HBVdb

Dataset for nucleotide sequence C of genotype RF

[Download (right click)] [Alignment] [Repertoires]

1009 sequence(s)

>gnl|hbvcds|AB014375_C_P-RF-CB Feature FT:CDS AB014375_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 16T01HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgggatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgtacgcctcaccatacgg
cactcaggcaagctattctatgttggggcgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacgtttcctg
tcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031265_C_P-RF-CB Feature FT:CDS AB031265_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV VietF-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033557_C_P-RF-CB Feature FT:CDS AB033557_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IWK146). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033558_C_P-RF-DE Feature FT:CDS AB033558_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate JYW796). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaataactctatctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaactctaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033559_C_P-RF-DE Feature FT:CDS AB033559_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate PYW310). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB048702_C_P-RF-DE Feature FT:CDS AB048702_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtaccaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB048703_C_P-RF-DE Feature FT:CDS AB048703_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtaccaatttagaagatccggca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB049609_C_P-RF-CB Feature FT:CDS AB049609_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV AN28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB105172_C_P-RF-CB Feature FT:CDS AB105172_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hawaii 2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcatcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
ccctcagacaagctgttctgtgttggggtgagttaatgaacctggctacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB188243_C_P-RF-DE Feature FT:CDS AB188243_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate KAMCHATKA27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagctcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB188245_C_P-RF-DE Feature FT:CDS AB188245_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ALTAY136). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagctcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB194949_C_P-RF-AE Feature FT:CDS AB194949_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate CMR151). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacgg
cactcaggcaagccactctatgctggggggagttaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcccccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB195939_C_P-RF-CB Feature FT:CDS AB195939_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195940_C_P-RF-CB Feature FT:CDS AB195940_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195941_C_P-RF-CB Feature FT:CDS AB195941_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195950_C_P-RF-CB Feature FT:CDS AB195950_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195951_C_P-RF-CB Feature FT:CDS AB195951_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195955_C_P-RF-CB Feature FT:CDS AB195955_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195956_C_P-RF-CB Feature FT:CDS AB195956_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195957_C_P-RF-CB Feature FT:CDS AB195957_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198084_C_P-RF-CB Feature FT:CDS AB198084_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttatgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205152_C_P-RF-CB Feature FT:CDS AB205152_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HB-JFH7-99). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB210819_C_P-RF-DE Feature FT:CDS AB210819_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaactaatgaccttagctacctgggtgggtgttaatttggaagatcaaaca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacctttcttg
tatcacttttggaagagacaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB222708_C_P-RF-AD Feature FT:CDS AB222708_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate UZBV74). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcagacaactattgtggtttcatacatcttg
cattacttttggaagagacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241109_C_P-RF-CB Feature FT:CDS AB241109_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate PhCH24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcacatttcttg
tcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgcatataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270535_C_P-RF-DC Feature FT:CDS AB270535_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate MGL50F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270538_C_P-RF-DE Feature FT:CDS AB270538_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MGL231F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatttcgggatgccttagagtctyctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtactaatttggaagatcaggca
tctagggatcaagtagtcagttatgtcaacactactgcgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcactttcggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB300369_C_P-RF-CB Feature FT:CDS AB300369_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagaccaagca
tccagggaagcagtagtcaatcatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB330368_C_P-RF-DA Feature FT:CDS AB330368_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate TAJ54HBV). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcacatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367393_C_P-RF-CB Feature FT:CDS AB367393_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 2/Adefovir-treated Pt. 2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctcaatgttag
>gnl|hbvcds|AB367400_C_P-RF-CB Feature FT:CDS AB367400_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367419_C_P-RF-CB Feature FT:CDS AB367419_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacctttcctg
ccttatgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB367800_C_P-RF-CB Feature FT:CDS AB367800_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ADVT Pt. 24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgacccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB453985_C_P-RF-AC Feature FT:CDS AB453985_C_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate JPN_CH7). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcgtttttgcctcctgacttctttccttccat
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcagctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctaactgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagctcaggcaaatattgtggtttcacgtatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB493837_C_P-RF-CB Feature FT:CDS AB493837_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 03UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggagcattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tcaagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB493838_C_P-RF-CB Feature FT:CDS AB493838_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 06UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattggggtttcacatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB493840_C_P-RF-CB Feature FT:CDS AB493840_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 16UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggacctccttgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcatatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB493842_C_P-RF-CB Feature FT:CDS AB493842_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 31UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcatcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493847_C_P-RF-CB Feature FT:CDS AB493847_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 05UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB583679_C_P-RF-DE Feature FT:CDS AB583679_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Pkst8134). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB642096_C_P-RF-CB Feature FT:CDS AB642096_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BFJT2000-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcasctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactmttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670303_C_P-RF-CB Feature FT:CDS AB670303_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Non-HCC pt No.30). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagstatstcaatgttaatatgggcctaaaawtcaggcaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
cacaaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674412_C_P-RF-DE Feature FT:CDS AB674412_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GaziantepHCCC6). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccatataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctaatgaacattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggatctaattaatctatctacctgggtgggtggtaatttgcaagatccaaca
tccagggacgcagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacactgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaagcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttga
>gnl|hbvcds|AB674432_C_P-RF-DE Feature FT:CDS AB674432_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD90). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggaagctttagaatctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674433_C_P-RF-DE Feature FT:CDS AB674433_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgagatcttctagataccgcctcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674434_C_P-RF-DE Feature FT:CDS AB674434_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GaziantepHCCC4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgaacattgttcagctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagctcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagtctactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB674436_C_P-RF-DE Feature FT:CDS AB674436_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SamsunD5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgccacagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcacttatgtcaacactcatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tcttacttttggaagagaaacagtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB674504_C_P-RF-DC Feature FT:CDS AB674504_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 11B18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB933279_C_P-RF-AG Feature FT:CDS AB933279_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2008). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB933280_C_P-RF-AG Feature FT:CDS AB933280_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Tk/JP/2009). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB933281_C_P-RF-AG Feature FT:CDS AB933281_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2010). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcatgcaactattgtggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB933282_C_P-RF-AG Feature FT:CDS AB933282_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2011). Complete genome. [Hepadnaviridae] (length=594 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtt
gttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcg
cagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB933283_C_P-RF-AG Feature FT:CDS AB933283_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2013). Complete genome. [Hepadnaviridae] (length=594 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtt
gttagacgacsggaccgasgcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcg
casaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297619_C_P-RF-DA Feature FT:CDS AF297619_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
acgagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297620_C_P-RF-DA Feature FT:CDS AF297620_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 57). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
tagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccggca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF330110_C_P-RF-CB Feature FT:CDS AF330110_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 975484). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacrg
ccctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF411409_C_P-RF-CB Feature FT:CDS AF411409_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccataccg
cactcaggcaagctattctgtgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
cacaaaatgcccctatcttatcaacacttccggaagctactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461361_C_P-RF-CB Feature FT:CDS AF461361_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate FH3Q). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcctctgtggagttactctcttttttgccttctgacttttttccgtctat
tcgagatctccttgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcacgccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccaagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ344117_C_P-RF-DE Feature FT:CDS AJ344117_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627217_C_P-RF-DE Feature FT:CDS AJ627217_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 20953). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggaccaaatagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagaagcacagttwtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627221_C_P-RF-DE Feature FT:CDS AJ627221_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 30125). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgcmttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgmatctagctacctgggtgggtgttaatttggaagatcaagca
tctagagaccaagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttag
>gnl|hbvcds|AM494716_C_P-RF-DE Feature FT:CDS AM494716_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate CAR175). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011102_C_P-RF-CB Feature FT:CDS AP011102_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcggctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcttacagac
cacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AP011103_C_P-RF-CB Feature FT:CDS AP011103_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AP011104_C_P-RF-CB Feature FT:CDS AP011104_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagttgtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011105_C_P-RF-CB Feature FT:CDS AP011105_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagttgtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011108_C_P-RF-CB Feature FT:CDS AP011108_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccgtctat
tcgagatctcctagataccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaacctggccacttgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY040627_C_P-RF-CB Feature FT:CDS AY040627_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY057948_C_P-RF-DC Feature FT:CDS AY057948_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet127). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttccaa
tcgggatctcctcgacaccgcctctgctctggatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY123041_C_P-RF-CB Feature FT:CDS AY123041_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY123424_C_P-RF-CB Feature FT:CDS AY123424_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccg
cactcaggcaagctattctgtgttggggtgagttgatgaatccggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161140_C_P-RF-AD Feature FT:CDS AY161140_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgatcctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagc
acgagatctcctagataccgcctcagctctatatcgggaagccttagagtctcctgagcactgctcacctcaccatacag
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161141_C_P-RF-AD Feature FT:CDS AY161141_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgatcctcataaagaaattggagctactgtggagttactctcgtttttgccttctgacttctttccttcagc
acgagatctcctagataccgcctcagcactatatcgggaaggcctagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161145_C_P-RF-AD Feature FT:CDS AY161145_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161146_C_P-RF-AD Feature FT:CDS AY161146_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161147_C_P-RF-DA Feature FT:CDS AY161147_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcaga
ccgggatctactagacacagcttcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167095_C_P-RF-CB Feature FT:CDS AY167095_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IIc). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206374_C_P-RF-CB Feature FT:CDS AY206374_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctctggagttactctcttttttgccttctgacttctttccttccat
tcgtgatcttctcgacaccgcctccgctctgtatcgggaggctcttgagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacgtttggaagagatactgttattgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY230115_C_P-RF-DA Feature FT:CDS AY230115_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233277_C_P-RF-AC Feature FT:CDS AY233277_C_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate 1848). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctccggagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233293_C_P-RF-DE Feature FT:CDS AY233293_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY233295_C_P-RF-DE Feature FT:CDS AY233295_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcgagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY236161_C_P-RF-DA Feature FT:CDS AY236161_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 12A). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY247030_C_P-RF-CB Feature FT:CDS AY247030_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate KUHB81). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctagacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY341335_C_P-RF-DE Feature FT:CDS AY341335_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagaatcactagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcagagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY373430_C_P-RF-DE Feature FT:CDS AY373430_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgcattagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagacccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800249_C_P-RF-DC Feature FT:CDS AY800249_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817509_C_P-RF-DC Feature FT:CDS AY817509_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L28). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagatgaagaact
ctctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817510_C_P-RF-DC Feature FT:CDS AY817510_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817511_C_P-RF-DC Feature FT:CDS AY817511_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L49). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817512_C_P-RF-DC Feature FT:CDS AY817512_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggctggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817513_C_P-RF-DC Feature FT:CDS AY817513_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L66). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY817515_C_P-RF-DC Feature FT:CDS AY817515_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L80). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862864_C_P-RF-DC Feature FT:CDS AY862864_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagaaaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862865_C_P-RF-DC Feature FT:CDS AY862865_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3-2nd). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862866_C_P-RF-DC Feature FT:CDS AY862866_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate H3-2nd). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcaggaatctcaatgttag
>gnl|hbvcds|DQ089798_C_P-RF-CB Feature FT:CDS DQ089798_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HK477). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaattgggagcttccggggagttactctctttttggccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagga
tccaggcaagcagtagtcagctatgtcaatgttamtatgggcctaaaaatcagacaactatggtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggatcctcaatgttag
>gnl|hbvcds|DQ111987_C_P-RF-DE Feature FT:CDS DQ111987_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MMU36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144601_C_P-RF-BC Feature FT:CDS DQ144601_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate Cq5-11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315777_C_P-RF-DE Feature FT:CDS DQ315777_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EI03194). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315779_C_P-RF-DE Feature FT:CDS DQ315779_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EI0399). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315780_C_P-RF-DE Feature FT:CDS DQ315780_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EI02456). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagacaccgccgcagctctatatcgggatgcgttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatctacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464164_C_P-RF-DE Feature FT:CDS DQ464164_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttccgc
tcgagatcttctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtggtaatttggaagatcaagca
tctagagatctaatagtcagttatgtcaacaccaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgaagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464165_C_P-RF-DE Feature FT:CDS DQ464165_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttccgc
tcgagatcttctagataccgcctcagctctgtatcgagaatccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtggtaatttggaagatcaagca
tctagagatctaatagtcagttttgtcaccgcccatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggcttcgcactcctcaagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464166_C_P-RF-DE Feature FT:CDS DQ464166_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttccgc
tcgagatcttctagataccgcctcagctctgtatcgagaatccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtggtaatttggaagatcaagca
tctagagatctaatagtcagttttgtcaccgcccatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggcttcgcactcctcaagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464167_C_P-RF-DE Feature FT:CDS DQ464167_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate LT7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtggtaatttggaagatcaagca
tctagagatctaatagtcagttatgtcaacaccaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcccagacgaagatctcaatcgccgcgtcccagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478886_C_P-RF-DC Feature FT:CDS DQ478886_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478887_C_P-RF-DC Feature FT:CDS DQ478887_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478889_C_P-RF-DC Feature FT:CDS DQ478889_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcaagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478890_C_P-RF-DC Feature FT:CDS DQ478890_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478892_C_P-RF-DC Feature FT:CDS DQ478892_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctaacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478897_C_P-RF-DC Feature FT:CDS DQ478897_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478898_C_P-RF-DC Feature FT:CDS DQ478898_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ991753_C_P-RF-DE Feature FT:CDS DQ991753_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Irish-13). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgcgatgctttggagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacttgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaataataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcatcacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EF103282_C_P-RF-AD Feature FT:CDS EF103282_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran103). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccatcctttgctggggggagctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagatcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagagacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103283_C_P-RF-AD Feature FT:CDS EF103283_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran105). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatgactcttgctacctgggtgggtgttaacttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcacactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103284_C_P-RF-AD Feature FT:CDS EF103284_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran113). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcaccatacgg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagctaatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|EF103285_C_P-RF-DE Feature FT:CDS EF103285_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ran128). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF464099_C_P-RF-AG Feature FT:CDS EF464099_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate 05hgg). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|EF494376_C_P-RF-CA Feature FT:CDS EF494376_C_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW706). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcatcgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgcggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttctggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494378_C_P-RF-CA Feature FT:CDS EF494378_C_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW1244). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtgcagttactctcatttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtaccgggaggccttagagtctccggagcattgtacacctcaccatacag
cactacggcaaactattctgtgttggggtgagttggtgaacctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagtcggctatgtcaacggtaatatgggcctaaagatcagacacttgttgtggtttcacatttcttg
tcttacttttggaagagaaacggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatataggc
caccaaatgcccctatcttatcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaagtctcgggaatctcaatgttag
>gnl|hbvcds|EU185780_C_P-RF-AD Feature FT:CDS EU185780_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate H-IDU7 (Rec.Arg-1)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522070_C_P-RF-CB Feature FT:CDS EU522070_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient 7N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccccgca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589337_C_P-RF-CB Feature FT:CDS EU589337_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S710-2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
ccgggatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctccttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaccggggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589339_C_P-RF-CB Feature FT:CDS EU589339_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S1556-11). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattaacacatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
ccgagatctcctcgacaccgccactgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccataccg
cactcagacaagctattgtgtgttggggtgagttgatgaatttggctacctgggtgggaagtaatttggaagacccagca
tccggggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttagtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctaaatgttag
>gnl|hbvcds|EU594406_C_P-RF-DE Feature FT:CDS EU594406_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggatgcattagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594435_C_P-RF-DE Feature FT:CDS EU594435_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594436_C_P-RF-DE Feature FT:CDS EU594436_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660227_C_P-RF-BC Feature FT:CDS EU660227_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HBV-14N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcgcctttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgccactgccctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU717211_C_P-RF-CB Feature FT:CDS EU717211_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate D23K-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttcgat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgca
tccagggaattagtagtcgggtatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU787434_C_P-RF-DC Feature FT:CDS EU787434_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 92). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787435_C_P-RF-DC Feature FT:CDS EU787435_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 114). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccatataaagaatttggagcttctctggagttactctcttttttgccttctgacttttttccttctat
acgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacgtttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787444_C_P-RF-CB Feature FT:CDS EU787444_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate W41). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgaataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcaacaccgcctctgctctgtatcgggaggccttaaagtctccggaacattgttaacctcaccataccg
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgcggtttcccatttcctg
gcttacttttggaaaaaaaacagttcttgagtatttggtgtcttttggagggtggattcccactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcttgcacgaaggtctccttcgccgagacgaaaaagatctcaatctcgggaatctcggtgttaa
>gnl|hbvcds|EU833889_C_P-RF-GA Feature FT:CDS EU833889_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate 5). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtctcacttttgggaaagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcacctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccagtgttag
>gnl|hbvcds|EU833890_C_P-RF-GA Feature FT:CDS EU833890_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate 6). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaataactttgccgtatggcttttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaatcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccgatgttag
>gnl|hbvcds|EU833891_C_P-RF-GC Feature FT:CDS EU833891_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H4536/07). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctctccgtctgt
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cacttaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggacgaccctgga
tccagggatttagtagtcacctatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU835240_C_P-RF-GC Feature FT:CDS EU835240_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate IND-DIB112). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871981_C_P-RF-CB Feature FT:CDS EU871981_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-95-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871983_C_P-RF-CB Feature FT:CDS EU871983_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-97-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871984_C_P-RF-CB Feature FT:CDS EU871984_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871985_C_P-RF-CB Feature FT:CDS EU871985_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtgtcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871986_C_P-RF-CB Feature FT:CDS EU871986_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871987_C_P-RF-CB Feature FT:CDS EU871987_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-01-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871988_C_P-RF-CB Feature FT:CDS EU871988_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-01-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871989_C_P-RF-CB Feature FT:CDS EU871989_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-03-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871990_C_P-RF-CB Feature FT:CDS EU871990_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-04-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871991_C_P-RF-CB Feature FT:CDS EU871991_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-04-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871992_C_P-RF-CB Feature FT:CDS EU871992_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-99-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871993_C_P-RF-CB Feature FT:CDS EU871993_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-99-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871994_C_P-RF-CB Feature FT:CDS EU871994_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-3). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcaagatctccgcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggactaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtcttaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871995_C_P-RF-CB Feature FT:CDS EU871995_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacaaac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871996_C_P-RF-CB Feature FT:CDS EU871996_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871997_C_P-RF-CB Feature FT:CDS EU871997_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtggcaagtaatttggaaggcccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871999_C_P-RF-CB Feature FT:CDS EU871999_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872014_C_P-RF-CB Feature FT:CDS EU872014_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-96-3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872015_C_P-RF-CB Feature FT:CDS EU872015_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-96-1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881995_C_P-RF-CB Feature FT:CDS EU881995_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggcgcatctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU882006_C_P-RF-CB Feature FT:CDS EU882006_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtaccgggaggcattagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacatttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggattcgcactcctgccccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916228_C_P-RF-CB Feature FT:CDS EU916228_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S7.3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctctttttttgcctctgacctttttccttctgt
tcgtgatctacttgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtttgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcatg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcggcaatctcaatgttag
>gnl|hbvcds|EU916232_C_P-RF-CB Feature FT:CDS EU916232_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S8.3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagcgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916239_C_P-RF-CB Feature FT:CDS EU916239_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcgatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916240_C_P-RF-CB Feature FT:CDS EU916240_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgaaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916241_C_P-RF-CB Feature FT:CDS EU916241_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcgatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919166_C_P-RF-CB Feature FT:CDS EU919166_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU919167_C_P-RF-CB Feature FT:CDS EU919167_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939547_C_P-RF-CB Feature FT:CDS EU939547_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939551_C_P-RF-CB Feature FT:CDS EU939551_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C56). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagca
tccagggaattaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939565_C_P-RF-CB Feature FT:CDS EU939565_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C86). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgrgatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattstgtgttggggtgagktgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcccactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagactaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939577_C_P-RF-CB Feature FT:CDS EU939577_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C116). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttaatgaacctggccacctgggtgggaagtaatttggaagaccctgca
tccagggaattagtagtcggttatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaaaagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaataact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctcaatgttag
>gnl|hbvcds|EU939581_C_P-RF-CB Feature FT:CDS EU939581_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate B16). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939589_C_P-RF-CB Feature FT:CDS EU939589_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C175). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacgtgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtggggagtaatttggaagacccagca
tccagggaattagtagtcggctatgttaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939602_C_P-RF-CB Feature FT:CDS EU939602_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C179). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgttgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgataatgtgggcctaaaactcagacgactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939606_C_P-RF-CB Feature FT:CDS EU939606_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C206). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatctggaagacccagca
tcccgggaattagttgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagaaaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939620_C_P-RF-CB Feature FT:CDS EU939620_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate B140). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctatccttctgt
tcgagatcttctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgtacacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggc
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU939621_C_P-RF-CB Feature FT:CDS EU939621_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C94). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcagctcatcatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttag
>gnl|hbvcds|EU939623_C_P-RF-CB Feature FT:CDS EU939623_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C126). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgcctctgctctgtatmgggaggccttagagtctcccgaacattgttcacctcatcatacgg
ctatcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggacgatccagca
tccagggaattaatagtcaactatgtcaacgttaatatgggcctgaaagtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttaa
>gnl|hbvcds|EU939627_C_P-RF-BC Feature FT:CDS EU939627_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccacacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcaracaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939629_C_P-RF-BC Feature FT:CDS EU939629_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C95). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccatcctgtgttggggtgagttgatgaatctggccacctgggtgggaactaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcaggcaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939630_C_P-RF-CB Feature FT:CDS EU939630_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C122). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcctctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939631_C_P-RF-BC Feature FT:CDS EU939631_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C123). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|EU939632_C_P-RF-CB Feature FT:CDS EU939632_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C130). Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ccctcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939668_C_P-RF-CB Feature FT:CDS EU939668_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C182). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023659_C_P-RF-BC Feature FT:CDS FJ023659_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate I1_M04-0469). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcatttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023664_C_P-RF-GC Feature FT:CDS FJ023664_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-0026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023665_C_P-RF-GC Feature FT:CDS FJ023665_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-0033). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagacccttca
tccagggagttagttgtcggttatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|FJ023666_C_P-RF-GC Feature FT:CDS FJ023666_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-1907). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgccgcagctctctaccgggaggctttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactactgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggatgcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|FJ023667_C_P-RF-GC Feature FT:CDS FJ023667_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-2742). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023670_C_P-RF-GC Feature FT:CDS FJ023670_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-3724). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023673_C_P-RF-GC Feature FT:CDS FJ023673_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-4997). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ032337_C_P-RF-CB Feature FT:CDS FJ032337_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S462-5). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032343_C_P-RF-CB Feature FT:CDS FJ032343_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S659-4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcctctgcggagttaatctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaagatcaagca
tccagggatttagtagtcaactatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ349207_C_P-RF-DE Feature FT:CDS FJ349207_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgttgagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaactattgtggtttcacacttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caactaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|FJ349212_C_P-RF-DE Feature FT:CDS FJ349212_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctctcttttggaagagaaaccgttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcctatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ349221_C_P-RF-DE Feature FT:CDS FJ349221_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H149). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttgctctcgtttttgccttctgacttctttccttcgat
aagcgatcttctagccaccgccacagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaactaatgtctctagccacctgggtgggtgtaaatttggatgatccagca
tctagagaacaagtagtcggttatgtcaactctcatatgggcctcaagttcagacaactcttgtggtttcacgtttcttg
tctcatgtttggacgagatttagttttagagtatttggtgtctttcggagtgtggattcgcactcctccggcctatagac
cttcaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ349241_C_P-RF-DC Feature FT:CDS FJ349241_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate C115). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ361772_C_P-RF-GC Feature FT:CDS FJ361772_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttttttccttctat
tcgagatctcctcgacaccgccgctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcccgca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttatgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagac
cacaaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|FJ386578_C_P-RF-CB Feature FT:CDS FJ386578_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1748). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386581_C_P-RF-CB Feature FT:CDS FJ386581_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1764). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386585_C_P-RF-CB Feature FT:CDS FJ386585_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1800). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386586_C_P-RF-CB Feature FT:CDS FJ386586_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1811). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccatataaagaatttggagcttctgcagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctatgtttcgggaggccttagagtctccggaacattgttcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386593_C_P-RF-CB Feature FT:CDS FJ386593_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1877). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttccgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ386633_C_P-RF-CB Feature FT:CDS FJ386633_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2372). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386635_C_P-RF-CB Feature FT:CDS FJ386635_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2399). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
ccgagatctcctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcacgctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagttgtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386643_C_P-RF-CB Feature FT:CDS FJ386643_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2493). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcttcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccccgca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctctcgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|FJ386646_C_P-RF-CB Feature FT:CDS FJ386646_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1716). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcaagatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctcttgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaatcagtagtcggctatgtcaatggtaatatgggcctaaaactcagacaaatactgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|FJ386649_C_P-RF-CB Feature FT:CDS FJ386649_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2422). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386674_C_P-RF-BC Feature FT:CDS FJ386674_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate S659). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcctctgcggagttaatctcttttttgccttctgacttctttcctaatat
tcragatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaagatcaagca
tccagggatttagtagtcaactatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ562223_C_P-RF-CD Feature FT:CDS FJ562223_C_P-RF-CD of [Viruses] Hepatitis B Virus recombinant form CD (isolate I15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctaacttttttccttcagt
acgagatcttctagataccgcctcagctctgtaccgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaatactatgctggggggaactaatgactctagctacctgggtggggggtaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcatcacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|FJ562226_C_P-RF-CB Feature FT:CDS FJ562226_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562227_C_P-RF-CB Feature FT:CDS FJ562227_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttcaat
tcgagatctcctcgacactgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggttatgtcaatgttaacatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtccgctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562229_C_P-RF-CB Feature FT:CDS FJ562229_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I36). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|FJ562247_C_P-RF-CB Feature FT:CDS FJ562247_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I75). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562263_C_P-RF-DC Feature FT:CDS FJ562263_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I113). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgyggagttactctcgtttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttggaagaggaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562267_C_P-RF-CB Feature FT:CDS FJ562267_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I120). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagttgtcctgtgttggggtgatttgatgaatctagccacctgggtgggaagtaatctggaagatccagca
tccagagaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tctcacttttggaagagagactgttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
ccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562271_C_P-RF-CB Feature FT:CDS FJ562271_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I124). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagga
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562277_C_P-RF-CB Feature FT:CDS FJ562277_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I134). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctactctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562278_C_P-RF-DC Feature FT:CDS FJ562278_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562287_C_P-RF-CB Feature FT:CDS FJ562287_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I151). Complete genome. [Hepadnaviridae] (length=552 residues).
atgggccttgacccgtataaagaatttggagcttttggggagttacttttttttttgccttttgacttttttccttccat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562294_C_P-RF-CB Feature FT:CDS FJ562294_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I168). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctccggcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562302_C_P-RF-CB Feature FT:CDS FJ562302_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I186). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgttaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562305_C_P-RF-CB Feature FT:CDS FJ562305_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I191). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562314_C_P-RF-CB Feature FT:CDS FJ562314_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I206). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562317_C_P-RF-CB Feature FT:CDS FJ562317_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I209). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccatataaagaatttggagcctcagcgcagttactctcttttttgcctactgacttctttccttcaat
tcgagatctcctcgacaccgcccaagctttatatcgggaggccttagagtctccggaacattgttcagctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcatttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562328_C_P-RF-CB Feature FT:CDS FJ562328_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I229). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgtctctgctctgcatcgggaggccttagagtctcccgaacattgtacacctcaccatacgg
cactcaggcaagctatactatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggactaaaactcagacaactattgtggtttcacctttcctg
tattacttttgggagagatactgttcttgaatatttggtttcttttggagtgtggattcgcactcctgctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562336_C_P-RF-CB Feature FT:CDS FJ562336_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I115). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcgtcgacaccgccacagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgacgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|FJ692536_C_P-RF-DE Feature FT:CDS FJ692536_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D4_50077). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagartctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttrgaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgttag
>gnl|hbvcds|FJ715345_C_P-RF-CB Feature FT:CDS FJ715345_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVC21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cagtcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715346_C_P-RF-CB Feature FT:CDS FJ715346_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVC22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cagtcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715347_C_P-RF-CB Feature FT:CDS FJ715347_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVC23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cagtcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcc
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715384_C_P-RF-CB Feature FT:CDS FJ715384_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVM51). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715385_C_P-RF-CB Feature FT:CDS FJ715385_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVM52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715387_C_P-RF-CB Feature FT:CDS FJ715387_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVM54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggcttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715411_C_P-RF-CB Feature FT:CDS FJ715411_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVN51). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715412_C_P-RF-CB Feature FT:CDS FJ715412_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVN52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715413_C_P-RF-CB Feature FT:CDS FJ715413_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVN53). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715414_C_P-RF-CB Feature FT:CDS FJ715414_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVN54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787446_C_P-RF-CB Feature FT:CDS FJ787446_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S425-20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787480_C_P-RF-CB Feature FT:CDS FJ787480_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S425-16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ882610_C_P-RF-GC Feature FT:CDS FJ882610_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H2252/01). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ882611_C_P-RF-GC Feature FT:CDS FJ882611_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H2072/03). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|FJ882612_C_P-RF-GC Feature FT:CDS FJ882612_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1886/07). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctgt
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cacttaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggawgaccctgga
tccagggatttagtagtcacctatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ882613_C_P-RF-GC Feature FT:CDS FJ882613_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1357/05). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctgt
tcgggatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagacccttca
tccagggatttagtagtcacctatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ882614_C_P-RF-GC Feature FT:CDS FJ882614_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1099/02). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ882617_C_P-RF-GC Feature FT:CDS FJ882617_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H0645/08). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctgt
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cacttaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgga
tccagggatttagtagtcacctatgtcaatgttaatatgggcctraagattagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccytagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccmaatgttag
>gnl|hbvcds|FJ882618_C_P-RF-GC Feature FT:CDS FJ882618_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H0035/08). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctgt
tcgagatctactcgacaccgcctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cacttaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgga
tccagggatttagtagtcacctatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatcacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ904394_C_P-RF-DE Feature FT:CDS FJ904394_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcttttttgcctgttgacttctttccatcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagmctactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904396_C_P-RF-DE Feature FT:CDS FJ904396_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagcaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacaccgtcgtagagtatttggtgtctttwggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ904397_C_P-RF-DE Feature FT:CDS FJ904397_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A13). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgacatcttctagataccgcctcagctctatttcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagct
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904398_C_P-RF-DE Feature FT:CDS FJ904398_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctaacgt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagartctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaaytaatgactctagctacctgggtgggagcaaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904400_C_P-RF-DE Feature FT:CDS FJ904400_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgtactcctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtgcaaatttggaagatcaagca
tctagggaactagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaaccgttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaatccttccggagactactgttgttagacgaagaggcaggtcccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|FJ904401_C_P-RF-DE Feature FT:CDS FJ904401_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A20). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatcagt
acgagatcttctagataccgcttcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatctaatgactttagctacctgggtgggtgcaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ904403_C_P-RF-DE Feature FT:CDS FJ904403_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgcattagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctgggcggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904404_C_P-RF-DE Feature FT:CDS FJ904404_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgttgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagartctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaggatccagca
tctagggaccaagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904405_C_P-RF-DE Feature FT:CDS FJ904405_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaagacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcccgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggagcaaatttggatgatccagga
tctagggaccaagtagtcagttatgtcaataataatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctagcagacgaaggtgtcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904406_C_P-RF-DE Feature FT:CDS FJ904406_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tatcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904407_C_P-RF-DE Feature FT:CDS FJ904407_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtsgagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggagcaaatttggaagatcaagca
tctagggactcagtagtcagttatgtcaatactaatatgggcctaaaattcaggcaaataatgtggtttcacatttcttg
tctcacttttggaaaagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|FJ904408_C_P-RF-DE Feature FT:CDS FJ904408_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgccagagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagccattatttgctggggggaactaatggctcttgctacctgggtgggagtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacatcgtcttagagtatttggtgtcttttggagtgtggatacgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904409_C_P-RF-DE Feature FT:CDS FJ904409_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A54a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatctactagataccgccactgctctgtttcgggatgcattagagtctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggggatgtaatgaatatagctacctgggtgggagtaaatttgcaagatcaagca
tcgagggaccaagtagtcaattatgtcaattctaatatgggcctaaagttcaggcagctattgtggtttcacatttcttg
cctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904414_C_P-RF-DE Feature FT:CDS FJ904414_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A62). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagccattatttgctggggggagttaatgactctagctacttgggtgggagtaaatttgcaagatccagca
tctagggaccaagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtactagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttcttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|FJ904416_C_P-RF-DE Feature FT:CDS FJ904416_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgtctctagctacctgggtgggagcaaatttagaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcactttcggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|FJ904417_C_P-RF-DE Feature FT:CDS FJ904417_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66b). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgtctctagctacctgggtgggagcaaatttagaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcactttcggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|FJ904425_C_P-RF-DE Feature FT:CDS FJ904425_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtactcctcaccatactg
cactcaggcaagccatcctttgctggggggaactaatgactctagctacctgggtgggttcaaatttggatccagtatct
agggacctagtagtcagttatgtcaatgataatatgggcctaaagttcaggcaaatattgtggtttcacatttcttgtct
cacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaggttatagaccac
ctaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccc
tcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904428_C_P-RF-DE Feature FT:CDS FJ904428_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B7). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgccaatttggaagacccacct
tccagggacctagtagtcagttatgttaatactaatgtgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcatgtttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904430_C_P-RF-DE Feature FT:CDS FJ904430_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggagtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctgacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactccccaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttattagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttga
>gnl|hbvcds|FJ904436_C_P-RF-DE Feature FT:CDS FJ904436_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctaatgacttctatcctccagt
acgagatcttctagacaccgcctmagctctgtttcgggatgccttagagtcttctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttgcaagatcaagct
tccagggacctagtagtcaattatgtcaacmctaatgcgggcctaaagtttaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttga
>gnl|hbvcds|FJ904437_C_P-RF-DE Feature FT:CDS FJ904437_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B30a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgyacacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggagcaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacaattccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904440_C_P-RF-DE Feature FT:CDS FJ904440_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggtgtcaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaacatgggcctgaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagaaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904441_C_P-RF-DE Feature FT:CDS FJ904441_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B42a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttmtgacttctttccttcggt
ccgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaggaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ904442_C_P-RF-DE Feature FT:CDS FJ904442_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagct
tccagggacctagtagtcagttatgtcaatactaatgtgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctaaaggaagaact
ccctcgcctcgcagacaaaggtctaaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904444_C_P-RF-DE Feature FT:CDS FJ904444_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggagcaaatttggaagatccagca
tctagggactcagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctctagcttatagac
cacaaaatgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttaa
>gnl|hbvcds|FJ904447_C_P-RF-DE Feature FT:CDS FJ904447_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FN594767_C_P-RF-DE Feature FT:CDS FN594767_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne127). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctttccttcrgt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaggcaattgtttgctgggggaacataatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tccagggacctactagtcagttatgtcaatactmatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaatcgtcatagagtacttggtgtcgttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594769_C_P-RF-DE Feature FT:CDS FN594769_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne281). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctwstgtgkagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgttggggggacctaatggctctagccacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaattctcatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagacaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN594770_C_P-RF-DE Feature FT:CDS FN594770_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne367). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gmgrgatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cattcaggcaagccattctttgttggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN594771_C_P-RF-DE Feature FT:CDS FN594771_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne442). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattcacctcacattccacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FR714490_C_P-RF-GB Feature FT:CDS FR714490_C_P-RF-GB of [Viruses] Hepatitis B Virus recombinant form GB (isolate DL706). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FR714496_C_P-RF-CB Feature FT:CDS FR714496_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate QL523). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctccattttgccttctgatttctttccgtctac
tcgggaccttctcgacaccgcatcagctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagatatgtcaatgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ161753_C_P-RF-AE Feature FT:CDS GQ161753_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GH2537). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattctctgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ161754_C_P-RF-DE Feature FT:CDS GQ161754_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GH16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ161767_C_P-RF-AE Feature FT:CDS GQ161767_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1616). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggaggccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcgggtatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcatttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ161788_C_P-RF-AE Feature FT:CDS GQ161788_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1607). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggacgccttagaatctcctgagcattgtacaccgcaccacactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcgttgagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ161806_C_P-RF-EA Feature FT:CDS GQ161806_C_P-RF-EA of [Viruses] Hepatitis B Virus recombinant form EA (isolate GU763). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtaccgggaagcmttagagtctcctgagcattgctcacctcaccacacwg
cactmaggcaagccattctttgytggggggaattaatgactctagctacctgggtgggsaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtstctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaractactgttgttagacgamgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|GQ161837_C_P-RF-AE Feature FT:CDS GQ161837_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1125). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcggttttgccctttggmttttttccttcagt
aagagatyttctagataccgcctcarccctgtatcgggatgccttagaatctcytgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtataaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagraaccgtcatagagtatttggtgtcatttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ161838_C_P-RF-AE Feature FT:CDS GQ161838_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GU1127). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatyttttagataccgcctcanccctgtatcgggaynccttagaatctcytkagcattkttcnccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcatttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183486_C_P-RF-DE Feature FT:CDS GQ183486_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MOD_4568). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ205377_C_P-RF-DE Feature FT:CDS GQ205377_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1178). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagattttctagataccgccgcagcgctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205378_C_P-RF-DE Feature FT:CDS GQ205378_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1181). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgccgcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205379_C_P-RF-DE Feature FT:CDS GQ205379_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1234). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatctgctagacaccgccgcagctctatatcgggatgcattagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ205387_C_P-RF-DE Feature FT:CDS GQ205387_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1545). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgccgcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ331048_C_P-RF-AE Feature FT:CDS GQ331048_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate BV-201). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctccttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tcttacttttggaagagatactgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ358155_C_P-RF-CB Feature FT:CDS GQ358155_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J022). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcatcatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tcaagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcatg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ358156_C_P-RF-CB Feature FT:CDS GQ358156_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate STN013). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ377516_C_P-RF-CB Feature FT:CDS GQ377516_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377520_C_P-RF-CB Feature FT:CDS GQ377520_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J18). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377522_C_P-RF-CB Feature FT:CDS GQ377522_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J20). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377534_C_P-RF-CB Feature FT:CDS GQ377534_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377539_C_P-RF-CB Feature FT:CDS GQ377539_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J53). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377544_C_P-RF-CB Feature FT:CDS GQ377544_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J69). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377548_C_P-RF-CB Feature FT:CDS GQ377548_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J79). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377549_C_P-RF-CB Feature FT:CDS GQ377549_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J80). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377556_C_P-RF-CB Feature FT:CDS GQ377556_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J87). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggaggctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctccatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ377560_C_P-RF-CB Feature FT:CDS GQ377560_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J93). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgtgatcttctcgacaccgcctccgctctgtatcgggaggctctagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377564_C_P-RF-CB Feature FT:CDS GQ377564_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J99). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377565_C_P-RF-CB Feature FT:CDS GQ377565_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J100). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377573_C_P-RF-CB Feature FT:CDS GQ377573_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J114). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377581_C_P-RF-CB Feature FT:CDS GQ377581_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377590_C_P-RF-CB Feature FT:CDS GQ377590_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J147). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377592_C_P-RF-CB Feature FT:CDS GQ377592_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J149). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctctagagtctccggagcattgttcacctcaccatacgg
ccatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttgggagacaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccctatagac
cccaaaatgcccctatcttatcaacacttccggaaactactgttattagaggaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ377594_C_P-RF-CB Feature FT:CDS GQ377594_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J152). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagcc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377595_C_P-RF-BC Feature FT:CDS GQ377595_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J155). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377596_C_P-RF-CB Feature FT:CDS GQ377596_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J156). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377602_C_P-RF-CB Feature FT:CDS GQ377602_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J165). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctctcgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377604_C_P-RF-CB Feature FT:CDS GQ377604_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J168). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctaatgacttctttccttctgc
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggtgagttgatgagtctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcgactatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagatgcaggcaccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377607_C_P-RF-CB Feature FT:CDS GQ377607_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J172). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|GQ377611_C_P-RF-CB Feature FT:CDS GQ377611_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J179). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377613_C_P-RF-CB Feature FT:CDS GQ377613_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J181). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcatgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377614_C_P-RF-CB Feature FT:CDS GQ377614_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J185). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377626_C_P-RF-CB Feature FT:CDS GQ377626_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J225). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377627_C_P-RF-CD Feature FT:CDS GQ377627_C_P-RF-CD of [Viruses] Hepatitis B Virus recombinant form CD (isolate J231). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377630_C_P-RF-BC Feature FT:CDS GQ377630_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J236). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377633_C_P-RF-CB Feature FT:CDS GQ377633_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J241). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctccttgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377634_C_P-RF-CB Feature FT:CDS GQ377634_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J242). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377635_C_P-RF-BC Feature FT:CDS GQ377635_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J245). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ475335_C_P-RF-CB Feature FT:CDS GQ475335_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate KOR31LC). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccgtctgacttctttccttccat
tcgagatctccttgacaccgcctctgctatgtatcgggaggccttagagtctccggaacattgtacacctcaccatacag
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924618_C_P-RF-CB Feature FT:CDS GQ924618_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate M35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU177079_C_P-RF-DE Feature FT:CDS GU177079_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate DN171). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU357843_C_P-RF-CB Feature FT:CDS GU357843_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Y580). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
ccgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaaataatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU385774_C_P-RF-CB Feature FT:CDS GU385774_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C2-Shanghai). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcatctacggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactttggtttcacatctcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563560_C_P-RF-DE Feature FT:CDS GU563560_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BV-146). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgccgcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HE981179_C_P-RF-FG Feature FT:CDS HE981179_C_P-RF-FG of [Viruses] Hepatitis B Virus recombinant form FG. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggt
tcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccg
ctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HE981180_C_P-RF-GF Feature FT:CDS HE981180_C_P-RF-GF of [Viruses] Hepatitis B Virus recombinant form GF. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggt
tcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccagtcataccg
ctctcaggcaggctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgca
gccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|HF571060_C_P-RF-AE Feature FT:CDS HF571060_C_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate 56325). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagccctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcatttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|HM146131_C_P-RF-AD Feature FT:CDS HM146131_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate TCGA5889). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctttatatcgggaagccttagagtctcctgagcattgctcaccgcaccatacag
cactcaggcaagccattctctgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgccactatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggtaggtcccctagaagg
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750133_C_P-RF-CB Feature FT:CDS HM750133_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate GSD-54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750142_C_P-RF-DC Feature FT:CDS HM750142_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QHN-52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750143_C_P-RF-DC Feature FT:CDS HM750143_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate tibet-116). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750144_C_P-RF-DC Feature FT:CDS HM750144_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QHX-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750145_C_P-RF-DC Feature FT:CDS HM750145_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750146_C_P-RF-DC Feature FT:CDS HM750146_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750147_C_P-RF-DC Feature FT:CDS HM750147_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcgctcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750148_C_P-RF-DC Feature FT:CDS HM750148_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgggatctcctcgacaccgcttctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750149_C_P-RF-DC Feature FT:CDS HM750149_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-60). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750150_C_P-RF-DC Feature FT:CDS HM750150_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-70). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctatactgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ684848_C_P-RF-CB Feature FT:CDS HQ684848_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVJSTZ1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ684849_C_P-RF-BC Feature FT:CDS HQ684849_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HBVJSTZ2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctgctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|HQ700462_C_P-RF-CB Feature FT:CDS HQ700462_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_HU27_1996). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagacctcctcgacaccgcctcagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtggtcagttatgtcaacattaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|HQ700485_C_P-RF-CB Feature FT:CDS HQ700485_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_TE55_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagacctccttgacaccgcckcagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtggtcagttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700492_C_P-RF-DE Feature FT:CDS HQ700492_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F006PF_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctatccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacttaatgactctagctacctgggtgggtactaacttagaagatccagca
tctagggacctagtagtcaattatgtcaacactaatgcgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactccccmagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700493_C_P-RF-DE Feature FT:CDS HQ700493_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F049PF_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagacgatccagca
tctagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700494_C_P-RF-DE Feature FT:CDS HQ700494_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F062PM_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttasaagatcaagca
tctagggacctggtagtcarttatgtcaacactcatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggatcctcaatgytar
>gnl|hbvcds|HQ700497_C_P-RF-DE Feature FT:CDS HQ700497_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_F109C_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700498_C_P-RF-CB Feature FT:CDS HQ700498_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_F528PF_2005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagttgtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700499_C_P-RF-CB Feature FT:CDS HQ700499_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_F528C_2005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagttgtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700500_C_P-RF-DE Feature FT:CDS HQ700500_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Samoa_En_1993). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700501_C_P-RF-DE Feature FT:CDS HQ700501_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Samoa_Fa_1991). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700503_C_P-RF-DE Feature FT:CDS HQ700503_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_Ng_1992). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaggatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700505_C_P-RF-CB Feature FT:CDS HQ700505_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_KI178P_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccat
tcgggatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccacacag
cactcaggcaagccattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700507_C_P-RF-CB Feature FT:CDS HQ700507_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_179928_2001). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700508_C_P-RF-CB Feature FT:CDS HQ700508_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_43577_2003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tcccgagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700509_C_P-RF-CB Feature FT:CDS HQ700509_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_3001_2003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgggatctactcgacaccgcctcagctctgtatcgggaggccttagagtccccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatattaatatgggcytaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700515_C_P-RF-CB Feature FT:CDS HQ700515_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_TA1_2003). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatttacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgggatctactcgacaccgcctcagctctgtatcgggaggccttagagtccccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700518_C_P-RF-CB Feature FT:CDS HQ700518_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_D071A_2005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggcaacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagttagttatgtcaatgttaatatgggcctaaaaattagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700519_C_P-RF-CB Feature FT:CDS HQ700519_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_G028A_2003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtaaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgagtatttggtatcttttggagtgtggatacgcacacctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700520_C_P-RF-CB Feature FT:CDS HQ700520_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_GM009A_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctcatttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcttcagctttgtatcgggaggccttagagtctcctgaacattgttcacatcaccatacag
