagggcatattgacaa
cagtgccaacagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggcagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
tgacaactctgttgtcctctctcggaaatacacctcctatccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ478889_P_P-RF-DC Feature FT:CDS DQ478889_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH14). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagccgactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ478890_P_P-RF-DC Feature FT:CDS DQ478890_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacattaccaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggtgacgaatctttctgttctcaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccacaaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcacgccatgcactggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctata
tttccctgctggtggctccagttcaggaacaacaaaccctgttccgactactgcctctcccatatcgacaatcttctcga
ggattggggaccctgtgcggaacatggaaaacatcacatcacgattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
gcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctcaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgtatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ478892_P_P-RF-DC Feature FT:CDS DQ478892_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatttgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccggggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaacagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
tgacaactctgttgtcctctctcgaaaatacacctcctatccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ478897_P_P-RF-DC Feature FT:CDS DQ478897_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagtaaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaca
aaatcaagcactgttttcgaaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ478898_P_P-RF-DC Feature FT:CDS DQ478898_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH38). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacatacatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
cggaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacag
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactttgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcactgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaatctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgaggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF103282_P_P-RF-AD Feature FT:CDS EF103282_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran103). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtgaaactcc
acaaccttccaccaagctctgcaagatcccagagtcagaggcctgtattttcctgctggtggctccagttcaggaacact
caaccctgttccgaccattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgacgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctttcaattttctagggggatccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcaacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatg
ttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactccctaaattttatgggtta
tgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttccggtca
atcgacctatagattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgggtac
cctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttctaag
taaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103283_P_P-RF-AD Feature FT:CDS EF103283_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran105). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acagctttccaccaagctctgcaagatcccacagtcaggggactgtattttcctgctggtggctccagttcacgaacact
caaccctgttccaactattgcctctcacatctcgacaatctcctcgaggattgcggaccctgcgacaaacatgcacaaga
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttatcttgttgacaagaatcctctctctaccgcag
agtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatg
ttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggtta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcacagaatgttttaaaaaacttcctgtta
acaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtatgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaaactttcggactcctctgccaatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103284_P_P-RF-AD Feature FT:CDS EF103284_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran113). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttacctttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccagcgca
cggaggccttctggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacaca
caaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaaca
tcacatcacgattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatg
ttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggcta
tgtcattggatgttatggttcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtacgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcagcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103285_P_P-RF-DE Feature FT:CDS EF103285_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ran128). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacccacttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggaccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttgcccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcctgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctcaattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcaaagtgcttgctgacccaccccccactg
gctggggcttggtcaagggccatcagcgcctgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtcgggggcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctcacgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF464099_P_P-RF-AG Feature FT:CDS EF464099_P_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate 05hgg). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattt
tcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgagga
ctggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttcccggaaatatacctcctttccatggcagctaggctgtacggccaactggatccttggaggga
cgtcggttgtttatgtcccgtcagcccctaatccagcggacgacccctcccgggcccctgggggggtctgtggccccctt
ctccgtttgccgttcctgccgaccacggggcgcacgtgtctttacgcggtctcccggtctgttccttttcatctgccgga
ccgtgtgcccttggcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|EF494376_P_P-RF-CA Feature FT:CDS EF494376_P_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW706). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttctggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcccgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
cttccaaacctcgaaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggac
cctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggt
aggagcgggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatat
tgacaacagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccataaagtggaactccacaacattccaccaagctctgctagaccccagagtgaggga
cctatactttcctgctggtggctccagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatct
tctcgaggactggggaccctgcaccgaacatggagaacacgacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctg
cacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattc
ccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataa
aaccaaacgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattg
tacaaaaaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagca
ggctttcactttttcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggt
caggtctctgccaagtgtttgctgatgcgacccccactggatggggcttggctattggccatcgccgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttat
cggaaccgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcc
tgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctac
cgtccccttcttcgactgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF494378_P_P-RF-CA Feature FT:CDS EF494378_P_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW1244). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaagtctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcct
gatatacatttgaaagaggacatttttgatagatgtcaacaatttgtgggccctcttactataaatgaaaaaaggagatt
aaagttaattatgcccgctagattttttcctaaacttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaaccacacgtagtgcctcgttttatgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaa
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgaccaccagttggaccctgct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcggttcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccattcagtggaattccacaacatttcatcacactctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagctccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccttgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcacttactaacctcttgtcctccgacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcgtcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtctgtcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcatctctatgtttccctcttgttgctgttcaaaaccttcggatggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgta
cagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggttgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttcccatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU185780_P_P-RF-AD Feature FT:CDS EU185780_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate H-IDU7 (Rec.Arg-1)). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcgttcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcatccacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgtgacgaacatggagaaca
tcacatcaggactcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatg
ttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaacaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtywwcgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgwgtgcacttsacttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|EU522070_P_P-RF-CB Feature FT:CDS EU522070_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient 7N). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattctactactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtaggccctcttacagtaaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatacagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaacaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccaattccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttgccacaggaacatattgtactta
aaattaagcaatgttttcggaaacttcctgtaaatagacctgttgattggcaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgccgttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccaccagcgcatgcgtggaacctttgtg
gctcccctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccc
cttctgtctctgccgttccggccaaccacggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU589337_P_P-RF-CB Feature FT:CDS EU589337_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S710-2). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaccggggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctcttctagaccccagagtgaggggccttcc
tgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaattttctcgaggactg
gggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtg
tcctggccgaaattcgcagtcccaaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgcttga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaa
ggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgc
tcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcat
cctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttataccgctattactaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttg
gggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactca
agcaatgttttagaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgcc
aagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaa
ctctgttgtcctctctcggaagtacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgt
cctttgtttacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttctt
catctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcctcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU594406_P_P-RF-DE Feature FT:CDS EU594406_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aaaatacatttacaccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaaggtggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatactgaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594435_P_P-RF-DE Feature FT:CDS EU594435_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtccctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaaggtt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggccggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacacactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaattttatgggtta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttggggtttgctgcaccatttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594436_P_P-RF-DE Feature FT:CDS EU594436_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacatactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtcgccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggcttcagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaatcctaacaaaacaaagagatggggttattctctacattttatgggtta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaaagaattgtgggccttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU660227_P_P-RF-BC Feature FT:CDS EU660227_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HBV-14N). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgagcatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagactgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaaccaa
aagttggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aaatcaaaatgtgttttaggaaatttcctgtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaatcgaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgcccggcagcggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcattgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU717211_P_P-RF-CB Feature FT:CDS EU717211_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate D23K-6). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgccggctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcca
aacctcgaaaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccactcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggagcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
catgtgtcctgaccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagcttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgcg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccacccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU787434_P_P-RF-DC Feature FT:CDS EU787434_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 92). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatacgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacag
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcttgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaccatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgcccctttcacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccaacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU787435_P_P-RF-DC Feature FT:CDS EU787435_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 114). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaactccctcctttcct
cacatacatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacag
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaaccttcctccaaactttgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtgaaccctgttccgactactgtctctcccatatcgtcaatcttctcga
ggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatctccaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaaacactgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaatctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU787444_P_P-RF-CB Feature FT:CDS EU787444_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate W41). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcttgcacgaaggtctccttcgccgagacgaaaaagatctcaatctcgggaatctcggtgttaatatcgcttgcactc
atagggcgggaaactttactgggctttattcttctactgtacccatctttaattctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgagccctcttacagttaatgaaaaaaggagatt
aaaattacttatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggcccaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacatacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU833890_P_P-RF-GA Feature FT:CDS EU833890_P_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate 6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactactcctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaacatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacagtccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagtggg
agcattcgggccagggctcacccctccacacggaggccttttggggtggagccctcaggctcagggcatattgaccacag
tgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagac
agtcatcctcaggccatgcagtggaattccactgccgtccaccaagctctgcaggatcccagagtcaggggtctgaattt
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgagga
ctggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccat
cgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagctatattgatgatattgtattgggggccaaatctgtacag
catcgtgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccccgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacctataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctat
gccaagtgtttgctgacgcaacccccactggttggggcttggccaccggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|EU833891_P_P-RF-GC Feature FT:CDS EU833891_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H4536/07). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggattttttggcgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttaaaccccaacaaggacccttggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattcattgaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccccgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgca
gctccactgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcatgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU835240_P_P-RF-GC Feature FT:CDS EU835240_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate IND-DIB112). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggaatggcaaactccttcctttcct
aacattcatttgcatgaagacattatcaatagatgtcaacaatttgtgggccctatgacagtcaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaacctcaccaagtatttgcccttagataaaggcattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaagctggtattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
ccgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctgaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccctgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaacatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatcccttatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaa
gaggtggggttattccttaaatttcatgggatatgtaattggaagttggggcactttgccacaagatcatattatacaga
aaatcaaacaatgttttagaaaactccctgttaataggcccattgattggaaagtatgtcaaagaattacgggtatcctg
ggctttgctgctcccttcacacagtgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagcaggtctggagcaaaccttatagggac
tgataattcagtcgtcctttcgcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU871981_P_P-RF-CB Feature FT:CDS EU871981_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-95-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccgccgtga
>gnl|hbvcds|EU871983_P_P-RF-CB Feature FT:CDS EU871983_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-97-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacgcctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgcctccccatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871984_P_P-RF-CB Feature FT:CDS EU871984_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggcatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871985_P_P-RF-CB Feature FT:CDS EU871985_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggcatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871986_P_P-RF-CB Feature FT:CDS EU871986_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871987_P_P-RF-CB Feature FT:CDS EU871987_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-01-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871988_P_P-RF-CB Feature FT:CDS EU871988_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-01-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggacgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttttgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871989_P_P-RF-CB Feature FT:CDS EU871989_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-03-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccatttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871990_P_P-RF-CB Feature FT:CDS EU871990_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-04-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaagggcgatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcagaaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgtttacgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871991_P_P-RF-CB Feature FT:CDS EU871991_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-04-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttcgagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactctaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871992_P_P-RF-CB Feature FT:CDS EU871992_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-99-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgtgaacaggggctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871993_P_P-RF-CB Feature FT:CDS EU871993_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-99-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagcggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871994_P_P-RF-CB Feature FT:CDS EU871994_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-3). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtcttaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttcgagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctga
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggacatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccagccgaccacagggcgcacctctctttgcgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871995_P_P-RF-CB Feature FT:CDS EU871995_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-4). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtgacaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacgaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtc
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
ccgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgttcgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttttccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871996_P_P-RF-CB Feature FT:CDS EU871996_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU871997_P_P-RF-CB Feature FT:CDS EU871997_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacgcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctattcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttcccatctgcc
