HBVdb

Dataset for nucleotide sequence X of genotype H

[Download (right click)] [Alignment] [Repertoires]

34 sequence(s)

>gnl|hbvcds|AB059659_X_P-H Feature FT:CDS AB059659_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaggactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB059660_X_P-H Feature FT:CDS AB059660_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggactacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB059661_X_P-H Feature FT:CDS AB059661_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggactacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB064315_X_P-H Feature FT:CDS AB064315_X_P-H of [Viruses] Hepatitis B Virus genotype H. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccaacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccctcggaacttgccaacaaccttatataagaggactcttggactttcgccccggtcaatgacctg
gattgaggaatacatcaaagactgtgtatttaagggctgggaggagtcgggggaggagttgaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB179747_X_P-H Feature FT:CDS AB179747_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JBDH1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205010_X_P-H Feature FT:CDS AB205010_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV-IM806-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgtcgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttttccacctctgcctaa
>gnl|hbvcds|AB266536_X_P-H Feature FT:CDS AB266536_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JAIW05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB275308_X_P-H Feature FT:CDS AB275308_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgcagaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB353764_X_P-H Feature FT:CDS AB353764_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375159_X_P-H Feature FT:CDS AB375159_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctaccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375160_X_P-H Feature FT:CDS AB375160_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctaccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375161_X_P-H Feature FT:CDS AB375161_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgcccccttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctyrgaacttgccaacaaccttacataagagaactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375162_X_P-H Feature FT:CDS AB375162_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccattggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375163_X_P-H Feature FT:CDS AB375163_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgcccccttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcagagcttgccaacaaccttacataagagaactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB375164_X_P-H Feature FT:CDS AB375164_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accmccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB818694_X_P-H Feature FT:CDS AB818694_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090454_X_C-H Feature FT:CDS AY090454_X_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcctggggctctgccgcccccttctccgccttccgttccggccgacgacagggcgcacctct
ctttacgcggactccccgcctgtgccttttcatcagccggcccgtgtgcacttcggttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcaaagcttgccaacacccttacataaaaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090457_X_P-H Feature FT:CDS AY090457_X_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcctggggctctgccgcccccttctccgccttccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcaaagcttgccaacaaccttacataagaggactcttggactttcaccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090460_X_P-H Feature FT:CDS AY090460_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LAS2523). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttgcataagaggactcttggtctttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF157291_X_P-H Feature FT:CDS EF157291_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586-YKH94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU498228_X_P-H Feature FT:CDS EU498228_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ356715_X_P-H Feature FT:CDS FJ356715_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|FJ356716_X_C-H Feature FT:CDS FJ356716_X_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|HM066946_X_P-H Feature FT:CDS HM066946_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggactacatcaaagactgtgtatttaaggactgggaggagtcaggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM117850_X_P-H Feature FT:CDS HM117850_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0153). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgtttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM117851_X_P-H Feature FT:CDS HM117851_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0201). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccagtcaacgacctg
gattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagtcgaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM998718_X_P-H Feature FT:CDS KM998718_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgcccccttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcagagcttgccaacaaccttacataagagaactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM998719_X_P-H Feature FT:CDS KM998719_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgacgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccagtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcatagattggtctgttcaccagcaccatgcaactttttcacctctggctaa
>gnl|hbvcds|KM998720_X_P-H Feature FT:CDS KM998720_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccgaccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcctcggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM998721_X_P-H Feature FT:CDS KM998721_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM998723_X_P-H Feature FT:CDS KM998723_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgacgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccagtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX264501_X_P-H Feature FT:CDS KX264501_X_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H-ajt). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY458059_X_P-H Feature FT:CDS KY458059_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacctgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY458060_X_P-H Feature FT:CDS KY458060_X_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgacgggtcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggaacctgccaacaaccttacataagaggactcttggactttcgccccggtcaacgacctg
gattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
© 1998-2020Legal notice