ccctcaggcaagctgttctrtgttggggtgagttaatgaatctggcgacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacctttcctg
ccttatgtttggaagagaaactgttcttgagtttttggtgtcttttggagtgtggattcgcactcctcaagcctacagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagcagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700521_C_P-RF-CB Feature FT:CDS HQ700521_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_H058_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgagtatttggtctcttttggagtgtggatacgcacgcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700523_C_P-RF-CB Feature FT:CDS HQ700523_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_P032C_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctttatatagggacgccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattartagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|HQ700524_C_P-RF-DE Feature FT:CDS HQ700524_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_PNG_P043PF_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700525_C_P-RF-DE Feature FT:CDS HQ700525_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_PNG_P054PF_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700526_C_P-RF-CB Feature FT:CDS HQ700526_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_143PF_2005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgaatat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagttagttatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700527_C_P-RF-CB Feature FT:CDS HQ700527_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_W035A_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcttcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggcgacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700528_C_P-RF-CB Feature FT:CDS HQ700528_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_W034A_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcttcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggcgacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700530_C_P-RF-CB Feature FT:CDS HQ700530_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T127_1994). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttctttccctcgat
tcgagatctcctcgacaccgcctcagctttgtatagggacgccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700531_C_P-RF-CB Feature FT:CDS HQ700531_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T107_1994). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctttgtatagggacgccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700532_C_P-RF-CB Feature FT:CDS HQ700532_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T114_1994). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctttgtatagggacgccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tctagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactgttgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700533_C_P-RF-DE Feature FT:CDS HQ700533_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI012P_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700534_C_P-RF-DE Feature FT:CDS HQ700534_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI018_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagaatatttggtgtcttttggagtgtggattcgcactccccaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700535_C_P-RF-DE Feature FT:CDS HQ700535_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI152P_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgayccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagamctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatrtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700536_C_P-RF-DE Feature FT:CDS HQ700536_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_K148A_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcakacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700537_C_P-RF-DE Feature FT:CDS HQ700537_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI191P_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagamctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatrtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700538_C_P-RF-DE Feature FT:CDS HQ700538_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI215p_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactmatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700539_C_P-RF-DE Feature FT:CDS HQ700539_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI346PF_2004). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700540_C_P-RF-DE Feature FT:CDS HQ700540_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI346C_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700541_C_P-RF-DE Feature FT:CDS HQ700541_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI387C_2005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700542_C_P-RF-CB Feature FT:CDS HQ700542_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_Y020_2003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttagtgtcatttggagtgtggattcgcactcctcccgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700547_C_P-RF-CB Feature FT:CDS HQ700547_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I_WA1034A). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttcttcccttccat
tcgcgatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700554_C_P-RF-CB Feature FT:CDS HQ700554_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_PA81). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggcgcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgccacagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctgttctttgttggggggagttaatgaatctggcyacctgggtgggaagtaatttggaagacccagca
tccagggaactagtggtcggttatgtcaacattaatatgggcataaaaatcagacaactattgtggtttcacctttcctg
tcttatgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|HQ700557_C_P-RF-CB Feature FT:CDS HQ700557_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_BB6189_2002). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccatcgat
tcgagatctcctcgacaccgcctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggcagtaatttggaagacccagca
tccagggaattagtggtcagttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctaccgcgtacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700560_C_P-RF-CB Feature FT:CDS HQ700560_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_BE4253_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactmaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagct
tccagggaattagttgtcagttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700579_C_P-RF-DE Feature FT:CDS HQ700579_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate C_Tonga_To29_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttccat
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttacaggatccagca
tctagggacctagtagtcaattatgtcaacactaatgcgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|HQ700580_C_P-RF-CB Feature FT:CDS HQ700580_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_To251_2006). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctgt
tcgagatctcctcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacatgtttcacctcaccatacwg
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaggcaatttggacgacccaaca
tccagggaagcagtggtcagttatgtcaacattaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
cacaaaatgcccctatcttatcaacgcttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcagtctcgggaaccycaatgttaa
>gnl|hbvcds|HQ700581_C_P-RF-DE Feature FT:CDS HQ700581_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_BB6995_2000). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcagcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700582_C_P-RF-DE Feature FT:CDS HQ700582_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_BH0071_2002). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|HQ700583_C_P-RF-DE Feature FT:CDS HQ700583_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_BQ3450_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700584_C_P-RF-DE Feature FT:CDS HQ700584_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_JF5498_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700585_C_P-RF-DE Feature FT:CDS HQ700585_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_Tonga_To29_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttccat
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgactctagctacctgggtgggtactaatttacaggatccagca
tctagggacctagtagtcaattatgtcaacactaatgcgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|J02202_C_P-RF-DE Feature FT:CDS J02202_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacttaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF436919_C_P-RF-CB Feature FT:CDS JF436919_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF436922_C_P-RF-CB Feature FT:CDS JF436922_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgcctttggacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF436923_C_P-RF-CB Feature FT:CDS JF436923_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttggtgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaaccagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgtagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439776_C_P-RF-AG Feature FT:CDS JF439776_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate MAU05C10). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctcgaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JF439995_C_P-RF-DE Feature FT:CDS JF439995_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439996_C_P-RF-DE Feature FT:CDS JF439996_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439998_C_P-RF-DE Feature FT:CDS JF439998_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439999_C_P-RF-DE Feature FT:CDS JF439999_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagtccaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440000_C_P-RF-DE Feature FT:CDS JF440000_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440001_C_P-RF-DE Feature FT:CDS JF440001_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgcgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440002_C_P-RF-DE Feature FT:CDS JF440002_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440003_C_P-RF-DE Feature FT:CDS JF440003_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440004_C_P-RF-DE Feature FT:CDS JF440004_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcttgggaatctcaatgttag
>gnl|hbvcds|JF440005_C_P-RF-DE Feature FT:CDS JF440005_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcttgggaatctcaatgttag
>gnl|hbvcds|JF440006_C_P-RF-DE Feature FT:CDS JF440006_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN60). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440007_C_P-RF-DE Feature FT:CDS JF440007_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagta
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440008_C_P-RF-DE Feature FT:CDS JF440008_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN70). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440009_C_P-RF-DE Feature FT:CDS JF440009_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN72). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440010_C_P-RF-DE Feature FT:CDS JF440010_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN77). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440011_C_P-RF-DE Feature FT:CDS JF440011_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN78). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttgatgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440012_C_P-RF-DE Feature FT:CDS JF440012_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagcctcctgagcattggtcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440013_C_P-RF-DE Feature FT:CDS JF440013_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440014_C_P-RF-DE Feature FT:CDS JF440014_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN86). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440015_C_P-RF-DE Feature FT:CDS JF440015_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN94). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440017_C_P-RF-DA Feature FT:CDS JF440017_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate FOL496). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcgactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440019_C_P-RF-AG Feature FT:CDS JF440019_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate MAU05C2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaag
atctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440021_C_P-RF-AG Feature FT:CDS JF440021_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate MAU05C6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=594 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtt
gttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcg
cagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440022_C_P-RF-AG Feature FT:CDS JF440022_C_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate MAU05C11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=594 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtt
gttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcg
cagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF491448_C_P-RF-DC Feature FT:CDS JF491448_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH-29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF491449_C_P-RF-DC Feature FT:CDS JF491449_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH-32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF491451_C_P-RF-DC Feature FT:CDS JF491451_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH-35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF491455_C_P-RF-DC Feature FT:CDS JF491455_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF491456_C_P-RF-DC Feature FT:CDS JF491456_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754613_C_P-RF-DE Feature FT:CDS JF754613_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TK145). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattttgtgctggggggaattaatggatctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactagtatgggcctaaagttcagacaactattgtggtttcacacttcttg
tctcacttttggaagagacacagtcatagagtatttggtgtctttcggagtgtggatacgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF754616_C_P-RF-DE Feature FT:CDS JF754616_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TK138). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctctgctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaaggagttctgtgctggggggatttaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtctctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF828933_C_P-RF-CB Feature FT:CDS JF828933_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF828934_C_P-RF-CB Feature FT:CDS JF828934_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF828935_C_P-RF-CB Feature FT:CDS JF828935_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF828936_C_P-RF-CB Feature FT:CDS JF828936_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF828938_C_P-RF-CB Feature FT:CDS JF828938_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040798_C_P-RF-DE Feature FT:CDS JN040798_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 919077). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagaatctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattttgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040803_C_P-RF-DE Feature FT:CDS JN040803_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 919031). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcagttatgtcaacactaccgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagatacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagacttctgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN104438_C_P-RF-CB Feature FT:CDS JN104438_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcatatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN104442_C_P-RF-CB Feature FT:CDS JN104442_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257154_C_P-RF-DE Feature FT:CDS JN257154_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHDKR). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttggagtctcatgagcactgctcacctcaccatactg
cactcaggcaagcatttctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggatgcgcactcctccaccttataggc
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN257164_C_P-RF-DE Feature FT:CDS JN257164_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHQNT). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257174_C_P-RF-DE Feature FT:CDS JN257174_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHOTH1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccyttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattcagtgctggggggamctaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagtyatgtcaacwctaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
cgccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257189_C_P-RF-DE Feature FT:CDS JN257189_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHMHD). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcggcaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257191_C_P-RF-DE Feature FT:CDS JN257191_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHWHD1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattttgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccarya
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcmagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257204_C_P-RF-DE Feature FT:CDS JN257204_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHYMN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN257206_C_P-RF-DE Feature FT:CDS JN257206_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHAKF1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggayytaatgwctctagctacctgggtgggtggtaatttggaagacccarya
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaagatacagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257207_C_P-RF-DE Feature FT:CDS JN257207_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHAKF2). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggayytaatgwctctagctacctgggtgggtggtaatttggaagacccarya
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaagatacagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257210_C_P-RF-DE Feature FT:CDS JN257210_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHYSR). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagacccarta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggatccgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257216_C_P-RF-DE Feature FT:CDS JN257216_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHMQR1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctgtgctggggagaattaatgactctagctacctgggtgggtggtaatttggaagayccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN400086_C_P-RF-CB Feature FT:CDS JN400086_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV-75-Baby). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcaagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagayccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642127_C_P-RF-DE Feature FT:CDS JN642127_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccgtcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcatatcaccatactg
cactcaggcaagcaattctatgctggggggaattaatgtctctagctacctgggtgggtagtaatttggatgacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642137_C_P-RF-DE Feature FT:CDS JN642137_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcatgtttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggaacttatgactttagctacctgggtgggtggaaatttagatgatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagtcatagagtatttggtgtctttcggagtgtggattcgcacacctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN642139_C_P-RF-DE Feature FT:CDS JN642139_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagacccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatttttggaagacaaacagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642141_C_P-RF-DE Feature FT:CDS JN642141_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb31). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttaaaagaaatttggagcttctgtggagttactctcgtttttgcctgttgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagaatctcctgaacattgttcagctcaccatactg
ctctcaggcaagcaattctgtgctggggggacttaataactctatctacatgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacaccaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642152_C_P-RF-DE Feature FT:CDS JN642152_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttttgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagaatctcctgaacattgttcagctcaccatactg
ctctcaggcaagcaattctgtgctggggggacttaataactctatctacatgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacaccaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642160_C_P-RF-DE Feature FT:CDS JN642160_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttctgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cattaaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagagacctagtggtcagttatgtcaacactaatatgggcctgaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664915_C_P-RF-DE Feature FT:CDS JN664915_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EN56_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttctgt
ccgagatcttctagataccgcctcagctctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|JN664925_C_P-RF-DE Feature FT:CDS JN664925_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EN57_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttctgt
ccgagatcttctagataccgcctcagctctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|JN664929_C_P-RF-DE Feature FT:CDS JN664929_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HE33_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctttataccgggatgcgttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggagacttaataactctatctacctgggtgggtgctaatttagaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacagttttggagtatttggtgtcgtttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664933_C_P-RF-DA Feature FT:CDS JN664933_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate EN58_CHB). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcctgacttctttccttccgt
ccgggatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccgttctctgctgggtggaattaatgacgctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagggcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664934_C_P-RF-DE Feature FT:CDS JN664934_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EN61_CHB). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=549 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcttttttgcctactgatttctttccgtctgt
acgagatcttctagataccgccrcagctctatatcgggatgcgttggaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaactctttgctggggagaactaatgactctagctacctgggtgggtgccaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaactccc
tcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664935_C_P-RF-DC Feature FT:CDS JN664935_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate HE28_CHB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664940_C_P-RF-DE Feature FT:CDS JN664940_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate THB20_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagggaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664943_C_P-RF-DE Feature FT:CDS JN664943_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EN76_LC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcctactgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatcctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagacccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacctttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN664946_C_P-RF-DA Feature FT:CDS JN664946_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate THB17_LC). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgatacagcctcagctctctttcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagggcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN688689_C_P-RF-DE Feature FT:CDS JN688689_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV115). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaattgggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
tcgagatcttctagataccgcctccgctttgtatcgggatgccttagattctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattttttgctggggggaactaatgactctagctacctgggtgggkgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacacttcttg
tctcacttttggaagagaaacagtthtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccagggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN688715_C_P-RF-DE Feature FT:CDS JN688715_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV192). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcact
aagagatcttttagataccgcctcagctctatttcgggatgccttagagtttcctgagcattgttcacctcaccatactg
caatcaggcaagcaattatttgctggggggaattaatgactctagctacctgggtgggtgttaatttggatcaagcatct
agggacctagtagtcagttatgtcaacaataacatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtct
cacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctscagcttatagaccac
caaatgcccctatcctatcaatccttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccc
tcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|JN688717_C_P-RF-DE Feature FT:CDS JN688717_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV216). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttcccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttaaagtctcctgatcatgtttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagatcaagca
tctagggaccaagttgttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
cctcacttttggaagacaaccggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaactcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttag
>gnl|hbvcds|JQ027310_C_P-RF-CB Feature FT:CDS JQ027310_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtwcacctcaccatacrg
cactmagacaagytattctrtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagayccagca
tccagggaakyagtagtmagctatgtcaatgttaatatgggcctaaaartcagacaactattgtggtttcacatttcytg
tcttacttttggragagaarytgttctwgartatttggtgtcttttggagtgtggattcgcactcctccygcwtacagac
cacmaaatgcccctatcttatcaacacttccggaaactactgttgttagacgamgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JQ040130_C_P-RF-CB Feature FT:CDS JQ040130_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 95). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgktaatatgggcctaaaaatyagacaactactgtggtttcacatttcctg
tctyacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040142_C_P-RF-CB Feature FT:CDS JQ040142_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 262). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggcagtaacttggaagacccagca
tccagggaattagtagtcagctatgttaatattaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040146_C_P-RF-CB Feature FT:CDS JQ040146_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 278). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcamgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcctttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040148_C_P-RF-CB Feature FT:CDS JQ040148_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgkggagttactytcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040174_C_P-RF-CB Feature FT:CDS JQ040174_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G246). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040175_C_P-RF-CB Feature FT:CDS JQ040175_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G250). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ272886_C_P-RF-GF Feature FT:CDS JQ272886_C_P-RF-GF of [Viruses] Hepatitis B Virus recombinant form GF (isolate HBV_MDQ5). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcktttttgccttctgactttttcccgtcwgttcgggayctwctcgacaccgcttcagccttstaccgggaakcyt
tagartcmycwgawcattgywcrcctmaccatacmgcwctcaggcaagcwatmytgtgctggggtgagttratgactttr
gctwcctgggtgggyaataayttggaagatccwgcttccagrgayttrgtggtyaattatgtyaatactaacatgggcyt
aaaaatcaggcaattattgtggtttcacatttcctgycttacttttggragagaaacmgttyttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatccacacttccggaaactactgtt
gttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaag
atctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ272887_C_P-RF-GF Feature FT:CDS JQ272887_C_P-RF-GF of [Viruses] Hepatitis B Virus recombinant form GF (isolate HBV_MDQ24). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagcacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
actctcttttttgccttctgactttttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctt
tagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattgtgctggggtgagttaatgactttg
gcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaactatgtcaatactaacatgggcct
aaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatccacacttccggaaactactgtt
gttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaag
atctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ687532_C_P-RF-DE Feature FT:CDS JQ687532_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Srb 207). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707421_C_P-RF-GA Feature FT:CDS JQ707421_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C1). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707424_C_P-RF-GA Feature FT:CDS JQ707424_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C12). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttccgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccgatgttag
>gnl|hbvcds|JQ707426_C_P-RF-GA Feature FT:CDS JQ707426_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C14). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaataactttgccatatggccttcttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccgatgttag
>gnl|hbvcds|JQ707430_C_P-RF-GA Feature FT:CDS JQ707430_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C19). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707432_C_P-RF-GA Feature FT:CDS JQ707432_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C20). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707441_C_P-RF-GA Feature FT:CDS JQ707441_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C34). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaataccaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707445_C_P-RF-GA Feature FT:CDS JQ707445_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C4). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707448_C_P-RF-GA Feature FT:CDS JQ707448_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C42). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707450_C_P-RF-GA Feature FT:CDS JQ707450_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C44). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707456_C_P-RF-GA Feature FT:CDS JQ707456_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C1). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707457_C_P-RF-GA Feature FT:CDS JQ707457_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C10). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707458_C_P-RF-GA Feature FT:CDS JQ707458_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C11-10). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707459_C_P-RF-GA Feature FT:CDS JQ707459_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C12). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccgatgttag
>gnl|hbvcds|JQ707460_C_P-RF-GA Feature FT:CDS JQ707460_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C13). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707461_C_P-RF-GA Feature FT:CDS JQ707461_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C15). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707462_C_P-RF-GA Feature FT:CDS JQ707462_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C17). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707463_C_P-RF-GA Feature FT:CDS JQ707463_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C19). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagctgcccaatgttag
>gnl|hbvcds|JQ707464_C_P-RF-GA Feature FT:CDS JQ707464_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C2-4). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatcccgcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707465_C_P-RF-GA Feature FT:CDS JQ707465_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C20). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccctctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707466_C_P-RF-GA Feature FT:CDS JQ707466_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C26). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707467_C_P-RF-GA Feature FT:CDS JQ707467_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707468_C_P-RF-GA Feature FT:CDS JQ707468_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C28). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcatgcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcggagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707469_C_P-RF-GA Feature FT:CDS JQ707469_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C32). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707470_C_P-RF-GA Feature FT:CDS JQ707470_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C34). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707471_C_P-RF-GA Feature FT:CDS JQ707471_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C37). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707472_C_P-RF-GA Feature FT:CDS JQ707472_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C40). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707473_C_P-RF-GA Feature FT:CDS JQ707473_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C41). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgactcttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707474_C_P-RF-GA Feature FT:CDS JQ707474_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C43). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707475_C_P-RF-GA Feature FT:CDS JQ707475_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C45). Non-functional genomic sequence. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707714_C_P-RF-CB Feature FT:CDS JQ707714_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S20_21). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ732168_C_P-RF-CB Feature FT:CDS JQ732168_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate DT2007). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801476_C_P-RF-CG Feature FT:CDS JQ801476_C_P-RF-CG of [Viruses] Hepatitis B Virus recombinant form CG (isolate AIDS18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801477_C_P-RF-BC Feature FT:CDS JQ801477_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate AIDS19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttag
>gnl|hbvcds|JX026887_C_P-RF-CB Feature FT:CDS JX026887_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WY-NJ-79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctat
tcgagatctcctcgacaccgccaccgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429896_C_P-RF-CB Feature FT:CDS JX429896_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WY-HZ-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgctcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429898_C_P-RF-DC Feature FT:CDS JX429898_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate WY-HZ-13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX504540_C_P-RF-CB Feature FT:CDS JX504540_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WY-NNJ-13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacactgctcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|JX661485_C_P-RF-CB Feature FT:CDS JX661485_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1201-C1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661486_C_P-RF-CB Feature FT:CDS JX661486_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1225-C12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccggttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661487_C_P-RF-CB Feature FT:CDS JX661487_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1207-C3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tctagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661494_C_P-RF-CB Feature FT:CDS JX661494_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1203-C2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttttttccttctat
tcgagatctcctcgacaccgcctcggctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661498_C_P-RF-CB Feature FT:CDS JX661498_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1213-C6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
ccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898686_C_P-RF-DE Feature FT:CDS JX898686_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898687_C_P-RF-DE Feature FT:CDS JX898687_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcagctcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898688_C_P-RF-DE Feature FT:CDS JX898688_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcagctcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898690_C_P-RF-DE Feature FT:CDS JX898690_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898693_C_P-RF-DE Feature FT:CDS JX898693_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898695_C_P-RF-DE Feature FT:CDS JX898695_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898696_C_P-RF-DE Feature FT:CDS JX898696_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898698_C_P-RF-DE Feature FT:CDS JX898698_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898699_C_P-RF-DE Feature FT:CDS JX898699_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC012653_C_P-RF-AD Feature FT:CDS KC012653_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC172106_C_P-RF-GB Feature FT:CDS KC172106_C_P-RF-GB of [Viruses] Hepatitis B Virus recombinant form GB (isolate BTO3048). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KC315400_C_P-RF-CB Feature FT:CDS KC315400_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate M0914). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774178_C_P-RF-BC Feature FT:CDS KC774178_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate GS12lz2088). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774183_C_P-RF-CB Feature FT:CDS KC774183_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1020). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774186_C_P-RF-CB Feature FT:CDS KC774186_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774188_C_P-RF-CB Feature FT:CDS KC774188_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1028). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774193_C_P-RF-CB Feature FT:CDS KC774193_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774198_C_P-RF-CB Feature FT:CDS KC774198_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2039). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcatttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774201_C_P-RF-CB Feature FT:CDS KC774201_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcatttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774212_C_P-RF-CB Feature FT:CDS KC774212_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2115). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttccat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774222_C_P-RF-CB Feature FT:CDS KC774222_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2166). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774230_C_P-RF-CB Feature FT:CDS KC774230_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1027). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774234_C_P-RF-CB Feature FT:CDS KC774234_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1038). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgataccgcttcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774246_C_P-RF-CB Feature FT:CDS KC774246_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cww1014). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774258_C_P-RF-CB Feature FT:CDS KC774258_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cww1060). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774263_C_P-RF-CB Feature FT:CDS KC774263_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cww1069). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774291_C_P-RF-CB Feature FT:CDS KC774291_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1194). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774294_C_P-RF-CB Feature FT:CDS KC774294_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1205). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttgggagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774305_C_P-RF-CB Feature FT:CDS KC774305_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1672). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctcagctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagaccctgct
tcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctg
tcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774307_C_P-RF-CB Feature FT:CDS KC774307_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2016). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774317_C_P-RF-CB Feature FT:CDS KC774317_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2042). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774322_C_P-RF-CB Feature FT:CDS KC774322_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2053). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774323_C_P-RF-CB Feature FT:CDS KC774323_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2057). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcg
tccagggaattagtagggatttatgtcaatgttaatatgggactaaaaatcacacaactattgtggtttcttccttcctg
tcttacttttggaagacaaactgttcttgcttatctggtaacttttgcagcgtggatacgaactcctccagcttaccgac
caccaaatgcccctatcttatcatcacttcgggaaactactgtggactcacgacgaggcaggtcccataggcgcgttact
ccctcgcctcgcagacgagaagaccaattgccgcgtcccagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|KC774324_C_P-RF-CB Feature FT:CDS KC774324_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2060). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774328_C_P-RF-CB Feature FT:CDS KC774328_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2073). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774332_C_P-RF-CB Feature FT:CDS KC774332_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaacatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774341_C_P-RF-CB Feature FT:CDS KC774341_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1040). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaacatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774344_C_P-RF-CB Feature FT:CDS KC774344_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1049). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774349_C_P-RF-CB Feature FT:CDS KC774349_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1095). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774364_C_P-RF-BC Feature FT:CDS KC774364_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate blz2088). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774414_C_P-RF-BC Feature FT:CDS KC774414_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate bxa2061). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcccactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774420_C_P-RF-DC Feature FT:CDS KC774420_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz1003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774422_C_P-RF-DC Feature FT:CDS KC774422_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz1044). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774423_C_P-RF-DC Feature FT:CDS KC774423_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2018). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774424_C_P-RF-DC Feature FT:CDS KC774424_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2021). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774425_C_P-RF-DC Feature FT:CDS KC774425_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2068). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774426_C_P-RF-DC Feature FT:CDS KC774426_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2091). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774428_C_P-RF-DC Feature FT:CDS KC774428_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2100). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774430_C_P-RF-DC Feature FT:CDS KC774430_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2121). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774431_C_P-RF-DC Feature FT:CDS KC774431_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2122). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774432_C_P-RF-DC Feature FT:CDS KC774432_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2128). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774433_C_P-RF-DC Feature FT:CDS KC774433_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2143). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774434_C_P-RF-DC Feature FT:CDS KC774434_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dur1021). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774435_C_P-RF-DC Feature FT:CDS KC774435_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1006). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774439_C_P-RF-DC Feature FT:CDS KC774439_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1024). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774442_C_P-RF-DC Feature FT:CDS KC774442_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaagctcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774443_C_P-RF-DC Feature FT:CDS KC774443_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1036). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774447_C_P-RF-DC Feature FT:CDS KC774447_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1057). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774448_C_P-RF-DC Feature FT:CDS KC774448_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1058). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774449_C_P-RF-DC Feature FT:CDS KC774449_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1071). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggaacgctattgtgtgttggggtgagttgatgaatttggccacctgggtgggcagtaatttggaagacccagca
tccagggaattaatagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|KC774450_C_P-RF-DE Feature FT:CDS KC774450_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate dww1073). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggtgaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774452_C_P-RF-DC Feature FT:CDS KC774452_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1080). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774453_C_P-RF-DC Feature FT:CDS KC774453_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1083). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774454_C_P-RF-DC Feature FT:CDS KC774454_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1087). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacttgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC774455_C_P-RF-DC Feature FT:CDS KC774455_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1100). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774456_C_P-RF-DC Feature FT:CDS KC774456_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1102). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774457_C_P-RF-DC Feature FT:CDS KC774457_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1105). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774458_C_P-RF-DC Feature FT:CDS KC774458_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1108). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774461_C_P-RF-DC Feature FT:CDS KC774461_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxa1577). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcagacaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774463_C_P-RF-DC Feature FT:CDS KC774463_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxa2066). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774466_C_P-RF-DC Feature FT:CDS KC774466_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1008). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774468_C_P-RF-DC Feature FT:CDS KC774468_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1012). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774470_C_P-RF-DC Feature FT:CDS KC774470_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1017). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggggagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774471_C_P-RF-DC Feature FT:CDS KC774471_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1018). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774472_C_P-RF-DC Feature FT:CDS KC774472_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1020). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774474_C_P-RF-DC Feature FT:CDS KC774474_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1025). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774475_C_P-RF-DC Feature FT:CDS KC774475_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtccccggaacattgttcacctcaccatacag
cactcaggcaagctatcctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774476_C_P-RF-DC Feature FT:CDS KC774476_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1030). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774478_C_P-RF-DC Feature FT:CDS KC774478_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774479_C_P-RF-DC Feature FT:CDS KC774479_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1036). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcttgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774480_C_P-RF-DC Feature FT:CDS KC774480_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1038). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774481_C_P-RF-DC Feature FT:CDS KC774481_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1039). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgtctttggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaacttagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774482_C_P-RF-DC Feature FT:CDS KC774482_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1043). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774483_C_P-RF-DC Feature FT:CDS KC774483_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774484_C_P-RF-DC Feature FT:CDS KC774484_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1051). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774485_C_P-RF-DC Feature FT:CDS KC774485_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1058). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
ccttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774486_C_P-RF-DC Feature FT:CDS KC774486_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1064). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgg
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtgatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774487_C_P-RF-DC Feature FT:CDS KC774487_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1066). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774488_C_P-RF-DC Feature FT:CDS KC774488_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1077). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774489_C_P-RF-DC Feature FT:CDS KC774489_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1079). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774490_C_P-RF-DC Feature FT:CDS KC774490_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1082). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctatatcgtgaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774492_C_P-RF-DC Feature FT:CDS KC774492_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1087). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774493_C_P-RF-DC Feature FT:CDS KC774493_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1089). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774494_C_P-RF-DC Feature FT:CDS KC774494_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1090). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774495_C_P-RF-DC Feature FT:CDS KC774495_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1091). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774497_C_P-RF-DC Feature FT:CDS KC774497_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1097). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774498_C_P-RF-DC Feature FT:CDS KC774498_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dyc1011). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774499_C_P-RF-DC Feature FT:CDS KC774499_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dyc1018). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875338_C_P-RF-DE Feature FT:CDS KC875338_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgcctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|KC875339_C_P-RF-DE Feature FT:CDS KC875339_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgcctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|KF170740_C_P-RF-DE Feature FT:CDS KF170740_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate SDAC_031). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgggatcttctagataccgcctcagctctgtatcgggatgcattagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccgttctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192833_C_P-RF-DE Feature FT:CDS KF192833_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP68). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctggctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192835_C_P-RF-DE Feature FT:CDS KF192835_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctgtgctggggggacctaatgactctggctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacgctaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192836_C_P-RF-DE Feature FT:CDS KF192836_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP69). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192837_C_P-RF-DE Feature FT:CDS KF192837_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP55). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192838_C_P-RF-DE Feature FT:CDS KF192838_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192839_C_P-RF-DE Feature FT:CDS KF192839_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192840_C_P-RF-DE Feature FT:CDS KF192840_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP56). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtgctaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192841_C_P-RF-DE Feature FT:CDS KF192841_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP49). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214656_C_P-RF-AC Feature FT:CDS KF214656_C_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate IND-2009-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttg
ccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214680_C_P-RF-GC Feature FT:CDS KF214680_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate IND-1963-3). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctttggagttactctcttttttgccttctgatttctttccatctgt
tcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctcctgaacattgtacacctcaccatacag
cactcaggcaagcggtaatatgttggggtgagttgatgactctagctacttgggtgggaagtaatttggaagaccctgcc
tccagggatttagtagtcagctatgtcaatggtcatatgggcctaaaatttagacaactattgtggtttcatatttcatg
tcttacgtttggaagagaaactgttcttgagtatttagtgtcttttggagtgtggattcgcactcctcctccatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|KF219922_C_P-RF-GH Feature FT:CDS KF219922_C_P-RF-GH of [Viruses] Hepatitis B Virus recombinant form GH (isolate HBV201302). Complete genome. [Hepadnaviridae] (length=588 residues).
ctggaywgmamaacttgcccatattgcctttttggcttagacattgacccttataaagaatttggagcttctgtggagtt
actctcatttttgccttctgactttttcccgtctgttcgtgaycttctcgacaccgcttcagctytstaccgggawkcct
tagagtccycygawcattgywcsccymaccatacwgcwctcaggcamgcwatyytgtgctggggtgagttgatgacyytr
gctacctgggtgggyaataatttggargatccagcakccagagatytggtrgtcaattatgtyaatactaatatgggyyt
aaaaatyagrcaaytattrtggtttcayatttcctgycttacwtttggragagaaacygttcttgagtatttggtgtctt
ttggagtgtggattcgcactccwcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacramgaggcaggkcccctmgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|KF471643_C_P-RF-DE Feature FT:CDS KF471643_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate PG-60). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctgaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KF679991_C_P-RF-DE Feature FT:CDS KF679991_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EICI-74). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgccgcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagcatttctttgctggggtgaattaatgactctagctacctgggtgggtgctaatttggaagatcaagga
tctagggacctagtagtcagttatgtcaacgttaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttataggc
caccaaatgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779353_C_P-RF-DA Feature FT:CDS KF779353_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate PNF5063). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF873511_C_P-RF-CB Feature FT:CDS KF873511_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 010_EA_Ram). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctg
cctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873513_C_P-RF-CB Feature FT:CDS KF873513_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 024_K_Kal). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccmttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcrgttatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctg
cctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873515_C_P-RF-CB Feature FT:CDS KF873515_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 022_EA_Gap). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacacagccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
cctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873517_C_P-RF-BC Feature FT:CDS KF873517_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 005_EA_Gal). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873518_C_P-RF-CB Feature FT:CDS KF873518_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 016_EA_Gap). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcmmgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873519_C_P-RF-CB Feature FT:CDS KF873519_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 017_EA_Gun). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgccaccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctaacttttggaagagaaacggtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcmmgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873521_C_P-RF-BC Feature FT:CDS KF873521_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 063_K_Ngk). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgcgatctcctcgacaccgccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctg
tctaacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagac
caccaaatgcccctatcttatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873522_C_P-RF-CB Feature FT:CDS KF873522_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 015_WA_Gou). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcatccgctctgtatcgggaggccttagagtctccggagcattgctcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcycgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873523_C_P-RF-CB Feature FT:CDS KF873523_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 055_WA_Oen). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcatccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagmwattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873524_C_P-RF-CB Feature FT:CDS KF873524_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 039_WA_Oen). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcatccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873527_C_P-RF-CB Feature FT:CDS KF873527_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 052_K_Vic). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcagtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tctagagaattagtagtaagttatgtcaatgttaatatgggcctaaaaattcgacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF873530_C_P-RF-CB Feature FT:CDS KF873530_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 018_WAust_Wyn). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgtctgtggagttactctcgtttttgccttccgatttctttccatctat
tcgtgatctcctcgacacggcctccgctctctatcgggaggccctagagtctgcggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaatmagacaattattgtggtttcacatttcctg
tctcacttttggaagagagactgttctggagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagac
crccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873531_C_P-RF-CB Feature FT:CDS KF873531_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 021_TI_Ngu). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctat
tcgagatcttctcgacactgcatccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaargtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873532_C_P-RF-CB Feature FT:CDS KF873532_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 031_TI_Ngu). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctat
tcgagatcttctcgacactgcatccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873533_C_P-RF-CB Feature FT:CDS KF873533_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 028_TI_Ngu). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccmttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctat
tcgagatcttctcgacactgcatccgctctatatcgggaggccttagagtytccggaacattgttcacctcaccatacag
cactcaggcaagctattytgkgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873534_C_P-RF-CB Feature FT:CDS KF873534_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 019_TI_Ngu). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctat
tcgagatcttctcgacactgcatccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF873535_C_P-RF-CB Feature FT:CDS KF873535_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 027_TI_Mil). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcagtggaattactctcttttttgccttctgatttctttccatctat
tcgagatcttctcgacaccgccgccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaacttagacaaatgttatggtttcacatttcctg
tcttagttaggaaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873537_C_P-RF-CB Feature FT:CDS KF873537_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 045_DR_Wad). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgayactgccwycgctctatatcgggatgccttagagtctccggaacattgtacacctcaccatacag
ccctcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggatgcgcactcctcwagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgamgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|KF873538_C_P-RF-CB Feature FT:CDS KF873538_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 059_DR_Wad). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgacactgcctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873540_C_P-RF-CB Feature FT:CDS KF873540_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 003_DR_Dal). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccmttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgacactgcctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctwttctgtgttggggtgarttaatgaatctggctacctgggtaggaagtaatttggaagatccagca
tccagggaattagtartcagttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggattcgcactcctcycgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873542_C_P-RF-CB Feature FT:CDS KF873542_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 038_DR_Wad). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgacactgcctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggattcgcactcctcycgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF873543_C_P-RF-CB Feature FT:CDS KF873543_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 050_DR_Wad). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgacactgcctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KF917451_C_P-RF-DC Feature FT:CDS KF917451_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate YN.071). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgctagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173279_C_P-RF-CB Feature FT:CDS KJ173279_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX004C(e207)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173280_C_P-RF-CB Feature FT:CDS KJ173280_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX004M(e208)). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173299_C_P-RF-CB Feature FT:CDS KJ173299_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HS005C(e22)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatctcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173300_C_P-RF-CB Feature FT:CDS KJ173300_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HS005M(e23)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatctcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173320_C_P-RF-CB Feature FT:CDS KJ173320_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate NH29M(e41)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KJ173322_C_P-RF-CB Feature FT:CDS KJ173322_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate NH30M(e41)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KJ173325_C_P-RF-CB Feature FT:CDS KJ173325_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P004-C(012)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ctctcaggcaagccattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173326_C_P-RF-CB Feature FT:CDS KJ173326_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P004-M(014)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ctctcaggcaagccattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173329_C_P-RF-CB Feature FT:CDS KJ173329_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P011-C(b168)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173330_C_P-RF-CB Feature FT:CDS KJ173330_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P011-M2(170)). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173349_C_P-RF-CB Feature FT:CDS KJ173349_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX017C(e226)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactaytgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173350_C_P-RF-CB Feature FT:CDS KJ173350_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX017M(e227)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ173358_C_P-RF-CB Feature FT:CDS KJ173358_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX065M(e314)). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttttgtggagttactttcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ410497_C_P-RF-BC Feature FT:CDS KJ410497_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HK_1325). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaacatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|KJ410506_C_P-RF-CB Feature FT:CDS KJ410506_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Occult_HK526). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctac
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagacccggcc
tccagggaattagtagtacgctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ410520_C_P-RF-CB Feature FT:CDS KJ410520_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Occult_HK4869). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470884_C_P-RF-DE Feature FT:CDS KJ470884_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8145). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470886_C_P-RF-DE Feature FT:CDS KJ470886_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8117). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470887_C_P-RF-DE Feature FT:CDS KJ470887_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8064). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470888_C_P-RF-DE Feature FT:CDS KJ470888_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagatactgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctraagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470890_C_P-RF-DE Feature FT:CDS KJ470890_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8033). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagatactgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470891_C_P-RF-DE Feature FT:CDS KJ470891_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtactaatttagacgatccagca
tccagggacttagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagatacggttcaagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470892_C_P-RF-DE Feature FT:CDS KJ470892_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8022). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactactgcgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ470897_C_P-RF-DE Feature FT:CDS KJ470897_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8016). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctactagataccgctacagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcatttctgtgctggggggaactaatgcatctagctacctgggtgggtactaatttagaagatcaagca
tcccgggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttga
>gnl|hbvcds|KJ470898_C_P-RF-DE Feature FT:CDS KJ470898_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8142). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttccttccgt
ccgagatctactagataccgctgcagcgctgtatcgggatgccttggagtctcctgagcattgttcacctcaccatactg
cmctcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcataaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagayacggttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacmaaatgcccctatcttatcaacacttccggagacttgtgttattagacaacgaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ586803_C_P-RF-AF Feature FT:CDS KJ586803_C_P-RF-AF of [Viruses] Hepatitis B Virus recombinant form AF. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgactttttcccgtcagt
tcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccg
ctttcaggcaagctatattgtgctggggggagttaatgactttggcttcctgggggggcaataacttggaagatcctgct
gctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctggggtttcacatttcctc
ccttacttttggaagagaaacagtttttgagtatttggtgttttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586810_C_P-RF-AF Feature FT:CDS KJ586810_C_P-RF-AF of [Viruses] Hepatitis B Virus recombinant form AF. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586811_C_P-RF-DF Feature FT:CDS KJ586811_C_P-RF-DF of [Viruses] Hepatitis B Virus recombinant form DF. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagattttttagataccgcctcagctctgtatcgggacgccttagagtttcctgagcattgttcacctccccatactg
cactcaggcaagcaattttttgctggggggaactaatgactctagctacctgggggggggttaatttggaagatccagca
tctagagacctagtggtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacattttttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaactccc
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ598675_C_P-RF-CB Feature FT:CDS KJ598675_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SHB3B2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgtgatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagca
tcccgagaattagtagtaagatatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctg
tcttacttttggaagagcaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ647349_C_P-RF-DE Feature FT:CDS KJ647349_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV156). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagcttcagtggagttactctcgtttttgcctaatgacttctttccttcagc
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggggctaatttggaagagcaagca
tctagagacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacctttcttg
tctctcttttggaagagatacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcctatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KJ647351_C_P-RF-DE Feature FT:CDS KJ647351_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV202). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcctactgacttctatccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggatctaatgaatctagctacctgggtgggggctaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatattgccctaaagttcaggcaactcwtgtggtttcacgtttcttg
tctcacttttgggagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ647356_C_P-RF-DE Feature FT:CDS KJ647356_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV249). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcaggacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggaccaagttgttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|KJ803753_C_P-RF-CB Feature FT:CDS KJ803753_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY515920). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803771_C_P-RF-DB Feature FT:CDS KJ803771_C_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate MY62981). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcccttgctctgtatcgggaggccttagattctccggaacattgttcacctcaccatacgg
caatcaggcaagctattgtgtgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagga
tccagggaattagtagtcaactatgtcaacgttaatatgggcctaaaaatgagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttagtgtctttcggagtgtggattcgcactcctccagcttataggc
catctaatgcccctatcttatcaacgcttccggagactactgttattagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803772_C_P-RF-BC Feature FT:CDS KJ803772_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY816598). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggca
tccagggaactagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttagtctcttttggagtgtggattcgcactcctcaggcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803778_C_P-RF-BC Feature FT:CDS KJ803778_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY753983). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttattgaatctagccacctgggtgggaagtaatttggaagatccagga
tccagggaattagtagtcaactatgtcaacgttaatatgggcctaaaaatgagacaactattgtggtttcacatttcctg
ttttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KJ803782_C_P-RF-CB Feature FT:CDS KJ803782_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY34118). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803785_C_P-RF-CB Feature FT:CDS KJ803785_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY34920). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggaccttctcgacaccgcctctgctctgtgtcgggacgccttagagtctccggaacatgtttcagctcaccatacag
cactaaggcaggctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KJ803788_C_P-RF-CB Feature FT:CDS KJ803788_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY541105). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagatacctttttttttgccttctgacttctttccttctat
tcgagatctcctctacaccacctctgttctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcttcgcagaagatgtaaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803791_C_P-RF-CB Feature FT:CDS KJ803791_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY824318). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgt
tcgggatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cccaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcttggcagaagatctcaatcttggcaatctcaatgttag
>gnl|hbvcds|KJ803798_C_P-RF-CB Feature FT:CDS KJ803798_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY464961). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacggtaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
ctccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803802_C_P-RF-CB Feature FT:CDS KJ803802_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY604675). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803803_C_P-RF-CB Feature FT:CDS KJ803803_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY501032). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctatcctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|KJ803804_C_P-RF-CB Feature FT:CDS KJ803804_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY590465). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacag
cactacggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagacccagca
tccagggaagcagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcctgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KJ803822_C_P-RF-CB Feature FT:CDS KJ803822_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY091938). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagccattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcccaactatagac
caccaaatgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|KJ803827_C_P-RF-BC Feature FT:CDS KJ803827_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY830498). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caataaggcaagctgttttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaggctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtgctagagtatttggtgtcttttggagtgtggattcgcactcctgcaccttacagac
catcaaatgcccctatcttatccacacttcctgagacttctgttgttagagcacggagcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KM213033_C_P-RF-CB Feature FT:CDS KM213033_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WSQ-k1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM359442_C_P-RF-DE Feature FT:CDS KM359442_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate CM4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgctacygtggagttactctcgtttttgcctcaggacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataaatctatctacctgggtgggagctaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KM386676_C_P-RF-DE Feature FT:CDS KM386676_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate CM1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggggctaatttggaagatccagca
tctagggacctagtagtcacttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacacttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM524336_C_P-RF-DE Feature FT:CDS KM524336_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV010_EP-CHB). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctgtgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM524337_C_P-RF-DE Feature FT:CDS KM524337_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV013_EP-CHB). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM524357_C_P-RF-DE Feature FT:CDS KM524357_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV.I-146_HIV-HBV). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctccttgataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM524359_C_P-RF-DE Feature FT:CDS KM524359_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EHBV.I-058_HIV-HBV). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagacccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM577663_C_P-RF-DE Feature FT:CDS KM577663_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM577664_C_P-RF-DE Feature FT:CDS KM577664_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM577665_C_P-RF-DE Feature FT:CDS KM577665_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM577666_C_P-RF-DE Feature FT:CDS KM577666_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctatccatcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaactctttgctgggtggaactaatgaatctagctacctgggtgggggctaatttggaagatcaagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM577667_C_P-RF-DE Feature FT:CDS KM577667_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaaaagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM606741_C_P-RF-DE Feature FT:CDS KM606741_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Cuba53a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctatccttcagt
acgagatcttctagataccgcctctgccctgtatcgggatgccttagagtctcctgagcattgtactcctcaccatacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatcaagca
tctagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM606750_C_P-RF-DE Feature FT:CDS KM606750_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Cuba60). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM606751_C_P-RF-DE Feature FT:CDS KM606751_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Cuba64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgaaggtctcaatcgccacgtcgcagagaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KM875422_C_P-RF-CB Feature FT:CDS KM875422_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate pt12N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttccgt
tcgggatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgagttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP148337_C_P-RF-BC Feature FT:CDS KP148337_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D282-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP148352_C_P-RF-CB Feature FT:CDS KP148352_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate D71-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggggtgtggattcgcacacctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP148442_C_P-RF-BC Feature FT:CDS KP148442_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate Y132-2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggcgttactctcttttttgccttctgatttctttccgtctat
tcgagaccttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacag
cactcaggcaagcagttttgtgctggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaacttttatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KP168416_C_P-RF-DE Feature FT:CDS KP168416_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ELD422). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggt
acgggatcttctagataccgcctcagctctgtaccgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctgtgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcgtg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP168417_C_P-RF-DE Feature FT:CDS KP168417_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ELD429). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP168418_C_P-RF-DE Feature FT:CDS KP168418_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ELD416). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP168420_C_P-RF-DE Feature FT:CDS KP168420_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ELD428). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
acgggatctcctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggagctaatgaatctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcctg
tcttacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP168421_C_P-RF-DE Feature FT:CDS KP168421_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ELD401). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttccgt
acgggatctcctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggaactagtagtcggttatgtcaataatactgtgggcttaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaatcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KP274926_C_P-RF-GA Feature FT:CDS KP274926_C_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate GS-2). Complete genome. [Hepadnaviridae] (length=588 residues).
atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt
gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatcct
tagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggttt
aaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaag
atctgcatctccagcttcccaatgttag
>gnl|hbvcds|KP276253_C_P-RF-DC Feature FT:CDS KP276253_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-1874). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgggatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP276254_C_P-RF-DC Feature FT:CDS KP276254_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-1887). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP276255_C_P-RF-DC Feature FT:CDS KP276255_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-1888). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP276256_C_P-RF-DC Feature FT:CDS KP276256_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-1925). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP288875_C_P-RF-DE Feature FT:CDS KP288875_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate PatC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccatcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacatcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaatacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KP995112_C_P-RF-DE Feature FT:CDS KP995112_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 1925-HCC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KR013806_C_P-RF-CB Feature FT:CDS KR013806_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KR013816_C_P-RF-CB Feature FT:CDS KR013816_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
ccgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KR013843_C_P-RF-CB Feature FT:CDS KR013843_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacgg
cactcaggcaagctattctgtgttgtggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgagcctaaaaatcagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KR013948_C_P-RF-CB Feature FT:CDS KR013948_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgcatcgggaggccttagagtctcctgaccattgttcacctcatcatacgg
cactcaggcaagctgttgtctgttggggtgagttgatgaatctagccacctgggtggggagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctg
tcttacttctggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|KR905422_C_P-RF-DE Feature FT:CDS KR905422_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate EICI-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctccttgataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT003704_C_P-RF-CB Feature FT:CDS KT003704_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IND-DIB-RMRC-667). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
ccgagacctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcg
tccagggaattagttgtaagttatgtcaacgttaatatgggtctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT366492_C_P-RF-DE Feature FT:CDS KT366492_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate C-EICI.40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT366503_C_P-RF-DE Feature FT:CDS KT366503_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate C-EICI.1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctccttgataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT366504_C_P-RF-DE Feature FT:CDS KT366504_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate C-EICI.12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT366505_C_P-RF-DE Feature FT:CDS KT366505_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate C-EICI.17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggatctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcatatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991417_C_P-RF-DC Feature FT:CDS KT991417_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991419_C_P-RF-DC Feature FT:CDS KT991419_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactatgaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991420_C_P-RF-DC Feature FT:CDS KT991420_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttctggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991421_C_P-RF-DC Feature FT:CDS KT991421_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KT991423_C_P-RF-DC Feature FT:CDS KT991423_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991424_C_P-RF-DC Feature FT:CDS KT991424_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I113-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
acgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttggaagaggaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KT991427_C_P-RF-DC Feature FT:CDS KT991427_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I113-2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttggaagaggaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU519422_C_P-RF-DC Feature FT:CDS KU519422_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetLinzhi-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU519423_C_P-RF-DC Feature FT:CDS KU519423_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetLinzhi-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
ccgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU576102_C_P-RF-CB Feature FT:CDS KU576102_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 23-9). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggt
tcgagatctcctcgacaccgcctctgctccgtgtcgggatgccttagagtctccggaacattgttcacctcaccgtacag
cactcaggcaagctattctgtgttgggttgagttgatgaatttagccacctgggtgggaagtaatttggaagacccaaca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtgaattcgcactcctccagcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|KU576103_C_P-RF-CB Feature FT:CDS KU576103_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 23-11). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggt
tcgagatctcctcgacaccgcctctgctctgtgtcgggatgccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttgggttgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtgaattcgcactcctccagcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttatcagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|KU576384_C_P-RF-CB Feature FT:CDS KU576384_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 66-9). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacgtatataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcccctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtggtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgaatatttggtatcttttggagtgtggattcgcactcctaccgcttacagac
cagcaaatgcccctatcttaccaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttaa
>gnl|hbvcds|KU576837_C_P-RF-BC Feature FT:CDS KU576837_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 135-6). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgggagctcctcgacaccgcctcagctctgtatcgggatgccttagagtctccggaacattgctcacctcaccacacag
cactcaggcaagctattctgtgttgggttgagttgatgagtctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctacggcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgttag
>gnl|hbvcds|KU577083_C_P-RF-BC Feature FT:CDS KU577083_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 29-6). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgggagctcctcgacaccgcctcagctctgtatcgggatgccttagagtctccggaacattgctcacctcaccacacag
cactcaggcaagctattctgtgttgggttgagttgatgagtctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctacggcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgttag
>gnl|hbvcds|KU668440_C_P-RF-DE Feature FT:CDS KU668440_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-HCV169). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtctgt
acgagatcttctagataccgcctcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactttagctacctgggtgggtactaatttggacgatccagcc
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggttttagagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
cctcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcacctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KU679939_C_P-RF-CB Feature FT:CDS KU679939_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 083_WA_Man). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcagtggagttactctcttttttgccttctgatttctttccatctat
tcgagatcttctcgacaccgccgccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679940_C_P-RF-CB Feature FT:CDS KU679940_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 084_WA_Man). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcagtggagttactctcttttttgccttctgatttctttccatctat
tcgagatcttctcgacaccgccgccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaamtattatggtttcacatttcctg
tcttacttttggaaragamactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratcccaatgttag
>gnl|hbvcds|KU679941_C_P-RF-CB Feature FT:CDS KU679941_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 087_WA_Jab). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcatccgctctgtatcgggaggctttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679942_C_P-RF-CB Feature FT:CDS KU679942_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 094_CA_Mim). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagaatctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtaagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcatttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU679943_C_P-RF-BC Feature FT:CDS KU679943_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 096_CA_Mim). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccmttataaagaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgccwccgctctgtatcgggaggccttagaatctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtargttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcatttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaracgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU679944_C_P-RF-BC Feature FT:CDS KU679944_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 097_EA_Mil). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcagrcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgktaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679945_C_P-RF-CB Feature FT:CDS KU679945_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 098_DR_Wad). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacmcttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctccttgacactgccttggctctatatcgggatgccttagagtctccggaacrttgttcagctcaccatacag
ccctcaggcaagctattgtgtgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatcaagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacagttattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtatcttttggagtgtggattcgcactcctatcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|KU679946_C_P-RF-BC Feature FT:CDS KU679946_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 100_EA_Gal). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacarac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctaraagaagaact
ccctcgcctcgcaracgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679948_C_P-RF-CB Feature FT:CDS KU679948_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 103_EA_Gap). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccmttayaaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctmaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679950_C_P-RF-CB Feature FT:CDS KU679950_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 108_EA_Gal). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtcttcggaacattgctcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccatca
tccagggacttagtagtcagttatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
cctgacttttggaagagatactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaacgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679952_C_P-RF-CB Feature FT:CDS KU679952_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 114_TI_Ngu). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagcttytgcggagttactctcttttttgccttytgacttttttccgtctat
tcgagatcttctcgacactgcatccgctctatatcgggaggccttagagtctccggaacattgctcayatcaccatacag
cactcaggcaagcyattctgtgttgggttgagttaatgaatcttgctacctgggtgggaggwaatttggatgatccagcw
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaamtattrtggtttcacatttcctg
tcttacttttggaagagataccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttrttagacaacgaggcaggwccyctaraagaagaact
ccctcgcctcgcaracgaaggtctcaatcgccgcgtcgcaraagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679953_C_P-RF-BC Feature FT:CDS KU679953_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 116_EA_Num). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgtgatctcctcgacaccgctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaaygttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgkggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679954_C_P-RF-CB Feature FT:CDS KU679954_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 119_CA_Ood). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagaatctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtargttatgtcaatgttaatatgggcctaaaamttagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcatttggagtgtggattcgcactcctcctgcttacagac
caycaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaraagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU679955_C_P-RF-CB Feature FT:CDS KU679955_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 120_K_Ngk). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctwctgatttctttccgtctat
tcgcgatctcctcgacaccgccgccgctctgtatcgagaggccttagagtctccggaacattgctcagctcaccatacag
cactcaggcaagccattctgtgttggggsgagttaatgaayctggccacctgggtgggaagtaatttggaagaccmagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctg
tctaacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU679956_C_P-RF-CB Feature FT:CDS KU679956_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 121_CA_Tit). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgcctkctgacttctttccgtctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctwttctgtgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccggca
tccagagaattagtagtargttatgtcaatgttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctyccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU679958_C_P-RF-CB Feature FT:CDS KU679958_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 125_WA_War). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgrtttctttccgtctat
tcgagatctcctcgacaccgcatccgctctgtatcgggaggccttagagtctccggagcattgcacacmtcaccatacag
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggttatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KU695741_C_P-RF-CB Feature FT:CDS KU695741_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5022). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU695742_C_P-RF-CB Feature FT:CDS KU695742_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5072). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
acgagatctcctcgacaccgcctcagccctgtatagggaagccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagaccccgca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccatcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU695743_C_P-RF-CB Feature FT:CDS KU695743_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5073). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU695744_C_P-RF-CB Feature FT:CDS KU695744_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5075). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagct
tccagagaattagttgtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
cacccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU695745_C_P-RF-CB Feature FT:CDS KU695745_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5081). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagttgtcagttatgtcaacattaatatgggcctaaaactcagacaaatattgtggtttcacgtttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtaccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU695746_C_P-RF-CB Feature FT:CDS KU695746_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5093). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtccat
tcgggatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaacgttaatatgggcttaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU711666_C_P-RF-DE Feature FT:CDS KU711666_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 007N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggacgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736914_C_P-RF-DE Feature FT:CDS KU736914_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ethiopia_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggatgccctagagtctcctgagcactgttcacctcatcatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagagaccgtcatagagtatttggtgtcttttggagtgkggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736915_C_P-RF-DE Feature FT:CDS KU736915_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ethiopia_2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggatgccctagagtctcctgagcactgttcacctcatcatactg
cactcaggcaagccattctttgttggggggacctaatgactctagctacctgggtgggtgyaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagagaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736916_C_P-RF-DE Feature FT:CDS KU736916_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Sudan_11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgggatcttctagataccgcctcagctctttatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggacttaatgtctttagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccggcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736917_C_P-RF-DE Feature FT:CDS KU736917_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Sudan_19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggatgccctagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736921_C_P-RF-DE Feature FT:CDS KU736921_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ethiopia_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtatcgggatgccttaragtctcctgagcactgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaratccagca
tctagggacttagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaaaagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736922_C_P-RF-DE Feature FT:CDS KU736922_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ethiopia_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacttagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaaaagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaaraggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU736923_C_P-RF-DE Feature FT:CDS KU736923_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Somalia_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963856_C_P-RF-CB Feature FT:CDS KU963856_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963857_C_P-RF-CB Feature FT:CDS KU963857_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963858_C_P-RF-CB Feature FT:CDS KU963858_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963859_C_P-RF-CB Feature FT:CDS KU963859_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963860_C_P-RF-CB Feature FT:CDS KU963860_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963861_C_P-RF-CB Feature FT:CDS KU963861_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963862_C_P-RF-CB Feature FT:CDS KU963862_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_7). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963863_C_P-RF-CB Feature FT:CDS KU963863_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963864_C_P-RF-CB Feature FT:CDS KU963864_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963865_C_P-RF-CB Feature FT:CDS KU963865_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963866_C_P-RF-CB Feature FT:CDS KU963866_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963867_C_P-RF-CB Feature FT:CDS KU963867_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963868_C_P-RF-CB Feature FT:CDS KU963868_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963869_C_P-RF-CB Feature FT:CDS KU963869_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963870_C_P-RF-CB Feature FT:CDS KU963870_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963883_C_P-RF-CB Feature FT:CDS KU963883_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 6_13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963930_C_P-RF-CB Feature FT:CDS KU963930_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963931_C_P-RF-CB Feature FT:CDS KU963931_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_2). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963932_C_P-RF-CB Feature FT:CDS KU963932_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_3). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963933_C_P-RF-CB Feature FT:CDS KU963933_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_4). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963934_C_P-RF-CB Feature FT:CDS KU963934_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_5). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963935_C_P-RF-CB Feature FT:CDS KU963935_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_6). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963936_C_P-RF-CB Feature FT:CDS KU963936_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963938_C_P-RF-CB Feature FT:CDS KU963938_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_9). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963939_C_P-RF-CB Feature FT:CDS KU963939_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_10). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963940_C_P-RF-CB Feature FT:CDS KU963940_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_11). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963941_C_P-RF-CB Feature FT:CDS KU963941_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963942_C_P-RF-CB Feature FT:CDS KU963942_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_13). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963943_C_P-RF-CB Feature FT:CDS KU963943_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_14). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963944_C_P-RF-CB Feature FT:CDS KU963944_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 10_15). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963990_C_P-RF-CB Feature FT:CDS KU963990_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963991_C_P-RF-CB Feature FT:CDS KU963991_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963993_C_P-RF-CB Feature FT:CDS KU963993_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963994_C_P-RF-CB Feature FT:CDS KU963994_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963995_C_P-RF-CB Feature FT:CDS KU963995_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963998_C_P-RF-CB Feature FT:CDS KU963998_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU963999_C_P-RF-CB Feature FT:CDS KU963999_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964001_C_P-RF-CB Feature FT:CDS KU964001_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964003_C_P-RF-CB Feature FT:CDS KU964003_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964005_C_P-RF-CB Feature FT:CDS KU964005_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964006_C_P-RF-CB Feature FT:CDS KU964006_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttctcatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964007_C_P-RF-CB Feature FT:CDS KU964007_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964008_C_P-RF-CB Feature FT:CDS KU964008_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964009_C_P-RF-CB Feature FT:CDS KU964009_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964010_C_P-RF-CB Feature FT:CDS KU964010_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacatggttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964303_C_P-RF-CB Feature FT:CDS KU964303_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964304_C_P-RF-CB Feature FT:CDS KU964304_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964305_C_P-RF-CB Feature FT:CDS KU964305_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964306_C_P-RF-CB Feature FT:CDS KU964306_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964307_C_P-RF-CB Feature FT:CDS KU964307_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964308_C_P-RF-CB Feature FT:CDS KU964308_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964309_C_P-RF-CB Feature FT:CDS KU964309_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964310_C_P-RF-CB Feature FT:CDS KU964310_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964311_C_P-RF-CB Feature FT:CDS KU964311_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964312_C_P-RF-CB Feature FT:CDS KU964312_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964313_C_P-RF-CB Feature FT:CDS KU964313_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964314_C_P-RF-CB Feature FT:CDS KU964314_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964315_C_P-RF-CB Feature FT:CDS KU964315_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964316_C_P-RF-CB Feature FT:CDS KU964316_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964317_C_P-RF-CB Feature FT:CDS KU964317_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964351_C_P-RF-CB Feature FT:CDS KU964351_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 39_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tagagatctcctcgacaccgcctctgcattgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KU964366_C_P-RF-DC Feature FT:CDS KU964366_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964367_C_P-RF-DC Feature FT:CDS KU964367_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_2). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964370_C_P-RF-DC Feature FT:CDS KU964370_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_5). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964372_C_P-RF-DC Feature FT:CDS KU964372_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_7). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964374_C_P-RF-DC Feature FT:CDS KU964374_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_9). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964379_C_P-RF-DC Feature FT:CDS KU964379_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_14). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KU964380_C_P-RF-DC Feature FT:CDS KU964380_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 40_15). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcgattgtgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagca
tccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KX096713_C_P-RF-CA Feature FT:CDS KX096713_C_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctccttgacaccgcctctgctctgtatcgggaggccttaragtctccggaacattgttcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcaggcaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KX354997_C_P-RF-DC Feature FT:CDS KX354997_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate B118_2012_CD). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357623_C_P-RF-DE Feature FT:CDS KX357623_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BL43ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357624_C_P-RF-DE Feature FT:CDS KX357624_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GD65ETH). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgacatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357625_C_P-RF-DE Feature FT:CDS KX357625_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BL60ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagatactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357626_C_P-RF-DE Feature FT:CDS KX357626_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA164ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttcctgcggt
tcgagatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtggaaatttggacgatccagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagacactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggaagaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357627_C_P-RF-DE Feature FT:CDS KX357627_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MK75ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtttcgggatgccttagagtcttttgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattgatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcagacaattattgtggtttcacctttcttg
tctcatgtttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KX357628_C_P-RF-DE Feature FT:CDS KX357628_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BL70ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtgcagttactctcgtttttgcctgctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggacgtactgtctctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcggttatgtcaacaataatatgggcctaaagttcagacaattattgtggtttcacctttcttg
tctcatgtttggaagagaaactgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|KX357629_C_P-RF-DE Feature FT:CDS KX357629_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BL63ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagatactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357630_C_P-RF-DE Feature FT:CDS KX357630_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA124ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357631_C_P-RF-DE Feature FT:CDS KX357631_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MK152ETH). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgtgatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaaactgttgtagagtatttggtgtcgtttggagtgtggatccgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|KX357632_C_P-RF-DE Feature FT:CDS KX357632_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA141ETH). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgccgcagccctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtaagttatgtcaacactcatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaattgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cakcaaatgcccctatcttatcaacacttccggagactgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KX357633_C_P-RF-DE Feature FT:CDS KX357633_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GD69ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357634_C_P-RF-DE Feature FT:CDS KX357634_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA33ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagctcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357635_C_P-RF-DE Feature FT:CDS KX357635_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GD39ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357636_C_P-RF-DE Feature FT:CDS KX357636_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MK74ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacttgggtgggtgtaaacttagaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcatgtttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX357641_C_P-RF-DE Feature FT:CDS KX357641_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MK141ETH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggatgccctagagtctcctgagcattgttcacctcatcatactg
caatcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactcatatgggcctaaagtttaggcaactattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtatcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttcttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660674_C_P-RF-DC Feature FT:CDS KX660674_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetAli-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660675_C_P-RF-DC Feature FT:CDS KX660675_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetAli-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctaacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660677_C_P-RF-DC Feature FT:CDS KX660677_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetAli-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660680_C_P-RF-DC Feature FT:CDS KX660680_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetAli-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaayt
ccctcgccwcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660682_C_P-RF-DC Feature FT:CDS KX660682_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetLahsa). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctymtcgacaccgcctctgctctgtatcgggaggccttagagwctccggaacattgttcacctcaccatacag
cactcaggcaagctattstgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660684_C_P-RF-DC Feature FT:CDS KX660684_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetShannan-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttggtagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660685_C_P-RF-DC Feature FT:CDS KX660685_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetShannan-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacaaaggtctcaatcgccgcgtcgcgaaagatctcgatctcgggaatctcaatgttag
>gnl|hbvcds|KX660686_C_P-RF-DC Feature FT:CDS KX660686_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetRikaze-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatccggccacctgggtgggaagtaatttcgaagacccagca
tccagggaattagtagtcagctatgtcaatggtaatatgggcctaaaactcagacaaataaaggggtttcacatttccgg
tcatactcttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcacttctaccgcttacagac
caccaaatgcccttatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX660689_C_P-RF-DC Feature FT:CDS KX660689_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetRikaze-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctgtcttatcaagacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX765835_C_P-RF-GC Feature FT:CDS KX765835_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate PID:0725). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctacatcgggaggccctagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX774505_C_P-RF-BC Feature FT:CDS KX774505_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate PID:0394). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaggtaatttggaagatcaagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcccactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX827299_C_P-RF-DE Feature FT:CDS KX827299_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate geno20.11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgacatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KX827302_C_P-RF-DE Feature FT:CDS KX827302_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate geno31.9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccttggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacacttcttg
tctcacttttggaagagatacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
cccccgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY363262_C_P-RF-CB Feature FT:CDS KY363262_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate geno6.1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacttgggtgggaagtaatttggaagaccaggca
tcccgggacttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KY363263_C_P-RF-CB Feature FT:CDS KY363263_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate geno6.3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacttgggtgggaagtaatttggaagaccaggca
tcccgggatttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KY363272_C_P-RF-CB Feature FT:CDS KY363272_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate geno13.1). Partial genome (Contains: HBc, HBx, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggcgcttcagcggagttactctcttttttgcctactgacttcttcccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaggtaatttggacgatccagca
tccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctacaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KY363273_C_P-RF-CB Feature FT:CDS KY363273_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate geno13.2). Partial genome (Contains: HBc, HBx, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggcgcttcagcggagttactctcttttttgcctactgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacatcgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaggtaatttggacgatccagca
tccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctacaccttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KY470843_C_P-RF-DC Feature FT:CDS KY470843_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-10-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470844_C_P-RF-DC Feature FT:CDS KY470844_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-109). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470845_C_P-RF-DC Feature FT:CDS KY470845_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-113). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtcagatatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|KY470846_C_P-RF-DC Feature FT:CDS KY470846_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-118). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470847_C_P-RF-DC Feature FT:CDS KY470847_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-120). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470848_C_P-RF-DC Feature FT:CDS KY470848_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-122). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtcagatatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|KY470849_C_P-RF-DC Feature FT:CDS KY470849_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-123). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470850_C_P-RF-DC Feature FT:CDS KY470850_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-124). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470851_C_P-RF-DC Feature FT:CDS KY470851_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-22). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtcagatatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|KY470852_C_P-RF-DC Feature FT:CDS KY470852_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-24). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtcagatatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|KY470853_C_P-RF-DC Feature FT:CDS KY470853_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcaccccaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcacctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470854_C_P-RF-DC Feature FT:CDS KY470854_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470855_C_P-RF-DC Feature FT:CDS KY470855_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-9-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470856_C_P-RF-DC Feature FT:CDS KY470856_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-X-1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgcgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagatattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY470858_C_P-RF-GC Feature FT:CDS KY470858_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate 2-24). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctactgatttctttccgtctat
tcaagatcttatcgacacagcaacagctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagcaattttgtgttgtggggagttgaatactctagctacctgggtgggaagtaatttggacgaccctgcc
tccaaggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagaggacgaggcaggtgccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KY470865_C_P-RF-GC Feature FT:CDS KY470865_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate 2-C03). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctaatgacttctttccgtctat
tcaagacctcttcgacaccgcaacagctctgtatcgggaggccttagagtctccgggacattgctcacctcaccatacag
cactcaggcaagcaattttgtgttgtggggggttgagtactctagctacctgggtgggaagtaatttggacgaccctgcc
tccaaggatttggtagtcaactatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggtgccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KY470871_C_P-RF-GC Feature FT:CDS KY470871_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate 2-26). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttttaaagaatttggagcttctgtggagttactctcttttttgcctactgatttctttccgtctat
tcaagaccttatcgacacagcaacagctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagcaattttgtgttgtggggagttgaatactctagctacctgggtgggaagtaatttggacgaccctgcc
tccaaggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagaggacgaggcaggtgccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|KY470893_C_P-RF-CB Feature FT:CDS KY470893_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 24-B1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggaacttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctccttgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY629632_C_P-RF-DC Feature FT:CDS KY629632_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate GSK1901). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KY670781_C_P-RF-DC Feature FT:CDS KY670781_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TYM01067). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcacacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgartatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|KY881840_C_P-RF-CB Feature FT:CDS KY881840_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient-03). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC279263_C_P-RF-CB Feature FT:CDS LC279263_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_child_nail). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC279264_C_P-RF-CB Feature FT:CDS LC279264_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_hair). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC279265_C_P-RF-CB Feature FT:CDS LC279265_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_nail). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC279266_C_P-RF-CB Feature FT:CDS LC279266_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_serum). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC279267_C_P-RF-CB Feature FT:CDS LC279267_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi-child_serum). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC416040_C_P-RF-CB Feature FT:CDS LC416040_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CT_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagttgtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LC458432_C_P-RF-CB Feature FT:CDS LC458432_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate JRC-HE02). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctatgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|LK995391_C_P-RF-ED Feature FT:CDS LK995391_C_P-RF-ED of [Viruses] Hepatitis B Virus recombinant form ED (isolate NAT2037631). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|M38454_C_P-RF-CB Feature FT:CDS M38454_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccg
cactcaggcaagctattctgtgttggcgtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatcggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgannnnnncgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF488699_C_P-RF-DE Feature FT:CDS MF488699_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-CRP058). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgcctcagctctgtatcgggatgcgttagagtctcctgagcattgctcatctcatcatactg
cactcaggcaatcggttctttgctggagagaattaatgactctggctacctgggtgggtactaatttggaagatcccgca
tctagggacctagtggtcagttatgtcgacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagacacatttttggagtatttggtggctttcggagtgtccatccgcactcctacagcttatagac
caccccatgcccctatcttatcaacacttcctgagacttgtgttgataaaggacgaggcaggaccaataaaataccatct
ccctcgaatcgcagactaacgtctcactcgccgcatcacataagatcacaatctcgggaagctcaatgttag
>gnl|hbvcds|MF488702_C_P-RF-DE Feature FT:CDS MF488702_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-PCP015). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagcgactgtggagatactctcatttttgtctcctgacttctttccttctct
acgagatcttcttgataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctaaaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF488705_C_P-RF-AD Feature FT:CDS MF488705_C_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate OHBV-PCP243). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgccttctgatttctttccttcagt
acgggatctactagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcatatatcttg
ccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MF618346_C_P-RF-DE Feature FT:CDS MF618346_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-HIV076). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF618347_C_P-RF-DE Feature FT:CDS MF618347_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-HIV078). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatcttctagataccgctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925360_C_P-RF-DB Feature FT:CDS MF925360_C_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate BD-HBV03). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagctcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcatctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tcttacttttggaagagatacggtcctagactatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagaccacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925370_C_P-RF-CB Feature FT:CDS MF925370_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BD-HBV14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaggctatgtcaatgttaacatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925371_C_P-RF-DC Feature FT:CDS MF925371_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctgatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacgataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925381_C_P-RF-CB Feature FT:CDS MF925381_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BD-HBV25). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925382_C_P-RF-CB Feature FT:CDS MF925382_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BD-HBV26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctacttctgagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgccaatgctttgtttcgggaggccttggagtctcaggaacattgttcacctcaccatacag
cactaaggcaattagttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccaacca
tccagggacttagtagtcggctatgtcaacgttaacatgggcctaaaactcagacaattattgtggtttcacctttcctg
tcttatgtttggaagagatattgttcacgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacaggc
caacaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttga
>gnl|hbvcds|MF925384_C_P-RF-DB Feature FT:CDS MF925384_C_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate BD-HBV28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcatctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggaaatttggatgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacaacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925386_C_P-RF-AC Feature FT:CDS MF925386_C_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
cggagatctcctagacaccgcctcagctttgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925388_C_P-RF-DC Feature FT:CDS MF925388_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgggatcttcttgataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925389_C_P-RF-DC Feature FT:CDS MF925389_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV33). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925392_C_P-RF-DB Feature FT:CDS MF925392_C_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate BD-HBV37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgcgatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925396_C_P-RF-DC Feature FT:CDS MF925396_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcatcatactg
cactcaggcaagcaatactatgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaatacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MF925397_C_P-RF-DC Feature FT:CDS MF925397_C_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MF925401_C_P-RF-DB Feature FT:CDS MF925401_C_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate BD-HBV47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagcaatcctttgctgggcggagctaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF925402_C_P-RF-BD Feature FT:CDS MF925402_C_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate BD-HBV48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatcttatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MF925404_C_P-RF-AC Feature FT:CDS MF925404_C_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV50). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MF967563_C_P-RF-DE Feature FT:CDS MF967563_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MG826141_C_P-RF-CB Feature FT:CDS MG826141_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM57). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtcttcggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaagatgcggca
tccagggaattagttgtcagttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcacccctcccgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826142_C_P-RF-CB Feature FT:CDS MG826142_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM31H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttccatctat
tcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagttgtcaattatgttaatgttaacatgggcctaaaacttagacaactattgtggtttcatatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826144_C_P-RF-CB Feature FT:CDS MG826144_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacacagcctccgctctgtatcgggaggccttagagtcaccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826145_C_P-RF-BC Feature FT:CDS MG826145_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaaaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MG826146_C_P-RF-CB Feature FT:CDS MG826146_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM40H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826147_C_P-RF-CB Feature FT:CDS MG826147_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM19H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826148_C_P-RF-CB Feature FT:CDS MG826148_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM50). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactccggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826149_C_P-RF-CB Feature FT:CDS MG826149_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM63). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaagcagtagtcagctatgtcaatgttaatatgggcctgaagctcagacagatactgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggatccgcactcctactgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MG826150_C_P-RF-BC Feature FT:CDS MG826150_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM15H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttaatctcttttttgccttctgacttctttcctactat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctatactatgttggggtgagttgatgaatctagccacctgggtgggaggtaatttgcaagatcaagca
tccagagatttagtagtcaactatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgacaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG826151_C_P-RF-BC Feature FT:CDS MG826151_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM26H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcgtatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaact
ccctcccctggcagaggaaggtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG893554_C_P-RF-CB Feature FT:CDS MG893554_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14021). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG893555_C_P-RF-CB Feature FT:CDS MG893555_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14022). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacactgttcgcctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG893559_C_P-RF-CB Feature FT:CDS MG893559_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14052). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MG893561_C_P-RF-CB Feature FT:CDS MG893561_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14075). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcagggaaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttcggaaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH094410_C_P-RF-BC Feature FT:CDS MH094410_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH368022_C_P-RF-GC Feature FT:CDS MH368022_C_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate 9736409). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggcgcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcakcagctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttaatgactctagctacctgggtgggaagtaatttggaagaycctgcc
tccagrgaattggtagtcggctatgtcaatgttaayatgggcctgaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtctttcggagtgtggatccgcactccacctgcatacagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|MH464835_C_P-RF-DE Feature FT:CDS MH464835_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA113). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactttagctacctgggtgggtgctaatttggaagatccagca
tctagagatctaggagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cacctaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH464846_C_P-RF-DE Feature FT:CDS MH464846_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA124). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH464850_C_P-RF-DA Feature FT:CDS MH464850_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate MA128). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
nnnnnnnntgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH464851_C_P-RF-DE Feature FT:CDS MH464851_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA129). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH464852_C_P-RF-DE Feature FT:CDS MH464852_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA130). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH481858_C_P-RF-DE Feature FT:CDS MH481858_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH481859_C_P-RF-DE Feature FT:CDS MH481859_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964C1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaacgcccctatcctatcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH481860_C_P-RF-DE Feature FT:CDS MH481860_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964C2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagaggaacggttctagggtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaaggact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH481861_C_P-RF-DE Feature FT:CDS MH481861_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964C4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcccgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH481862_C_P-RF-DE Feature FT:CDS MH481862_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964C6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacagtgacccttataaagaatttggagctactatggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH685719_C_P-RF-DE Feature FT:CDS MH685719_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate E0-055). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttccgacttctttccttccgt
acgggatctcctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH724222_C_P-RF-DE Feature FT:CDS MH724222_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BR12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH724239_C_P-RF-DE Feature FT:CDS MH724239_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BR30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgaccattgtacacctcaccatactg
cactcaggcaagcaattatttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagaggtacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH724240_C_P-RF-DE Feature FT:CDS MH724240_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BR31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcngtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcatcagctctctatcggcaagccttagagtctcctgagcattgttcacctcaccacactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggggctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
cctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MH724243_C_P-RF-DE Feature FT:CDS MH724243_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BR35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctctgctctgtatcggcaagccttagagtctcctgaacattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcatgtttggaagagacacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaagt
ccctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH746811_C_P-RF-BC Feature FT:CDS MH746811_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgctggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccagtgttag
>gnl|hbvcds|MH746812_C_P-RF-BC Feature FT:CDS MH746812_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MH746813_C_P-RF-BC Feature FT:CDS MH746813_C_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggaccttctcgacaccgcatcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaaaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MK052957_C_P-RF-DE Feature FT:CDS MK052957_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NP137-11). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccacactg
cgatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggcgcaaatttggatccagtatct
agggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcactattcttgtct
cacttttggaagagaaacggtcttaaattatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccac
caaatgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccc
tcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MK052967_C_P-RF-BD Feature FT:CDS MK052967_C_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttctttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK052968_C_P-RF-BD Feature FT:CDS MK052968_C_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttagagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgccccgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK052969_C_P-RF-DE Feature FT:CDS MK052969_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NP137Q-8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggcgctaatttggatccagtatct
agggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgcggtttcactattcttgtct
cacttttggaagagatacggtcttaaattatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccac
caaatgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccc
tcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MK052970_C_P-RF-BD Feature FT:CDS MK052970_C_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccaggaaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttaaatatttggtgtcttttggagtgtggattcgcactcctcctacatatagac
caccaaatgcccctatcttatcaacacttccgaaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacaaaggtctcaatcgccgcgtcacaaaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|MK052976_C_P-RF-BD Feature FT:CDS MK052976_C_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggcactaatttggaagatccagca
tctagggacctaatagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK321265_C_P-RF-CB Feature FT:CDS MK321265_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1331). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacactgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK516279_C_P-RF-DE Feature FT:CDS MK516279_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 012/14/0533). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagacaccgccgcagctctatatcgggatgcgttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MK516280_C_P-RF-DE Feature FT:CDS MK516280_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 012/15/4535). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagacaccgccgcagctctatatcgggatgcgttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|MK541689_C_P-RF-DE Feature FT:CDS MK541689_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HEP/13/0028). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagacaccgccgcagctctatatcgggatgcgttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttaa
>gnl|hbvcds|MK598652_C_P-RF-DE Feature FT:CDS MK598652_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_VNovg25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK598653_C_P-RF-DE Feature FT:CDS MK598653_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_VNovg73). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK598654_C_P-RF-DE Feature FT:CDS MK598654_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_VNovg9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK598656_C_P-RF-DE Feature FT:CDS MK598656_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_VNovg4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK618438_C_P-RF-DE Feature FT:CDS MK618438_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MK618439_C_P-RF-DE Feature FT:CDS MK618439_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK618440_C_P-RF-DE Feature FT:CDS MK618440_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MK618442_C_P-RF-DE Feature FT:CDS MK618442_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK618444_C_P-RF-DE Feature FT:CDS MK618444_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|MK618445_C_P-RF-DE Feature FT:CDS MK618445_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_Arkh30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK720627_C_P-RF-CB Feature FT:CDS MK720627_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate p1331_RCA). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacactgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MK720628_C_P-RF-CB Feature FT:CDS MK720628_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate p1331_CL). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacactgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MN507835_C_P-RF-DE Feature FT:CDS MN507835_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 954_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtaccgggatgccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagtttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|MN507850_C_P-RF-DE Feature FT:CDS MN507850_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 2526_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|U95551_C_P-RF-DE Feature FT:CDS U95551_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|X65259_C_P-RF-DA Feature FT:CDS X65259_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate patient E; HBV subtype ayw). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaacaatttggagctactgtggagttactcccgtatttgccttctgacttctttctctacgt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacttagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttacacgacgaggcaggtcccctagaagaagaact
ccctcgcctgccagaccaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|X68292_C_P-RF-DA Feature FT:CDS X68292_C_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate Patient D, HBV subtype ayw). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaactgatgactctagcatcctgggtgggtgataatttggaagatccagcg
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggacaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|X75656_C_P-RF-CB Feature FT:CDS X75656_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Cha). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagacctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtggtcagttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgtcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|X80925_C_P-RF-DE Feature FT:CDS X80925_C_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate patient 4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|Y18856_C_P-RF-CB Feature FT:CDS Y18856_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttgcttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttacagac
cgccaaatgcccctctcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatccgcgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|Y18857_C_P-RF-CB Feature FT:CDS Y18857_C_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV-C6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
ctctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
© 1998-2020Legal notice