ggaccgtgtgcacttcgcttcacctctacacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU871999_P_P-RF-CB Feature FT:CDS EU871999_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgcaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggcccagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaa
aaatcaaacactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccgccgtga
>gnl|hbvcds|EU881995_P_P-RF-CB Feature FT:CDS EU881995_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient17). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcccgagtggcaaattccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttcca
aacctcgaaaaggcatggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccaaagtgaggggcctata
tttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttctcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccagggacgtcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaagctgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgtaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtcctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU882006_P_P-RF-CB Feature FT:CDS EU882006_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient22). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatacagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccaccactttccaccaagctctgctagatcccagagtgaggggcctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgttccgactactgcctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccagtcactcaccaacctgttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaggcctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttctgttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaactttatgggatatgtaattgggggttggggcactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtggctatcctgccttaatgccattgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcacgtctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccc
cttctgcttctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU916232_P_P-RF-CB Feature FT:CDS EU916232_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S8.3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccataccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagagtcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaac
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aaatcaagcaatgctttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatacgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU916239_P_P-RF-CB Feature FT:CDS EU916239_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
tacgttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgctgccggtcgggagcaacacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgttagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU916240_P_P-RF-CB Feature FT:CDS EU916240_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
tacgttctcgccgacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgctgccggtcgggagcaacacttatcggaac
cgacaactctgttgtcctctctcggaaatacaccccctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU916241_P_P-RF-CB Feature FT:CDS EU916241_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
tacgttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgctgccggtcgggagcaacacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgttagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU919166_P_P-RF-CB Feature FT:CDS EU919166_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient25). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgcattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gagactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggacttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagcactgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacagaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggcacattaccacaagaacatattgtactaa
aactcaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttatg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcct
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU919167_P_P-RF-CB Feature FT:CDS EU919167_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient25). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgcattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gagactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggca
tggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactca
aacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggcc
agggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagcagcac
ctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccacaactttccaccaagcactgctagatcccagagtgaggggcctatattttcctgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgctgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttataccgctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactaaaactcaaacaatgtt
ttcgaaaactgcctgtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaac
ttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactccgttgt
cctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcgtctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939547_P_P-RF-CB Feature FT:CDS EU939547_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C45). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaacttcactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctc
ctcctgtctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaacattccaccaaactctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgactcctgccaacggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaagcgttggggctactccct
taacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaattaagcaatgttttc
gaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggcttttactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcttctgccgatccat
actgcggaaatcctagcagcttgttttgctcgcagccggtatggggcgaaacttatcggaactgacaattctgttgtcct
ctctcggaaatacacctcctttccatggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgatgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcattcgccgttc
cggccgacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939551_P_P-RF-CB Feature FT:CDS EU939551_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C56). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttacaggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggatactcccttaatttcatgggatatgtaattggaagttggggtacattaccgcaggaacatattgtattaa
aaatcaagcaatgttttcgtaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaccttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcttctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939565_P_P-RF-CB Feature FT:CDS EU939565_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C86). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagactaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataatgtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagacaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccactacattccaccaagctctactagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatctgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtacattaccgcaagaacatattgtacaaa
aaattaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttactcaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaac
cgacaactctgttgtcctttctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgtttgggactctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939577_P_P-RF-CB Feature FT:CDS EU939577_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C116). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaataactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
cacattcatttgcgggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcaggtattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattctcgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcttattgacaacagtgccagcagcacctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaaccttccaccaagccctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaaatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactccct
taacttcatggggtatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttc
gaaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcacgttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcct
ctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttc
cgaccgtccacggggagaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939589_P_P-RF-CB Feature FT:CDS EU939589_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C175). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagccatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacaccgcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtcccgcggccgtttgggactctaccgtccc
cttctgactctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939606_P_P-RF-CB Feature FT:CDS EU939606_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C206). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcctctactgtacctatctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcactatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggca
tggggacgaatctttctgttcccaaccccctgggattctttcccgatcaccagttggaccctgcattcggagccaactca
aacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggcc
agggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcac
ctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtgg
ctccagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtattaaaactcaagcaatgtt
ttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgcccct
tttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaac
ttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgt
actctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcctcttcttcatctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939620_P_P-RF-CB Feature FT:CDS EU939620_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate B140). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggcaggacgccaacaaggtgggagt
gggagcattcgggctagggttaacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacggtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
cagtcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatatgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
cattatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcataggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagcgaattgtgggtctgtta
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtattcaagctaagcaagcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaggtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggaccctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgatccgtttcggggccgtttgggtctctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939621_P_P-RF-CB Feature FT:CDS EU939621_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C94). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttagtattccttggacac
ataaggtgggaaattttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgataaatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcgtgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaataggcctattgattggaaagtgtgtcagagaattgtgggtttgttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctttctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939623_P_P-RF-CB Feature FT:CDS EU939623_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C126). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttaatattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcgatttgtggggccccttacagtaaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaagcggggatcttatataaaaga
gagtccacacgtagcgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccaaattccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
agactggggaccctgcactgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcggaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcttctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttataggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggttggtaggttgtgctgccaaatggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgatgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttgttagtccgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttgtcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939627_P_P-RF-BC Feature FT:CDS EU939627_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C15). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttrcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatctgcacaaggacaactggccggacgccaacaaggtgggagt
gggggcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
cttccctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaatatggagaacatcgcatcaggactccyaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggraacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacgaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgtcgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939629_P_P-RF-BC Feature FT:CDS EU939629_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C95). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcccctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaattccacaacattccaccaagctctgctagaccccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaccatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgcgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU939630_P_P-RF-CB Feature FT:CDS EU939630_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C122). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacacgggggactgttggggtggagccctcaggctcagggcatattcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
cttccctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttataccgctattaccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaa
acgctggggttactcccttaacttcatgggatatgtaattggaagttggggtactttgccgcaggagcatattgtactga
aactcaagcaatgttttcgtaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcacatggagaccaccgtga
>gnl|hbvcds|EU939631_P_P-RF-BC Feature FT:CDS EU939631_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C123). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttgatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcccaggacccctgctcgtgttacaggcggggtat
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttcaaagggaaacacc
cgtgtgtcatggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttctcctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttggggaccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatataaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaaagcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctatgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttttcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU939668_P_P-RF-CB Feature FT:CDS EU939668_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C182). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagc
gggatcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctcaccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccttgcaagacatgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaaatctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgtttccgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgcctatttacaaggcctttctatgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactgtaccgtccc
cttcttcgtctgccgtaccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ023659_P_P-RF-BC Feature FT:CDS FJ023659_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate I1_M04-0469). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaacttaattatgcctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatc
ctgaacaggcagttaatcattacttcaaaactagacactatttacatactctgtggaaagcgggcattctatataagaga
gaaacaacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaaggtgttccacca
ctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcattc
ggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcggg
agcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacg
tgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagac
agtcatcctcaggccatgcagtggaattccacaaccttccaccaagctctgcaagatcccagaatcaggggcctgtattt
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcacgagga
ttggggaccctgcaacgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggattat
caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagag
atggggttattccttaaacttcatgggttatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaa
ttaaaaaatgttttagaaaactacctgttaacagacccattgattggaaagtatgtcaaagaatttcaggacttttgggc
tttgctgctccattcacacaatgtggttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcac
tttctcaccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgccaggcaacggcccggtctat
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactgctagccgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctctt
cttcatctgccgtaccggccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023662_P_P-RF-GC Feature FT:CDS FJ023662_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I1_M04-3718). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacaattccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatc
ctgaacaggcagttaatcattacttcaagactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaacaacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggttgttggtcaaaac
ctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttc
ggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcggg
agcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacg
tgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagac
agtcatcctcaggccatgcagtggaattccacaaacttccaccaagctctgcaagaccccaggatcaggggcctgtattt
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcgcgagga
ttggggaccctgcaacgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagag
atggggttattccttaaacttcatgggatatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaa
tcaaacaatgttttagaaaactccctgttaacagacccattgattggaaagtatgtcaaagaatttcaggactcttgggc
tttgctgctccattcacacaatgtggttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgccaggcaacggcccggtctat
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactgctagccgcctgttttgctcacagccggtctggagcaaaactcattgggactga
taattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctctt
cttcatctgccgtaccaaccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttctcgtcggccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023664_P_P-RF-GC Feature FT:CDS FJ023664_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-0026). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
macctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagacaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcaggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ023665_P_P-RF-GC Feature FT:CDS FJ023665_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-0033). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacagtttgtgggccctttgacattgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagcgcttcaagatcccagagtcaggggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccattgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtcaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatttaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023666_P_P-RF-GC Feature FT:CDS FJ023666_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-1907). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttacatgaggacattatcaataggtgtgaacagtttgtgggccctttgacattgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttcggtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatcccgattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctctggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttcaamcaagcgcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatctccgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccattgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcaagtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023667_P_P-RF-GC Feature FT:CDS FJ023667_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-2742). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcaggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023668_P_P-RF-GC Feature FT:CDS FJ023668_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-3223). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttaacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagacaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcaggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatatgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ023670_P_P-RF-GC Feature FT:CDS FJ023670_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-3724). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
ctgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gcgatggggttattccttgaatttcatgggatacataattggaagttggggtaccttgccacaagatcatattatacaga
aaatcagacaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtctcctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttatatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactactagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ023673_P_P-RF-GC Feature FT:CDS FJ023673_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-4997). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
gaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctgaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagacaatgttttagaaaactccctgttaatcggcccgttgattggaaagtatgtcaaagaatttcaggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ032337_P_P-RF-CB Feature FT:CDS FJ032337_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S462-5). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggaaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggcccccttacagtgaatgagaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaagactaggcattatttacatactccgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttcca
aacctcgacgaggcatggggacaaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggaccttgcg
ttccgagccaactcaaacaatccagattgggacttcaaccccagcaaggatccttggccagaggcaaatcaggtaggagc
gggagcattcgggccaggtttcaccccacctcacggcggtcttttggggtgaagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagg
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctgggtgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactccctcaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtactaa
aaatcaaacaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcgtgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaac
tgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ032343_P_P-RF-CB Feature FT:CDS FJ032343_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S659-4). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatccaaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctcttctagaccccagagtgaggggccttcc
tgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaattttctcgaggactg
gggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtg
tcctggccgaaattcgcagtcccaaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgcttga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaa
ggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgc
tcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcat
cctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttataccgctattactaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttg
gggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactca
agcaatgttttagaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgcc
aagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaa
ctctgttgtcctctctcggaagtacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgt
cctttgtttacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttctt
catctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcctcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349207_P_P-RF-DE Feature FT:CDS FJ349207_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H22). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttagaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagctaatgagacaagaaggct
aaaattaattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaaaggtattaaaccgtactatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatgggaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctcaacca
atcgccagtcaggaaggcagcctaccccgctgtccccacctctgagagacactcatcctcaggccatgcattggaactcc
acaaccttccatcaaactctgcaagatcccaaagtgagaggcctttatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattgggggccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcgg
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaata
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctg
ctgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacatttcatgggtta
tgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttatatgcatgtattcaatctaagcaggccttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcggcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactccgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctaccgtccccttctccgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|FJ349212_P_P-RF-DE Feature FT:CDS FJ349212_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H36). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtgttccttggactc
ataaggtggggagctttactgggctctattcttctactgtacctgtcttcaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagtaaatgaaaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggtctcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagacaggaaggcagccgaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggagcagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatctgcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtccgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggctttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcacggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|FJ349221_P_P-RF-DE Feature FT:CDS FJ349221_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H149). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaagtctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttactcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataaaaga
gaatcaactcatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcccactccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccgcatcgtcaatcttctcgaggattggggaccctgtgctgagcatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggccctaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtaccgcaccttgagtccctttttactgctgtttcc
aattttcttttgtctttgggtatacatttaaaccctcacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaggttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaagctaagagggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|FJ349241_P_P-RF-DC Feature FT:CDS FJ349241_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate C115). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaagtatttgcctttggacaaaggtattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcaaaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggttatgtcattgggagttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ361772_P_P-RF-GC Feature FT:CDS FJ361772_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC. Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcct
cacattcatttgaaagaggacattgtcaatatatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcccaacctgaccaaatatttgcccttagataaaggcattaaaaattattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaaccacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagctccgctttcca
aatctcgacgaggcatggggacgaatctttctgttcccaatcctctgggattcctccccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccatcaaggatcaatggtcagcagcaaaccaggtgggagt
gggatccttcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcaaggcacattaacaa
cagtgccagcagcccctcctcctgcctccaccaatcggcagtcaagaagaaagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacggtggaaccccatcacattccaccaagagccgtcagttcacaatcctgctggtggctt
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagacttgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaa
ttcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaaacccaaataaaacaaaacgttggggctactccct
taatttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattatacaaaaaatcaaacaatgttttc
gtaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggccttctcggctttgccgctcctttt
actcaatgtggttacccagcattaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacgta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctg
acgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgtcgtact
ctctcggaaatacacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttctccgtctgccgttc
cggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386578_P_P-RF-CB Feature FT:CDS FJ386578_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1748). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatactgacaa
cagtgccagtagcacctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctgactcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttcacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagctggtctggagcaaagcttatcggcac
cgacaactctgttgtcctctctcggaaatacacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcct
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386581_P_P-RF-CB Feature FT:CDS FJ386581_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1764). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
cagaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtrtactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccacccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ386585_P_P-RF-CB Feature FT:CDS FJ386585_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1800). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatactgacaa
cagtgccagtagcacctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttcacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccatttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagctggtctggagcaaagcttatcggcac
cgacaactctgttgtcctctctcggaaatacacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcct
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386586_P_P-RF-CB Feature FT:CDS FJ386586_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1811). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttatggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggcccatgcaagacctgcacaat
acctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtacactaccacaggaacatattgtattaa
aaatcaagaaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtgggtatcctgccttaatgcctttatatgcctgtatacaatctaagcaggcttt
tacattctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatacagcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386593_P_P-RF-CB Feature FT:CDS FJ386593_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1877). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagg
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcaccccctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccattcctgctggtggatc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccct
taacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaaacaatgttttc
gaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttaatgcctttatacgcatgtatacaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcctgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcct
ctctcgaaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggaaaccaccatga
>gnl|hbvcds|FJ386633_P_P-RF-CB Feature FT:CDS FJ386633_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2372). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgaccaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacagcattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aacttaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386635_P_P-RF-CB Feature FT:CDS FJ386635_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2399). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcctctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtattaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcct
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386646_P_P-RF-CB Feature FT:CDS FJ386646_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1716). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacatgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggccggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacgttccaccaagctctgctagacccctgagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagrctcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgtcaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgcgcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccc
cttcttcgtctgccgtaccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386649_P_P-RF-CB Feature FT:CDS FJ386649_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2422). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatactgacaa
cagtgccagtagcacctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttcacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccatttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tytgccaagtgtttgctgatgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagctggtctggagcaaagcttatcggcac
cgacaactctgttgtcctctctcggaaatacacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcct
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ386674_P_P-RF-BC Feature FT:CDS FJ386674_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate S659). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatccaaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggaccgcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggactgttggggtggagccctcaggctcagagcatattcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccgtaactccacctctaagg
gacactcatcctcaggccacgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactgta
ctttcctgctggtggctccagttcaggaacactgagccctgctcagaacactgtctctaccacatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcgtggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatat
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttagaaaacttcctataaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacgcaatgtggatatcctgctttactgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaaacctttctgcgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggcacctttgtg
tctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562223_P_P-RF-CD Feature FT:CDS FJ562223_P_P-RF-CD of [Viruses] Hepatitis B Virus recombinant form CD (isolate I15). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcatcacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctgattggaaaacaccctcttttcct
aacattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattatttccaaaccagacattatttacacactctctggaaggcgggtatattatataagaga
gaaacaacacatagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggactgggactcaccccaccgca
cggaggccttttggggtggagccctcaggcacagggcacactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgyctcwcscatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggagagca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctactt
ccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgccaacggaacctctatgtttccctcttg
ttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatggg
agtgggcctcagtccgtttctcctggctcagtttcttagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattacc
aattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgggata
tgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcctgtaa
atagacctattgattggaaagtatgtcaaagaatcgtgggtcttttgggctttgctgccccttttacacaatgtggctat
cctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactg
gatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaatacac
ctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgttggggattctatcgtccccttcttcatctgccgttccggccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ562226_P_P-RF-CB Feature FT:CDS FJ562226_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggtattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaagtctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtgttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctaggtcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttagaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctaccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgattggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562227_P_P-RF-CB Feature FT:CDS FJ562227_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I25). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtccgctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcccctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
cattcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggaactttaccacaagaccatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcwggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcac
cgacaactctgttgtcctatctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562229_P_P-RF-CB Feature FT:CDS FJ562229_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I36). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccagactccaacaaggtgcgagt
gggagcattcgggccaaggttcactcctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtttggtgggggggctactcccttatctccacctctaacg
gacaataatcctcacgccatacaatggaactcctccactttccaccaaactcttcaagatcccagagtcagggccctgca
cagccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562247_P_P-RF-CB Feature FT:CDS FJ562247_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I75). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctgtattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaccaggagatt
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccacgggggattgttggggtggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctygttgacaaraatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctttggtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattacctgtcaatagacctattgattggaaagtatgtcaaagaattgtgggacttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgcg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgatccgtctcggggccgtctgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562263_P_P-RF-DC Feature FT:CDS FJ562263_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I113). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcccgctaggttctatcctaaccttactaaatatttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaa
cagtgccagcagcacatcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctata
tctccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctttaaatttcatgggctatgtcattgggtgttatgggtccttgccacaaacacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttcttgcccgtaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562267_P_P-RF-CB Feature FT:CDS FJ562267_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I120). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccatattatc
ctgaacaagcagttaatcattacttcaaaactagacattatttacatactctgtggaaggcgggtattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttgggcctcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctttgctagaccccagagtgagaggcctata
ctttcctgctggtggctccagttccggaacagtagaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
aaagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattggggtccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccag
acgttggggctactccctcaatttcatgggatatgtaattggaagttggggaactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttg
ggctttgccgccccttttacacaatgtggctatccagccttaaagcctttatatgcatgtatacagtctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctatcgcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatactgcgcg
ggacgtcctttgtctacgtcccgtcggcgatgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562278_P_P-RF-DC Feature FT:CDS FJ562278_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcccgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgta
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgttaatcttctcga
ggattggggaccytgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaatac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaattgcctgtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaagctcatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562287_P_P-RF-CB Feature FT:CDS FJ562287_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I151). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaagaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcgcctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggccttttg
ggctttgctgccccatttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgactacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562294_P_P-RF-CB Feature FT:CDS FJ562294_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I168). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattgttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaacgttaccaaatatttgcccttggacaaagggattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctgggattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggcggacttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccttctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccactttccaccaaactcttctagatcccagagtgaggggcctgta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggaa
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggagactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacacttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggctatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562302_P_P-RF-CB Feature FT:CDS FJ562302_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I186). Non-functional genomic sequence. [Hepadnaviridae] (length=2502 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgcctgctggtggctccagttccggaac
agtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggaga
acacaacatcaggattcctaggacccctgctcgtgttacaggcggggcttttcttgttgacaagaatcctcacaatacca
cagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtcccc
aacctccaatcactcaccaacctcgtgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatat
tcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctcta
cttccaggaacatcaactaccagtacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctc
ttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctat
gggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggctcgtagggctttcccccact
gtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctatt
accaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatggg
atatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaaacaatgttttagaaaacttccta
taaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtggc
tatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttct
gtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccca
ctggatggggcttggccataggccatcaccgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactc
ctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaacgctgttgtcctctctcgaaaaga
cacctcgtttccatggctgctcggatgtgctgccaactggatcctgcgctggacgtcctttgtctacgtcccgtcagcgc
tgaatcccgcggacgatccctgtcggggcggtttgggactctaccgtccccttgttcatctgccgttccggccgaccacg
gggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgca
cgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562305_P_P-RF-CB Feature FT:CDS FJ562305_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I191). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggtattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtgctttaccgcaagaacatattgtactaa
aaatcaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttg
ggctttgccgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctaccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562314_P_P-RF-CB Feature FT:CDS FJ562314_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I206). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaattctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgagcatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcaccaagctctgctagatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcactgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccaccagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccc
cttcttctgctgccgttccagccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FJ562317_P_P-RF-CB Feature FT:CDS FJ562317_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I209). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaacttcactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaagattatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattactttaagactaggcattatttacacaccctgtggaaggctggcattttatataagaga
gaaactacgcgcagtgcctcattttgtgggtcaccatactcttgggaacaagagatacagcatgggaggtccggcttcca
aacctcgacgaggcatggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaagcaggtaggagt
gggagcattcgggccaggggtcaccccaccacacggcggtcttgtggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagccatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tctccctgctggtggctccagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactccctgaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aaatcaagcaatgtttccgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttg
ggctttgctgccccgtttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggcttt
cactttctcgccaacttacaaggcctttctgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggmac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatactgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgatccgtctcggggccgtctgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ562328_P_P-RF-CB Feature FT:CDS FJ562328_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I229). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccg
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttactcattacttccaaacgcgacattatttacacacactttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgagaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgaagtggaactcccccactttccaccaaactctccaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggctttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacagccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgattccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatagtgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ692536_P_P-RF-DE Feature FT:CDS FJ692536_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D4_50077). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgttagtatcccttggaccc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatctacaccaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagtcaatgaaaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaggatcacattatacacaaaatcaaagaatgttttagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtctgctgggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatactcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ787446_P_P-RF-CB Feature FT:CDS FJ787446_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S425-20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagctttcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctgcccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacatccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aacttaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ787480_P_P-RF-CB Feature FT:CDS FJ787480_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S425-16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacgtgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagctttcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aacttaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactatttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882610_P_P-RF-GC Feature FT:CDS FJ882610_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H2252/01). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggattttttggcgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttaaaccccaacaaggacccttggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882611_P_P-RF-GC Feature FT:CDS FJ882611_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H2072/03). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgcccgtattacaggcgggattt
tccttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttcgagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgtaaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgca
gctccactgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882612_P_P-RF-GC Feature FT:CDS FJ882612_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1886/07). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcacgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaagaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattcattgaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgca
gctccactgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882613_P_P-RF-GC Feature FT:CDS FJ882613_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1357/05). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaagaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcgaggtacgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttgaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgca
gctccactgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcrggac
tgataatyctgtcgtcctttcacggaaatatacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882614_P_P-RF-GC Feature FT:CDS FJ882614_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1099/02). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggattttttggcgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttaaaccccaacaaggacccttggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttaaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ882617_P_P-RF-GC Feature FT:CDS FJ882617_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H0645/08). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccytagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccmaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcaygaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaraga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttckagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgtwaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattccttraatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgca
gctccwctgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|FJ882618_P_P-RF-GC Feature FT:CDS FJ882618_P_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H0035/08). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcacgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaagaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcga
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
aagatggggttattcattgaatttcatgggatatgtaattggaagttggggcaccttgccacaagatcatattgtacaga
aaatcagaaaatgttttagaaaactccctgttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctg
ggctttgctgctccctttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgca
gctccactgccgatccatactgcggaactgctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccc
cttctccgtctgccgtaccggccgtccacggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ904394_P_P-RF-DE Feature FT:CDS FJ904394_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A7). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagmctactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatccaagttttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatmtagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttctggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcccaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcatctcccatatcgtcagtcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttcaagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggaagttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttcttggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttgggcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904396_P_P-RF-DE Feature FT:CDS FJ904396_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A12). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaagtttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagccacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttgggttggagccctcaggctcagggcataatacaaaccttgccagcaaaaccgcctcctgcctccgcca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcckcaggccacgcagtggaactcc
acaactttccaccaaaatctgcaagatcccagagtgagagacctgaattcccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcatacacaaaatcaaagactgtttcagaaaactccctgtta
acaggcccattgattggaaagtatgtcaacggattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaatttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtagttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904397_P_P-RF-DE Feature FT:CDS FJ904397_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A13). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=2487 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacgc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcgaaaaatgtgagcagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtatcaaaccctattatc
ccgaacatctagttaatcattacttccaaaccagacactatttacacactctrtggaaggcgggtattttatataggaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccyca
cggaggccttttgggttggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtccggacggcagcctactccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatccaacagtgaatcctgctggtggctccagttcaggaacagtaaaccctgttcc
gactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggat
tcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcg
tggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactc
accaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgc
tgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctacttccaggatcgaca
accaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaa
accttcggatggaaaytgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcag
cccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagtt
atatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttg
tctttgggtatacatttaaacactaacaaaacaaaaagatggggttactctctacattttatgggttatgtcattggatg
tgggggaaccttgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgttaacaggcctattg
attggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttatcctgcattaatg
cccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacct
gaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttgg
caataggccatcagcgcatgcgtggaacctttcaggctcctttgccgatccatactgcggaactcctagccgcttgtttt
gctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatacatcgtttccatg
gctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacg
acccttctcggggtcgcttggggatctatcgtcctcttctcygcctgccgttccggccgaccacggggcgcacctctctt
tacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagacc
accgtga
>gnl|hbvcds|FJ904398_P_P-RF-DE Feature FT:CDS FJ904398_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A14). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaakkttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatktagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccsccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaagacagccgaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtkgtattgggggccaagtctgtacaacatcttgartccctttttaccgctgttacc
aattttcttytgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccacaagatcatatcagacacaaaatcaaagattgtttcagaaaactccctgtta
acaggcccattgattggaaagtatgtcaacggattgtgggtcttctggggtttgctgcccctttcacacaatgtggttat
cctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaccgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtgtgtgccttctcaycggccggaccgtgtgcacttcgcttcacctctgcacgt
cgaatggagaccaccgtga
>gnl|hbvcds|FJ904400_P_P-RF-DE Feature FT:CDS FJ904400_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A19). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaatccttccggagactactgttgttagacgaagaggcaggtcccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagcattccttggactc
ataaggtgggaaatttcacggggctttactcttctactgtacctgtctttaaccctcattggaaaacaccttcctttcct
aatatacatttaaaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
aaaattgattatgcctgctaggttttatcctaaagttaccaaatatttgcccttggacaaaggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattctgtgggtcaccatattcatgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagttggagcattcggactggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcctcaacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgcgagacactcatcctcaggccatgcagtggaattca
acaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattccctacatttcatgggtta
tgtcattggatgttggggatcattgccacaagagcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtaa
acaggcctattgattggaaagtctgtcagcgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgaaaatatac
tgcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904401_P_P-RF-DE Feature FT:CDS FJ904401_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A20). Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctaatgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacatggaga
agaatctttccaccagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagcaaacaccaacaat
ccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggtt
caccccacctcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctc
ctgccaccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacccttgagagacactcatcctcaggccatg
cagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccag
ttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctat
gtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttaggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcgcagcatcttgagtcccttttt
accgctgtgaccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctaca
ttttatgggttatgtcattggatgttggggatcattgccgcaagatcatatcagacacaaaatcaaagaatgtttcagaa
aactccctgttaacaggcccattgactggaaagtgtgtcaacgaattgtgggtcttcttggttttgctgccccttttaca
caatgtggttatcctgcattaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaa
ggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatg
caacccccactggctggggcttgggcttgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatact
gcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctc
ccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
cgtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccgg
ccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ904403_P_P-RF-DE Feature FT:CDS FJ904403_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A29). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggcaattttacggggctttattcttctactgtacctgtctttaacccccattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgagcagtttgtaggcccgctgacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagttggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctctacctttgagagtcactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactgtcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggatgttggggatcattgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacgaccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtagttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccgtctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904404_P_P-RF-DE Feature FT:CDS FJ904404_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A42). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaacaagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaagacacctggccagatgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgatcagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggatgttggggatcattgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttcttggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgcg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904405_P_P-RF-DE Feature FT:CDS FJ904405_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A44). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctagcagacgaaggtgtcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaatttcacggggctttattcttatactgtacctgtctttaaccctcattggaaaacaccctcgtttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagacaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccatattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaaccctctaggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataacacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcaaccaaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttactgctgtttcc
aattttcttttgtctttgggtatacatttaaacactaacaaaacgaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcaaacacaaaatcaaagactgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtctggcctgtgccaagtgtttgcagatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactcagtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctttcgtcctcttctctgcctgccgttccggccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904406_P_P-RF-DE Feature FT:CDS FJ904406_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A45). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttaagccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacaattaatgagagaagaaggtt
aaaattgattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaaaggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggat
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagttggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaagctcagggcataatacaaaccttgccagcaaatccacctcctgcctcaacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattccctacatttcatgggtta
tgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtaa
acaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcctttatatgcatgtattcaatctaagcaagctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaagtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatatatcgtccccttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904407_P_P-RF-DE Feature FT:CDS FJ904407_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A47). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggcctattggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcccaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaactcc
acaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatccttgccgcaagatcatatyatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904408_P_P-RF-DE Feature FT:CDS FJ904408_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A53). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggttttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcccgctaggttttatcctaagtttaccaaatatttgcccttggataagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggactggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccaccattgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaatagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgtgggggatccttgccgcaagatcatatcgtacacaaaatcaaagaatgtttcaggaaactccctgtta
acagacccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcattaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904409_P_P-RF-DE Feature FT:CDS FJ904409_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A54a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggacagtttacggggctttattcttctactgaacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcmaaagatgtgaacagtttgtaggcccgctcacaattaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtatcaaatcctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggtattttatataagaga
gaaacaacacgtagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaatagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttggcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggcagttggggatccttgccgcaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904414_P_P-RF-DE Feature FT:CDS FJ904414_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A62). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttcttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactc
ataaggtgggaaatttcacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggcatcaaaccttattatc
cagaacatctagttaatcattacttccaaacaagacactatttacacactctatggaaggcgggtattttgtataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctacctccacca
atcgccagtcaggaaggcagccaacccccctgagtccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtaagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcatctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggttttgggggccaagtctgtatcccatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcatacacaaaatcaaagactgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacagtgtggctat
cctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904416_P_P-RF-DE Feature FT:CDS FJ904416_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacatcaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaaccaatgagaaaagaaggtt
gcaattgattatgcctgctaggttttatcctaagcataccaaatatctgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggat
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttcaacca
atcgccagtccggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcactttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcctacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatacagcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggactgacaactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904417_P_P-RF-DE Feature FT:CDS FJ904417_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66b). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacatcaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaaccaatgagaaaagaaggtt
gcaattgattatgcctgctaggttttatcctaagcataccaaatatctgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggat
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttcaacca
atcgccagtccggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcactttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcctacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatacagcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggactgacaactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904425_P_P-RF-DE Feature FT:CDS FJ904425_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactctacctgtctttaacccgcattggaaaacaccctcttttcct
aatatacatttaaaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaaggtt
aaaattgattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaaaggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagtcggagcattcgggctggggttcacccccccgca
cggaggccttttggggtggagccctcaggctcagggcataatacacaccttgccagcaaatccacctcctgcctcaacca
atcgccagtcaggaaggcagcccactccgctgtctccacctctgcgaaacactcatcctcaagccatgcagtggaactca
acgaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggttttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacygctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattccctaaatttcatgggtta
tgtcattggatgttggggatcattgccacaggaccatatcatacacaaaatcaaagaatgtttcagaaaactccctgtaa
acaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccctctcggggccgcttggggatctatcgtccccttctctgcctgtcgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgaatggagaccaccgtga
>gnl|hbvcds|FJ904430_P_P-RF-DE Feature FT:CDS FJ904430_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B10). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatctacaccaagatattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaaggttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgktttatsatcttcc
tcttcrtcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggcagttggggatccttgccgcaagatcatatcaaacacaaaatcaaagactgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtggggcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904436_P_P-RF-DE Feature FT:CDS FJ904436_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B28). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttgatattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtttttaactctcagtggaaaacaccatcttttcct
aatatacatttacaccaagacattattaaaaaatgtgaacagtttgtaggcccgctcacaaacaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaatttgaccaaatatttgcccttggacaagggtatcaaaccctattatc
ccgaacatctagttgatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataggaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccacccca
cggaggccttttgggctggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctccacca
atcgtcagtcgggacggctgcctaccccgctgtctccacctttgagagacactcatcctcaggctatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggaaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaaatctgtgtcrcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggaagttggggatcattgccacaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcattaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904437_P_P-RF-DE Feature FT:CDS FJ904437_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B30a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacaattccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacgacacatagcggctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttgca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcggggtggggttcaccccactgca
cggaggccttttggggtggagccctcaagctcagggcatattaacaaccttgccagcaaatccgcctcctgcctccacca
attgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacacccatcctcaggccatgcagtggaactca
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccgggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcagacacaaaatcaaagactgtttcagaaaactccctgtta
acaggcccattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcattaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctccgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904440_P_P-RF-DE Feature FT:CDS FJ904440_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B35). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcctttcct
aatatacatttaaaccaagacattctcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaaggtt
aaaattgattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaaaggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagttggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccacctcctgcctcaacca
aacgccagtcaggaaggcagcctaccccgctgtctccacctcttcgagacactcatcctcaggccatgcagtggaactct
acaaccttccaccaaactctgcaagatcccagagtgagaggcctttatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattccctacatttcatgggtta
tgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtaa
acaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904441_P_P-RF-DE Feature FT:CDS FJ904441_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B42a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagcattccttggactc
ataaggtgggaaattttacggggctttattcttctactgcacctgtctttaaccctcattggaagacaccctcttttcct
aatatacatttaaaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaaggtt
aaaattgattatgcctgctaggttttatcctaactttaccaaatatttgcccttggacaagggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagttggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcctcaacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgcgagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtacaaaaccttcggatggaaactgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgaacagcatcttgagtccctttttaccgctgttacc
aattttcttatgtctttgggtatacatttaaacactaacaaaacaaaacgatggggttactccctacatttcatgggtta
tgtcattggatgttggggatcattgccacaagatcatatcagacacaaaatcaaagaatgtttcaggaaactccctgtaa
acaggcctattgattggaaagtctgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaaagcctttatatgcctgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtatgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatattgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904442_P_P-RF-DE Feature FT:CDS FJ904442_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B45). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctaaaggaagaactccctcg
cctcgcagacaaaggtctaaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaacactcattggaaaacaccatcttttcct
aatatacatttacaccaagatattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattggttatgcctgctaggttttatcctaattgtaccaaatatttgcccttggacaagggtattaaaccctattatc
ccgaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagccccacattttgcgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccrcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccacccca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtccggaaggcagcctaccccgccgactccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgagacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggatgttggggaacattgccgcaagatcatatcatacataaaatcaaagaatgtttcagaaaactccctgtta
acaggcatattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgcattaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaagtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctttcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904444_P_P-RF-DE Feature FT:CDS FJ904444_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B61). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttaatattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacccgtatttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccgctcacaatcaatgagaaaagaaggtt
gcaattgattatgcctgctaggttttatcctaaatttaccaaatatttgcccttggacaagggtatcaaaccctattatc
ccgaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccaatcaagaaggcagcctaccccgccttcactacctttgagaaacactcatcctcaggcaatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacaccaacaagacaaagagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgcacctttaccccgttgcccggcaacggtccggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904447_P_P-RF-DE Feature FT:CDS FJ904447_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B65). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggatttattcttctactgtacccgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagacgatt
gaaattgattatgcctgctaggttttatcctaagtttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatccttgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FN594767_P_P-RF-DE Feature FT:CDS FN594767_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne127). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaraga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccgctggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgagga
ttggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgt
caaggtatgttgcccgtttgtcctctacttccaggatcgtcaactaccagcacgggaccctgcmgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctyctrgctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaag
atggggttactctttacatttcatgggmtatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaa
tcaaagaatgttttagaaaacttcctattaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggt
tttgctgccccttttacacaatgtggttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594769_P_P-RF-DE Feature FT:CDS FN594769_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne281). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtaaatgagaaaagaaggtt
gaaaatgattatgcctgctaggttttatcctaatggtaccaaatatttgcccttggacaagggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgggggtcaccttattcctgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacacacsaawtccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcattcgggccggggttcaccccaccgcacggaggccttttggggtggagcccacaggctcagggcataatacaaacct
tgccagcaaatccgcctcctgcctctaccaatcgacagtcaggaaggcagcctaccccgctgactccacctctgagagac
actcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattt
ccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcatatatcgtcaatcttctcgagga
ttggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcc
tgctcaaggaacctctatgtatccctcatgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtaggactttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacag
catctggagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacactaacaaaacacaaag
atggggttattccctaaattttatgggttatgtcattggaagttggggatcattgccacaagatcatatcagacacaaaa
tcaaggaatgtttcagaaaactgcctgttaacagacctattgattggaaagtctgtcagcgaattgtgggtcttctgggt
tttgctgctcctttcacacaatgtggttatcctgctctcatgcccttatatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttcgggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcacacattctcgggactga
caactctgttgttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtttacgtcccgtcggcgatgaatcctgcggacgacccttctcggggccgcttggggatctaccgtcccctt
ctctgcctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594770_P_P-RF-DE Feature FT:CDS FN594770_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne367). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtaaatgagaaaagaaggtt
gaacttgattatgcctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtattaaaccgtattatc
cagaacaactagttaatcattacttccaaaccagacactatttgcacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatcccgcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagackccaacaaggtaggagtggg
agcattcgggccggggtycaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaacct
tgccagcaaatccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagac
actcatcctcaggccatgcagtggaactccacaaccttccacmaaactctgcaagatcccagagtgagaggcctgtatct
ccctgctggtggctccatttcaggaacagtaaaccctgctccgactactgcctctcccatatcgtcaacctccgcgagga
ttggggaccctgcgctgaacatggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacttgcacgactcc
tgctcaaggaaactctacgtatccctcctgttgctgtataaaaccttcggatggaaactgcacctgtattcccatcccat
catcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactactgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacag
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacactaacaagacaaaaag
atggggttattccctacatttcatgggttatgtcattggaagttggggatcattgccgcaagatcatatcagacacaaaa
tcaaagactgtttcagaaaactccctgttaacaggcccattgattggaaagtatgtcaacggattgtgggtcttctgggg
tttgctgcccctttcacacaatgtggttatcctgcattaatgcccttatatgcatgtattcaacctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggycaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggct
cctctgccgatccawactgcgsaactcctggccgcttgttttgctcgcagccggtctggagcaaacattctcgggactga
caactctgtcgttctctcccgcaaatatacatcrtttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcccctc
ctctgcctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcatgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594771_P_P-RF-DE Feature FT:CDS FN594771_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne442). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtaaatgagaaaagacggtt
gaaattgattatgcctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcattcgggccggggttcacccctccgcacggaggccttttggggtggagcccgcaggctcagggcataatacaaacct
tgccagcaaatccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagac
actcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattt
ccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcctatatcgtcaatcttctcgagga
ttggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgccctctaattccagagtcttcaaccaccagcacgggaccatgcagaacctgcacgactcc
tgctcaaggaacctctatgtatccctcctgttgctgtacaaaacctttggatggaaactgcacctgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacag
catcttgagaccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaagg
atggggttattctctacatttcatgggttatgtcattggatgttggggatcactgccacaagatcatattatacacaaaa
tcaaagaatgtttccgaaaactccctgtcaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctaggt
tttgttgctcctttcacacaatgtggttatcctgctttgatgcccttatatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctat
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttccagtt
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactga
caactcggttgttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcccctt
ctctgtctgccgttccgaccgaccacgggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FR714490_P_P-RF-GB Feature FT:CDS FR714490_P_P-RF-GB of [Viruses] Hepatitis B Virus recombinant form GB (isolate DL706). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagatt
aaacttaatcatgcctgctcggttctatcctaatcttactaagtatttgcccttagataaaggaataaaaccttattatc
ctgagcaggcagttaatcattacttcaagactaggcattatttacatactctgtggaaatctggcattctatataagaga
gaaacaacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcactcctcctcacggaggtcttttggggtggagtcctcaggctcagggcattttaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctctgcaagatcccagaatcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcacga
ggattggggaccctgcaacgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaaaactaa
gagatggggttattccttaaacttcatgggatatgtaattggaagttggggtaccttgccacaagatcatattatacaaa
aaatcaaacaatgttttaggaaactccctgttaacaggcccattgattggaaagtatgtcaaagaatctcaggactcttg
ggctttgctgctccatttacacaatgtggttaccctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttt
caccttctcgccaacttacaaggtctttctgcgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcct
cttcttcatctgccgtaccgcccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FR714496_P_P-RF-CB Feature FT:CDS FR714496_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate QL523). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaacgaaaaaaggagatt
aaacttaatcatgcctgctaggttctatcctaaccttactaaatatttgcccttggataaaggcattaaaccttattatc
ctgagcaggcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaacaacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaaccaggtaggagt
gggagcattcgggccggggttcactccaccacacggcggtctgttggggtggagccctcaggctcagggcatattgacaa
cattaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccagcaaattccaccaagctctgctagatcccagagtgaggggcctata
ctctcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcaactctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaacttcatgggatatgtaattggaagttggggtaccttgccacaagatcatattatacaga
aaatcaaacaatgttttagaaaactccctgttaacaggcccattgattggaaagtatgtcaaagaatttcaggactctgg
ggctttgctgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagcaggtctggagcaaaccttatcgggac
tgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcagacgacccctctcggggccgcttggggatctatcgtcct
cttctgcgtctgccgtaccgcccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161753_P_P-RF-AE Feature FT:CDS GQ161753_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GH2537). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcct
aagattcatttgcatgaggacattgttaataggtgtcaacaatttgtgggccctctcaccgtaaatgaaaaaagaagact
gaaattaattatgcctgctagattctatcctaacagtacaaaatatttgcccctagacaaagggattaaaccttattatc
ctgatcatgtagttaatcattactttcagactcgacattatttacatactctttggaaggctggtattctatataagagg
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggagcgaatctttctg
ttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaacccagattgggac
ttcaaccccatcaaggaccactggccagcagccaatcaggtaggagtgggagcatttgggccagggttcacccctccaca
cggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgccagcagttcctcctcctgcctccacca
atcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaattcc
acaaatttccaccaagctctgcaggatcccagagtaaggggcctgtattttcctgctggtggctccagttcagaaacagt
aaaccctgttccgaatatcgcctctcacatcttgtcaatctcctcgaggactggggaccctgcaccgaccatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatt
ccaggatccacaataaccagtacgggaccctgcagaacttgcacgactcctgctcaaggcgactctatgtttccctcatg
ttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatggg
agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgggtta
cataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcctgtta
ataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccctttacacaatgtggatac
cctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttctaag
taaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggagcctttgtggctcctctgccgatccatactgcggaactccta
gcagcgtgttttgctcgcagccggtctggagcaacactcatcgggactgataattctgtcgtcctctctcggaaatatac
ttcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
tgcatggagaccaccgtga
>gnl|hbvcds|GQ161754_P_P-RF-DE Feature FT:CDS GQ161754_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GH16). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtaaatgagaaaagaaggtt
gaacttgattatgcctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtattaaaccgtattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcattcgggccggggttcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcataatacaaacct
tgccagcaaatccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagac
actcatcctcaggccatgcagtggaactccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtattt
ccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcatatatcgtcaatcttctcgagga
ttggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcc
tgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacag
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaagag
atggggttattccctacatttcatgggttatgtcattggatgttggggatcattgccacaagatcatatcatgcataaaa
tcaaagaatgtttcagaaaactgcctgttaacagacctattgattggaaagtctgtcagcgaattgtgggtcttctgggt
tttgctgctcctttcacacaatgtggttatcctgctctcatgcccttatatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggct
ccgctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcacgcattctcgggactga
caactctgttgttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcccctt
ctctgcctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161767_P_P-RF-AE Feature FT:CDS GQ161767_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1616). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaattttaccggtctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttcct
aagattcatttacatgaggacattgttaagaggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagatt
acaattgattatgcctgctagattctatcctatcagaacaaaatattttcccttagacaaagggatcaagccttattatc
ctgattatgtagttaatcattacttccagacccgacattatttacatactctttggaaggcgggtattctatataagagg
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaa
aacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatcaagattgggacttcaaccacaacaaggaccactggccacaagccaatcaggtgggagt
gggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgacta
cagtgccagcagttcctcctcctgccgccaccactcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatccacaggcccagtggaaatccacagctttccagcaagctctgcaagatcccagagtcaggggcctgccctt
tcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgagga
ctggggaccctgcaccgaccatggagaacatcacatcaggatccctaggacccccgcccgtgttacaggcggggttttcc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgt
caaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcagaacctgcacgactcc
tgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccat
catcatgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgacgccctttatacagctgtaaccaattttcttttgtctctgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccctaaacttcatgggttacgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaa
tcaaaaactgttttagaaaacttcctgttaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgcagctccctttacacaatgtggataccctgccttaatgcctttgtattcatgtatacaagctaaacaggcttttac
tttctcgccaacttacaaggcctttctacgtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggaccga
taattctgtcgtcctctctcggaagtatacctcctttccatggctgctaggctgtactgccaactggattcttcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccctt
ctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ161806_P_P-RF-EA Feature FT:CDS GQ161806_P_P-RF-EA of [Viruses] Hepatitis B Virus recombinant form EA (isolate GU763). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaractactgttgttagacgamgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctaccatacctgtcttcaatcctaactggaaaactccatcttttcct
gatattcatttrcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacwtcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaacctctgcagratcccagagtaagaggtcaggattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatccccacaaaacaaaaag
atggggatattccctacacttcatgggttayrtaattggaagttggggrtcattgccacaggatcayatygkacagaaaa
tcaaaaattgttttagaaaacttcctattaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgcagctccctttacacaatgtggatatcctgcyttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccwacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacrgtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcmtgcgcggaacctttgtggct
cctmtgccgatccatactgcggaactcctagcmgcttgttttgctcgcagcmggtctggagcgaaactyatcgggactga
yaattctgtcgtyctctcccggaaatatacmtcctttccatggctgctaggctgtrctgccaactggatycttcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatccygcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgtwccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ161837_P_P-RF-AE Feature FT:CDS GQ161837_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1125). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttactggtctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttcct
aagattcatttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagatt
acaattgattatgcctgctagattctatcctatcagaacaaaatattttcccttagacaaagggatcaaaccttattatc
ctgatcatgtagttaatcattacttccagacccgacattatttacatactctttggaaggcgggtattctatataagagg
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaa
aacctcgcaaaggcatggggacgaatctatctgttcccaatcctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtgggagt
gggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgacta
cagtgccagcagttcctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatccacaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaacccctgttccgaatattgcctctcacatctcgtcaatctcctcga
ggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcatgggctttckyaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatctaaaccctaacaaaacaaa
aagatggggttattccttaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattgtacaaa
aaatcaaaaactgttttagaaaacttcctgttaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttg
ggctttgcagctccctttacacaatgtggataccctgccttaatgcctttgtattcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaattaaacagtagttgaaccttnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtactgccaactggattcttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccc
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ183486_P_P-RF-DE Feature FT:CDS GQ183486_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MOD_4568). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattctactactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagatt
gcaattgattatgcctgctaggttttatcctaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacacctagttaatcattacttccaaactagacactatttacacactctttggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcccaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctaaattttatgggcta
tgtcattggatgttatggatctttgccacaagaacacatcaaacaaaaaatcaaagaatgttttcgcaaacttcctgtta
accggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatccaagcaggcttttaccttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactctta
gcagcgtgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205377_P_P-RF-DE Feature FT:CDS GQ205377_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1178). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacatcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttagtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205378_P_P-RF-DE Feature FT:CDS GQ205378_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1181). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205379_P_P-RF-DE Feature FT:CDS GQ205379_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1234). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
atacggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcct
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaacgctaccaaatatttacccttagataagggtattaaaccttactatc
cagaacagctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagactatcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacggt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaagacgaaaagatggggttattctctacacttcatggggta
tgtcattggttgttggggatcattaccacaggagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttatatgcatgtattcaatctaaacaggcttttactttctcgccaacttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcctgggtctctgtcgtcctctcctccgtctgccgtaccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205386_P_P-RF-DE Feature FT:CDS GQ205386_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1503). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgcccttatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205387_P_P-RF-DE Feature FT:CDS GQ205387_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1545). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagtcactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaagacctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacggcccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ331048_P_P-RF-AE Feature FT:CDS GQ331048_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate BV-201). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttct
tttcctaagattcatttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaag
aagattgaaattaattatgcctgctaggttctatcctaacagcactaaatatttgcccctagacaaagggattaaaccct
attatccagatcaggtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccaaaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacaaccttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgtaccgaacatggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtactt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggaatgggcctcagtccgtttctcatggctcagttcactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaagagatggggttactccctaaacttcatgggatatgtaattggaagttggggaacattaccacaggatcatattg
tacaaaaacttaaacactgttttagaaaacttcctgttaataggcctattgattggaaagtatgtcaacgaattgtgggt
cttttgggctttgccgctccttttacacaatgtggataccctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacc
tttgcggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ358155_P_P-RF-CB Feature FT:CDS GQ358155_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J022). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcct
gacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatacactgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatgcagtggaactccacagcatttcaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacagcaacatattgtactaa
aaatcaagcagtgttttcgcaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctgtaggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaattctgtcgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcct
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ358156_P_P-RF-CB Feature FT:CDS GQ358156_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate STN013). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagatt
aaaattaataatgcctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatgcagtggaactccacagcattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaa
acgatggggctactcccttaacttcatgggatacgtaattggaagttggggtaccttaccacagcaacatattatactaa
aaatcaagcagtgttttcgcaaacttcctgtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatataaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctgtgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaac
cgacaattctgtcgtcctctctcggaaatacacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377516_P_P-RF-CB Feature FT:CDS GQ377516_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J10). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattaatagatgtcaacaatttgtaggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttgccgcaagaacatattatactta
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377520_P_P-RF-CB Feature FT:CDS GQ377520_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J18). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagacaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccactacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatctgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtacattaccgcaagaacatattgtacaaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttactcaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaatttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaatcttatcggaac
cgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377522_P_P-RF-CB Feature FT:CDS GQ377522_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J20). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcttttcct
cacattcacttacaggaggatattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
acaattaattatgcctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgtcaaggcatggggacgaatctttctgttcctaatcatctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcagggaggagc
gggagcattcgggccagggttcaccccgccccgcggcggtcttttggggtggagccctcaggctcagggcatattgacta
cagtggccgcagcacctcctcctgcctccacaaatcggaagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcgtcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
agctcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ377534_P_P-RF-CB Feature FT:CDS GQ377534_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J41). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaagacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacaaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgtcaacagtgccagtagcacctc
ctcctgcctccaccaatcggcagacaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccactacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcctcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactccct
taacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgtttta
gaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccgttt
acacaatgtggctatcctgccttaaagcctttatatgcatgtatacactctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaactcccactggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcct
ctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgtttgggactctaccgtccccttctgcatctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377539_P_P-RF-CB Feature FT:CDS GQ377539_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J53). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gaatccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
aggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgactgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatrttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctcgctcagttcactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgttggtcttctg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377544_P_P-RF-CB Feature FT:CDS GQ377544_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J69). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctgta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggctctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccc
cttctgcttctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377548_P_P-RF-CB Feature FT:CDS GQ377548_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J79). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
cacattcatttacaggaggacattatcaatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatc
gctggatgtgactgcggcgttttatcatattcctcttcatcctgctgctatgcctcctcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|GQ377549_P_P-RF-CB Feature FT:CDS GQ377549_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J80). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggaytcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgtta
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaakctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
gaacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggwctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377556_P_P-RF-CB Feature FT:CDS GQ377556_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J87). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaaggagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttaatattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacggtaaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccycacaaggacaactggccggacgccaacawggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactattggggyggagccctcaggctcagggcatatccacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gactctcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaraatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aaatcaagcgatgttttcgaaaactgcctgtaaatagacctattgattggaaagtttgtcaaagaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaakctaagcaggcttt
cactttctcgccaacttacaagacctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaac
cgacaactctgttgtgctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgctgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377560_P_P-RF-CB Feature FT:CDS GQ377560_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J93). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacatacatttgcaggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaataatgcctgcaaggttctatcccaacctcaccaaatatttgccattagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtccccatattcttgggaacaagagctacaccatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccttgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagctctgctagatcccagagtaaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacatgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattatactaa
aaatcaaacaatgttttcggaaacttcctgtaaataggccaattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggtac
tgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377564_P_P-RF-CB Feature FT:CDS GQ377564_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J99). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggggcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccrccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377565_P_P-RF-CB Feature FT:CDS GQ377565_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J100). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattagttatgccggctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtctacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtagagccctcaggctcagggcatactcacta
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377573_P_P-RF-CB Feature FT:CDS GQ377573_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J114). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttcacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtgctga
aaatcaaggaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcgagcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactccgttgtcctctctcggaaatacacctcttttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacggcccgtctcggggccgcttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggwctccccgtctgtgccttctcatctgcc
ggwccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377581_P_P-RF-CB Feature FT:CDS GQ377581_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J129). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgargggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacarcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377590_P_P-RF-CB Feature FT:CDS GQ377590_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J147). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtggggaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattactttcagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccatgaagtggaactcccccactttccaccaaactcttcaagatcccagagtgagggscctrta
ctttcctgctggtggctccagttccggaacagtrarccctgytcmgamtactgyctcwsccatatcgtcaatcttctcga
rgactggggaccctgyaccgaacatggagaacaymrcatcaggaytcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377592_P_P-RF-CB Feature FT:CDS GQ377592_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J149). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcgtttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aagattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatacaaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccaccaccggaccatgcaaaacctgcacgat
tcctgctcaaggaacctctttgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaaaatgtgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcaccgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcggaac
tgacaattctgtcgtgctctcccgcaagtatacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctaccgcccg
cttctccttctgttgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377594_P_P-RF-CB Feature FT:CDS GQ377594_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J152). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacagctggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatgggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccgrccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377595_P_P-RF-BC Feature FT:CDS GQ377595_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J155). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttactaaatatttgcccctagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagg
gagtcaacacgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctgagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgagtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccacttttcttttgtctttgggtatacatttaaatcctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccttgccacaagaacatattgtattga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcmtttctgtgyaaacartatctgaacctttaccccgttgcycggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377596_P_P-RF-CB Feature FT:CDS GQ377596_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J156). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactattggggtggagccctcaggctcaaggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactcaaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaraatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377602_P_P-RF-CB Feature FT:CDS GQ377602_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J165). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgctagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccaaacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttttctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccctgatgcctttatatgcatgtatacaatctaagcaggcttt
cacgttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctatcggccatcgccgtatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377604_P_P-RF-CB Feature FT:CDS GQ377604_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J168). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagatgcaggcaccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgtcgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttggataaagggatcaaaccgtattatc
cagaggatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttatgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377607_P_P-RF-CB Feature FT:CDS GQ377607_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J172). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaatatgcagttaatcattacttcaaaaccaggcattatttacataccctgtggaaggctggcattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggtctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|GQ377611_P_P-RF-CB Feature FT:CDS GQ377611_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J179). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcccgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattactttaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatwggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggrctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377613_P_P-RF-CB Feature FT:CDS GQ377613_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J181). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaraatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttcacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtgctga
aaatcaaggaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggwctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377614_P_P-RF-CB Feature FT:CDS GQ377614_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J185). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377626_P_P-RF-CB Feature FT:CDS GQ377626_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J225). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttaca
aacctcgaaaaggcatgggatcaaatctttctgtcccaaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcagtgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactctgttgtgctctcccgcaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377627_P_P-RF-CD Feature FT:CDS GQ377627_P_P-RF-CD of [Viruses] Hepatitis B Virus recombinant form CD (isolate J231). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaaaacattatcgaaaaatgtgaacagtttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgtaaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctrtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgyctcwcacatatcgtcaatcttctcgaggaytggggaccctgcrctgaacatggagaaca
ycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctactt
ccaggaacatcaactaccaccacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttg
ttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgttacc
aattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggttactcctttaacttcatgggata
tgtaattggaagttggggtactttaccgcaagatcatattgtactaaaaatcaagcaatgttttcgaaaactgcctgtta
atagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctat
cctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggtcaggtstctgccaagtgtttgctgacgcaacccccactg
gatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaatacac
ctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcttctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ377630_P_P-RF-BC Feature FT:CDS GQ377630_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J236). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaacttcactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcttttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctagattctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaraatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttttcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactttaccgcccg
cttctccgccttgtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377633_P_P-RF-CB Feature FT:CDS GQ377633_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J241). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctata
ytttcctgctggtggctccagttccggaacagyaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagarcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactca
aactcaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377634_P_P-RF-CB Feature FT:CDS GQ377634_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J242). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgataaatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagact
taaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcttgcctccaccaatcggcaatcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactccctcaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctctttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ377635_P_P-RF-BC Feature FT:CDS GQ377635_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J245). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctataatcctgagtggcaaactccctcttttcct
aacatccatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaataatgcctgctaggttctatcctaaccgtaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacacactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccaccacatggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctcaccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggaacatcaactaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtggtttacgaaacttcctggaaacaggcctattgattggaaagtatgtcaacaaattgggggtcttttg
gggtttgccggccctttcacgcaatggggatatcctgctttaatgcccttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtagcatggagaccaccgtga
>gnl|hbvcds|GQ475335_P_P-RF-CB Feature FT:CDS GQ475335_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate KOR31LC). Non-functional genomic sequence. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttaaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaattttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaatctacacgaagcgcctcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggggccaactccaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcggcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggagcacaacattccacccagctctgctcaatcctgctggtggctccagttccgg
aacagtaaaccctgttccgacyactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatgg
agagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcct
ctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcc
ctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcc
tatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttccccc
actgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttttaccgct
attaccaattttcttttgtctttgggtatacatttgaaccctaataaaacaaaacgttggggctactcccttaacttcat
gggatatgtaattggaagttggggtactttaccacaggaacatattgtaatgaaaatcaagcaatgttttcggaaactgc
ctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgt
ggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctt
tctgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccc
ccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaa
ctcctagcagcgtgttttgctcgcagccggtctggggcgacactcatcggaactgacaactctgttgtcctctctcggaa
atacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgg
cgctgaatcccgcggacgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgacc
acggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctct
gcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ924618_P_P-RF-CB Feature FT:CDS GQ924618_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate M35). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaacagatgtcaacaatatgtgggccctcttacggttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcataaaaccttattatc
ctgaacatacagttaatcattacttccaaacgaggcattatttacatactctgtggaaggctgggattttatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccaaagtgaggggcctata
ttttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcaagtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttctacgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GU177079_P_P-RF-DE Feature FT:CDS GU177079_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate DN171). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctct
tttccaaatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaag
aaggttaaaattgattatgcctgctaggttctatcccaattttaccaaatatttgcccttggacaagggtatcaaaccct
attatccagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatat
aagagagaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgaccaccagttggat
ccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggt
aggagctggagcattcgggctggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataa
tacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcaggaaggcagcctactccgctgtctccacct
ttgagaaacactcatcctcaggccatgcagtggaactctacaaccttccaccaaactctgcaagatcccagagtgagagg
cctgtatttccctgctggtgggtccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatct
tatcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
aactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctg
cacgactcctgctcaaggaacctctatgtatccctcttgttgctgtacaaaaccttcggatggaaactgcacctgtattc
ccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacactaacaa
aacaaaaagatggggttattctctacattttatgggttatgtcattggatgttggggatcattgccgcaagatcatatca
tacacaaaatcaaagaatgtttccgtaaactccctgttaacaggcctattgattggaaagtatgtcaacgaattgtgggt
cttctgggttttgctgcccctttcacacaatgtggttatcctgctctcatgcccttatatgcatgtattcaatcaaagca
ggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggc
caggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggcaataggccatcagcgcatgcgtggaacc
tttcaggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacattct
cgggactgacaactctgtggttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
tgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgcttggggatctat
cgtcctcttctccgcctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GU357843_P_P-RF-CB Feature FT:CDS GU357843_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Y580). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttagtcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaatgccacagagtctagactcgtggtggacttctcacaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaacatgcaggacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggccggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aacttaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccctttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctcagccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacatcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GU385774_P_P-RF-CB Feature FT:CDS GU385774_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C2-Shanghai). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggaattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttgtggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgagcatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagagtcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttacctcaagaacatattgtacaaa
aaatcaagcactgttttcggaaactgcctgtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgagtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GU563560_P_P-RF-DE Feature FT:CDS GU563560_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BV-146). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaagaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaacaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggcgaaca
gcatatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtctcttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaactcccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|HE981179_P_P-RF-FG Feature FT:CDS HE981179_P_P-RF-FG of [Viruses] Hepatitis B Virus recombinant form FG. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcct
gatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggtt
gaaattgattatgccagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatc
ctgagcatgcagttaatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagaga
gaatccacacgtagcgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaa
cgacaagaaggggcatgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctctt
ttcagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagt
gggaggttacggtccagggttcacacccccacacggtggcctgttggggcggagccctcaggcacaaggtgttctaacaa
ccttgccagcagatccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaaga
gacacacatccacaggcaatgcagtggaactcaacccagttccaccaggccctgttggatccgagggtaagggctctgta
tgttcctgctggtggctccagttcagagacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcga
agactgggggccctgctatgaacatggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggactacc
cgggtgtcctggccaaaattcgcagtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatc
gttggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcggctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatctaaaccctaacaaaacaaa
aagatggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaga
aaattaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttg
ggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggac
tgacaattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccc
cttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981180_P_P-RF-GF Feature FT:CDS HE981180_P_P-RF-GF of [Viruses] Hepatitis B Virus recombinant form GF. Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataggaga
gaaacatcccgtagcgcctcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcctggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaagtaggagttgg
agcctatggacccgggttcacccctccacacgaaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcagtcctgctggtgg
ctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctg
caccgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcct
aaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctgattccaggaccctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtgattcgta
gggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttttctttgggtatacatctaaaccctaacaaaacaaaaaggtggggttattc
cttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgtt
ttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcct
tttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaac
ttataaggcctctctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttg
ctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgt
cctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccg
ttcctgccgaccacgaggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HF571060_P_P-RF-AE Feature FT:CDS HF571060_P_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate 56325). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaattttactggtctttattcctctactgtacctatttttaatcctgaatggcaaactccttcttttcct
aagattcatttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagatt
acaattgattatgcctgctagattctatcctatcagaacaaaatattttcccttagacaaagggatcaaaccctattatc
ctgatcatgtagttaatcattacttccagacccgacattatttacatactctttggaaggcgggtattctatataagagg
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaa
aacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtgggagt
gggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgacta
cagtgccagcagttcctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatccacaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaacattgcctctcacatctcgtcaatctcctcga
ggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatctaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattgtacaaa
aaatcaaacactgttttagaaaacttcctgttaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttg
ggctttgcagctccctttacacaatgtggataccctgccttaatgcctttgtattcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagcaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtactgccaactggattcttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccc
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|HM146131_P_P-RF-AD Feature FT:CDS HM146131_P_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate TCGA5889). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgccactatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggtaggtcccctagaaggagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaaccctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactccccctcacggaggtgttttggggtggagccctcaggctcagggcatat
tgrccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacagctttccaccaaactcttcaggatccymgagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtctatct
cctcgaggattggggaccctgcaccgaacatggagaacatcgcatcaggatacctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacgataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcagggtatgttgcccgtttgtcctctgattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctctaggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacgacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtggat
cctttgggttttgctgcccctttcacacaatgtggttatcctgctttaatgcccttgtatgcctgtattcaatctaagca
ggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggc
caggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacc
tttccggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattct
cgggacggataactctgttgttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
tgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctct
cgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctctcattacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750133_P_P-RF-CB Feature FT:CDS HM750133_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate GSD-54). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacatgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaacattaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaactgtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccctgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750142_P_P-RF-DC Feature FT:CDS HM750142_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QHN-52). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750143_P_P-RF-DC Feature FT:CDS HM750143_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate tibet-116). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgcctcaatcacacatcatgcaaa
aaatcaaagattgttttcgaaaactccctgttaaccggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctggccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750144_P_P-RF-DC Feature FT:CDS HM750144_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QHX-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactccgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcagggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgaatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaca
aaatcaaagattgttttcgaaaactccctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctggccgcttgttctgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacttcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccatggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcgcctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750145_P_P-RF-DC Feature FT:CDS HM750145_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactatgcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
tttggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtgcagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctgaattttatgggctatgtcattgggtgtcatgggtccttgccacaatctcacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggttatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggagtctaccgtccc
cttcttcgtttgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750146_P_P-RF-DC Feature FT:CDS HM750146_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-26). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatattttcctttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaaaatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgtttccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaaacacacatcatacaaa
aaatcaaagattgttttcgtaaactccctgttaacaggcctattgattggaaggtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcaccaacttataaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
ggacaactctgttgtactcgcccgcaaatatacatcctttccatggctgctaggctgcgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750147_P_P-RF-DC Feature FT:CDS HM750147_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggacccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcagggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttcttgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactcttccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750148_P_P-RF-DC Feature FT:CDS HM750148_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacta
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggagttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaggtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggagccttcgtg
gctcctctaccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750149_P_P-RF-DC Feature FT:CDS HM750149_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-60). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggtattaaaccgtattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggcacagggcatattgacaa
cagtgccagcaacaccacctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacagtcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgttctcgcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctaccgtccc
cttcttcgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM750150_P_P-RF-DC Feature FT:CDS HM750150_P_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-70). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacatacatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaacattaccaaatatctgcctttggataaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggcgccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
cagcatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattctctaaatttcatgggctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaa
aaatcaaagattgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggatatcctgccttactgcccttgtatgcatgtattcaatccaaacaggcttt
cacattctcgcaaacttacaagacctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggac
tgacaactctgttgtcctcgcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttatgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcctcggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ684848_P_P-RF-CB Feature FT:CDS HQ684848_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVJSTZ1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
taaatttataatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgtacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtt
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggaacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcaaaacttatcggaac
tgacaattctgtcgtgctctcccgcaagtatacatcttttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ684849_P_P-RF-BC Feature FT:CDS HQ684849_P_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HBVJSTZ2). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaacttcacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgcaagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcga
agactggggaccctgtaacgaacatggagaacacagcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaactaccagcaccggaccatgcaaggcctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaatcggaagttggggtactttaccgcaagagcatattgtactga
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccc
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700462_P_P-RF-CB Feature FT:CDS HQ700462_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_HU27_1996). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctcttttcct
gacattcatttaaaagaagacattatcaataggtgtcaacaatatgtgggccctcttactgttaatgaaaaaagaagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatc
ctgaacacgcagttaatcattactttaaaactaggcattatttacatactctgtggaaagcgggcattctatataagaga
gaaactacacgcagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaacagtgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatacagtggaattccacaacattccaccaagctctgctagatcccagagtaaggggcctgta
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
aaggtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataagactaa
aagatggggctattcccttaacttcatgggctatgtaattggaagttggggtaccttaccacaagaacatattatactca
aaatcaaaaactgttttcgaaaacttcctgtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttg
ggatttgctgccccttttacacaatgtggctatcctgccctaatgcctttgtatgcatgtattcaagctaagcaagcttt
cactttttcgtcaacttacaaagtttttctrtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaac
tgacaactctgttgtcctttctcgcaaatacacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
ctccttcgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700485_P_P-RF-CB Feature FT:CDS HQ700485_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_TE55_1984). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctcttttcct
gacattcatttaaaagaagacattatcaataggtgtcaacaatatgtgggccctcttactgttaatgaaaaaagaagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatc
ctgaacacgcagttaatcattactttaaaactaggcattatttacatactctgtggaaagcgggcattctatataagaga
gaaactacacgcagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaacagtgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtaaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
aaggtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataagaccaa
aagatggggctattcccttaacttcatgggctatgtaattggaagttggggtaccttaccacaagaacatattatactca
aaatcaaacactgttttcgaaaacttcctgtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttg
ggatttgctgccccttttacacaatgtggctatcctgccctaatgcctttgtatgcatgtattcaagctaagcaagcttt
cactttttcgtccacgtacaaagtttttctatgtaaacaatatatgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggggcgaaactcatcgggac
tgacaactctgttgtcctttctcgcaaatacacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700492_P_P-RF-DE Feature FT:CDS HQ700492_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F006PF_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaatcttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagcga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggmcttttggggtggagccctcaggctcagggcataatacaatccatgccagaaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaatcactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaaacctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactaytgcctctcccayatcgtcaatcttctcraggattggggtccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcarttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctamtt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
gtagacctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700493_P_P-RF-DE Feature FT:CDS HQ700493_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F049PF_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaaktttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcttctacca
atcgccagycasmacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggaaggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatcttggggatcattgccgcaaratcacatcatacacaaaatcaaagaatgttttagaaaactccctgtta
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gytggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgctgaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700494_P_P-RF-DE Feature FT:CDS HQ700494_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F062PM_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggatcctcaatgytartatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcagaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaagtttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacattctatggaaggcaggtgttttatataagaga
gaatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattccttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggay
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcccacyccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaaccctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcaccttgagtccctttttaccgctgtwacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttattctctcaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgtta
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccgggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcctgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaagtatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggycgcttggggmcctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|HQ700497_P_P-RF-DE Feature FT:CDS HQ700497_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F109C_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700498_P_P-RF-CB Feature FT:CDS HQ700498_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_F528PF_2005). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctatctttaatcctgagtggcaaactccctcttttcct
gacattcatttgaaagaggacattattaataggtgtcaacaatatgtgggccctcttacaattaatgaaaagcggagatt
aaaattaattatgcctgctaggttttatcccaaccttaccaaatatttgcccttagataaaggcataaaaccttattacc
ctgaacacgcagttaatcattactttaaaactaggcattatttacatactctgtggaaagctggtgttttatataagaga
gaaaccacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccggaggcaaatcaggtaggagc
gggagcattcgggccaggtttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtaaggggccttta
ttttcctgctggtggctccagttccggagcagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
aaggtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataagaccaa
acgatggggctattcccttaacttcatgggatatgtaattggaagttggggaaccttaccacaagaacatattgtactaa
aaatcaaacactgttttcgaaaacttcctgtaaataggcctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtattcaagctaagcaagcttt
cactttttcgtctacttacaaggtttttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactccgttgtcctttctcgcaaatacacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccgaccaacaacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700499_P_P-RF-CB Feature FT:CDS HQ700499_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_F528C_2005). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctatctttaatcctgagtggcaaactccctcttttcct
gacattcatttgaaagaggacattattaataggtgtcaacaatatgtgggccctcttacaattaatgaaaagcggagatt
aaaattaattatgcctgctaggttttatcccaaccttaccaaatatttgcccttagataaaggcataaaaccttattacc
ctgaacacgcagttaatcattactttaaaactaggcattatttacatactctgtggaaagctggtgttttatataagaga
gaaaccacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccggaggcaaatcaggtaggagc
gggagcattcgggccaggtttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtaaggggccttta
ttttcctgctggtggctccagttccggagcagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
aaggtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataagaccaa
acgatggggctattcccttaacttcatgggatatgtaattggaagttggggaaccttaccacaagaacatattgtactaa
aaatcaaacactgttttcgaaaacttcctgtaaataggcctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtattcaagctaagcaagcttt
cactttttcgtctacttacaaggtttttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactccgttgtcctttctcgcaaatacacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccgaccaacaacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700500_P_P-RF-DE Feature FT:CDS HQ700500_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Samoa_En_1993). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
aaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcttctacca
atcgccagtcaggaagacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgctcctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700501_P_P-RF-DE Feature FT:CDS HQ700501_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Samoa_Fa_1991). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700503_P_P-RF-DE Feature FT:CDS HQ700503_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_Ng_1992). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaaggttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtggttcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcacacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700505_P_P-RF-CB Feature FT:CDS HQ700505_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_KI178P_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgttcctgtctttaatcctgagtggcaaaccccctcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatacttgcccttagataaaggcattaaaccttattatc
ctgagcatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatacgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtccatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgat
tcctgcacaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgatggggctattctcttaatttcatgggatatgtaattggatgttggggtaccttacctcaggaacatattatactaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtgtgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtctaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaaattctcggaac
cgacaactctgtcgtcctctcccggaaatacccctcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgcctggggatttaccgtccc
cttctttgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700507_P_P-RF-CB Feature FT:CDS HQ700507_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_179928_2001). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtccctgtcttcaatcctgaatggcaaactccctcctttcct
gacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatc
ctgaaaatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtaggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctcgccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgtkggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtgtgtcaaagaattgtcggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgcaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgtcgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctatcgtccc
cttctttgtctgccgttccggccgaccacggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700508_P_P-RF-CB Feature FT:CDS HQ700508_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_43577_2003). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtccctgtcttcaatcctgaatggcaaattccctcttttcct
gacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatc
ctgaaaatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaacttctcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
aggagcattcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggcccagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctcgccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtgtgtcaaagaattgtcggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccgacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctatcgtccc
cttctttgtctgccgttccggccgaccacggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700509_P_P-RF-CB Feature FT:CDS HQ700509_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_3001_2003). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggrctttattcttctactgtacctgtctttaatactgaatggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaatagatgtcaacaatatgtgggccctcttacaabtaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaacyttaccaaatatttgcccctagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaagcccagggcatactgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggragcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtaatca
aaatcaaacaatgttttcgaaaactgcctgtacataggcctattgattggaaggtgtgtcaaagaattgtgggtttgttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgccgttgtatgcatgtatacaagctaagaaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaacattctcggcac
cgacaactctgtcgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtccc
cttctttgtctgccgttccggccgaccacggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700515_P_P-RF-CB Feature FT:CDS HQ700515_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_TA1_2003). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=2510 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatactgaatggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccataccaaatatttgcccctagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttcggtacccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaagcccagggcatactgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggccttta
cttccctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtaatca
aaatcaaacaatgttttcgaaaactgcctgtacataggcctattgattggaaggtgtgtcaaagaattgtgggtttgttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgccgttgtatgcatgtatacaagctaagaaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaacattctcggcac
cgacaactctgtcgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtccc
cttctttgtctgccgttccggccgaccacggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgca
>gnl|hbvcds|HQ700518_P_P-RF-CB Feature FT:CDS HQ700518_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_D071A_2005). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcacttgcaggaggacattattgatcgatgtcaacaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgccagattctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatc
cagaacatgtagttaatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggaggtattttggggtggagcccgcaggctcagggcatattgacac
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgttagatcccagagtgaggggccttta
ttttcctgctggtggctccggttccggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacctctacaaccagcacgggaccatgcaagacttgcacgac
tcctgctctaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
gcgatggggctactctctcaactttatgggctatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaccttcctgttaataggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaaacaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatttgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccgtaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcac
ggacaactctgttgttctctctcggaagtacacctcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgttccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatttaccgtccc
cttcttcgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700519_P_P-RF-CB Feature FT:CDS HQ700519_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_G028A_2003). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttactcttctactacacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcatttgcgggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattagttatgcctgctcgattttatcctaaccttactaaatatttgccgttagataaaggcattaaaccttattatc
cggaacacgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcctcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttttgcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccaggagcaaatcaggtaggaac
aggagcatttgggccagggttcaccccaccacacggaggtttgttggggtggagccctctggctcagggcacattgacaa
cggtgccagcagcgcctcctcctgcatccaccaatcggcagtcagggagacagccgactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaactttccatcaagctctgctagatccccgagtaaggggccttta
tcttcctgctggtggctccagttccgggacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcactgagcatggagagcacaacatcaggattcctaggacccctgctcgkgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcacttaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcgtcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttctatctttgggtatacatttaaaccctaataaaaccaa
gcgatggggctactgccttaacttcatgggatatgtaattggaagttggggaactttaccacaggaccatattgtgctca
aaatcaagcaatgttttagaaaactccctgtaaataggccaattgattggaaagtgtgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcatgtattcaagctaaacaagcttt
cactttctcgccaacatacaaggcttttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccatgggccacaggcgcatgcgtggcacctttgtg
gctcccctaccgatccatactgcggaactcctagctgcctgttttgctcgcagccggtctggagcgaaactcatcggaac
tgacaactcggttgtcctctctcggaagtacacctccttcccatggctgctaggttgtgctgccaactggatactacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccagcggacgatccgtctcggggccgcttggggatctatcgtccc
cttctccgcctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccatga
>gnl|hbvcds|HQ700520_P_P-RF-CB Feature FT:CDS HQ700520_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_GM009A_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagcagatctcaatctcgggaatcccaatgttagtataccctggactc
ataaggtgggaaactttactgggctttattcttctacagtacctgtctttaatcctgagtggcaaactccctcctttcct
aacatccatttgcaggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagaggagact
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggcgcattcgggccagggttcacccccccacacggaggtcttttggggtggagccctcaggctcagggcatgttaacat
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagg
gacagtcatcctcaggccatgcagtggaatgccaaaacattccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctttcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
catgtgtcctggccaaaattcgcagtccctaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttgaacccgcataaaaccaa
acgatggggctactcccttcacttcatgggttatgtaattggaagttgggggtctttaccacaagaacatattgtactaa
aaatcaaacaatgttttcgaaaactgcctgttaatmggcctattgattggaaggtgtgtcaacgcattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaagcaatattcggccctttaccccgttgcccggcaacggtctggcc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccataccgcggaactcctagcagcctgttttgctcgcagcmggtctggggcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgatccgtcgcggggccgcttgggactctaccgtccc
cttcttcgcctgccgttccggcccaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgattcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700521_P_P-RF-CB Feature FT:CDS HQ700521_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_H058_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggaccc
ataaggtgggaaactttactggtctttattcttctactacacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcctnngagggaggacattatcaataggtgtcaacaatatgtgggccctcttacaattaatgagaaaaggagatt
gaaattaattatgcctgctaggttctatcctaaccttactaaatatttgccattagataagggcattaaaccttattatc
ctgaacatgcagttaaccattacttcaaaactagacattatttgcatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcctcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggatttttgcccgatcaccagttggaccctgtg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccacaagcaaatcaggtaggaac
aggagcatttgggccagggttcaccccaccacacggaggtctgttggggtggagccctctggctcagggcacattgacaa
cggtgccagcagctcctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagg
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagctctgctagatccccgagtaaggggccttta
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcactgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtctgtcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
gcgatggggctactcccttaacttcatgggatatgtaattggaagttggggaactttgccacaggaacatattgtactta
aaatcaagcaatgttttagaaaactacctgtaagtaggccaattgattggaaagtgtgccaaagaattgtaggtctgttg
ggctttgcagccccgtttacacaatgtggatatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccatgggccaccagcgcatgcgtggaacctttgtg
gctccactaccgatccatactgcggaactcctagctgcctgttttgctcgcagccggtctggagcgaaactcatcggaac
tgacaactctgttgtcctctctcggaagtacacctccttcccatggctgctaggttgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccggcggacgatccgtctcggggccgcttggggatttaccgtccc
cttctccgcctaccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700523_P_P-RF-CB Feature FT:CDS HQ700523_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_P032C_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gatattcatttgcaggaggacattatcaacaggtgtcagcaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtatcaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccgaaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctctgttagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacactaaaccttgttccgactactgcttatcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaagcacgggaccctgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
aagatggggttactcccttaacttcatgggatatgtaattggaagttggggtactttgccacaggaacatattgtattaa
aaatcaaacagtgttttcgcaaacttcctgttaataggcctattgattggaaagtgtgtcaaagaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttt
tactttttcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgaggaacttttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggttgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgattggggatctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700524_P_P-RF-DE Feature FT:CDS HQ700524_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_PNG_P043PF_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccgagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700525_P_P-RF-DE Feature FT:CDS HQ700525_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_PNG_P054PF_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccgagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgwccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700526_P_P-RF-CB Feature FT:CDS HQ700526_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_143PF_2005). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
gacattcatttgcaggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggaggtt
aaaattaatcatgcctgctagattttatcctaaccttaccaaatatttgcccctagataaaggcattaaaccttattatc
cggaacatgcagttaatcattactttaaaactaggcattatttgcatactctgtggaaggctggcatcctctataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctctggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagttagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccatcaagctctgctagatcccagagtgagaggcctgta
ttttcctgctggtggctccagttccggaacagtaacccctgttccgacttctgcctctaccatatcgtcaatcttatcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtcgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaactaa
gcgatggggatattcccttaacttcatgggttatgtaattggaagttggggtaccttaccacaggaacatattgttctaa
aactaaagcaatgttttcgaaaacttcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaaacaggcttt
cactttctcgccagtttacaaggcctttttgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcagcgcatgcgtggtgcctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaactcatcggaac
cgacaactctgttgtgctctctcggaagtacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccc
cttctctgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|HQ700527_P_P-RF-CB Feature FT:CDS HQ700527_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_W035A_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
acaaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggggc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctccggcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgagaggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatctcctcca
ggactggggaccctgcgccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcy
cgtgtgtcktggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaactttatgggatatgtaattggatgttggggtactttaccacaagaccatattgtactaa
aaatcaagcaatgttttcgaaaacttcctgttaataggcctattgattggaaggtgtgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaccctttaccccgttgcccggcaacggtctggcc
tctgccaagtatttgctgatgcaacccccactggatggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccttga
>gnl|hbvcds|HQ700528_P_P-RF-CB Feature FT:CDS HQ700528_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_W034A_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcatttgcaggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggggc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctccggcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgagaggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcca
ggactggggaccctgcgccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgatggggctactcccttaactttatgggatatgtaattggatgttggggtactttaccacaagaccatattgtactaa
aaatcaagcaatgttttcgaaaacttcctgttaataggcctattgattggaaggtgtgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaccctttaccccgttgcccggcaacggtctggcc
tctgccaagtatttgctgatgcaacccccactggatggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccttga
>gnl|hbvcds|HQ700530_P_P-RF-CB Feature FT:CDS HQ700530_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T127_1994). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gatattcatttgcaggaggacattatcaacagatgtcagcaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctagccttaccaaatatttaccattagacaaaggtatcaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcg
tttggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccgaaagcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactctacaaccttccaccaagctctgttagatcccagagtgaggggccttta
ttttcctgctggtggctccagttcaggaacattaaaccttgttccgactactgcctctcccatatcgtcaatcttmkcga
cgactggggaccctgcwccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccrttt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
aagatggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggatcatattgtattaa
aaatcaagcaatgttttcgcaaacttcctgttaataggcctattgattggaaagtgtgtcgaagaattgtgggtttgttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcctgtatacacgctaagcaggcttt
cactttttcgccaacttataaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtac
agacaactctgttgtcctctctcggaaatacacctcatttccatggctgctaggttgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700531_P_P-RF-CB Feature FT:CDS HQ700531_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T107_1994). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gatattcatttgcaggaggacattatcaacaggtgtcagcaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtatcaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagaga
gaaactacacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaacccagattgggacttcaaccccaacaaggattactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacac
ccgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagctctgttagatcccagagtgaggggtcttta
ttttcctgctggtggctccagttccggaacactaaaccctgttccgactactgcctctcccatatcgtcaatcttatcga
ggactggggaccctgcactgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaagcacgggaccctgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaacccgaataaaacaaa
aagatggggttactccctcaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattca
aaatcaagcactgttttcgcaaactgcctgttaataggcctattgattggaaagtgtgtcaaaggattgtgggtctgttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttt
cactttttcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcggcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaatctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctaggttgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700532_P_P-RF-CB Feature FT:CDS HQ700532_P_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T114_1994). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gatattcatttgcaggaggacattatcaacaggtgtcagcaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgccattagataaaggtatcaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacattatttacatactttgtggaaggcgggtattttatataagaga
gaaactacacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatcaaacctcggaaaggca
tggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactca
aacaacccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggagcattcgggcc
agggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacacccgtgccagcagctc
ctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccacaaccttccaccaagctctgttagatcccagagtgaggggtctttattttcctgctggtgg
ctccagttccggaacactaaaccctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggcca
aagttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactacaagcacgggaccctgcaagacctgcacaattcctgctcaaggaac
ctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttatacctctattaccaattttcttttgtctttgggtatacatttgaacccgaataaaacaaaaagatggggttactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcactgtt
ttcgcaaactgcctgttaataggcctattgattggaaagtgtgtcaaagaattgtgggtctgttgggctttgctgcccct
tttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggctttcaccttttcgccaac
ttataaggcctttctgtgtaaacaatatctgaacctttaccccgttacccggcaacggtcaggtctmtgccaagtgtttg
ctgacgcaacccccactggctggggcttggctatcggccatcggcgcatgcgtgggacctttgtggctcctttgccgatc
catacggcggaactcctagcagcttgttttgctcgcagccggtctggagcaactctcatcggaaccgacaactctgttgt
cctctctcggaaatacacctcatttccatggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtccccttcttcgtctgccg
ttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700533_P_P-RF-DE Feature FT:CDS HQ700533_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI012P_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtataaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctccactgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccgtctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700534_P_P-RF-DE Feature FT:CDS HQ700534_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI018_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctactactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccaragtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcratgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctccactgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700535_P_P-RF-DE Feature FT:CDS HQ700535_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI152P_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagtttaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaagaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700536_P_P-RF-DE Feature FT:CDS HQ700536_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_K148A_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcakacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacgcctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctactccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcyggctccactgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccgtctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggcgaccaccgtga
>gnl|hbvcds|HQ700537_P_P-RF-DE Feature FT:CDS HQ700537_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI191P_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtrtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtacgcatgtatccaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcctgcgtggaaccttcctggctccactgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700538_P_P-RF-DE Feature FT:CDS HQ700538_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI215p_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccytgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccaytgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|HQ700540_P_P-RF-DE Feature FT:CDS HQ700540_P_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI346C_2004). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcgttttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggacgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactggtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgttttagaaaactccctgttc
ataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtacgcatgtatccaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctat