HBVdb

Dataset for nucleotide sequence SP of genotype H

[Download (right click)] [Alignment] [Repertoires]

28 sequence(s)

>gnl|hbvcds|AB059659_SP_P-H Feature FT:CDS AB059659_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttccaaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB059660_SP_P-H Feature FT:CDS AB059660_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctgtcaacaattccggagacttgtgttattagacaacgaggcagggcccctagaggaagaactccctcg
cctcgcagacgaagatctaaatcaccgcgtcgcagaagatctccatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB059661_SP_P-H Feature FT:CDS AB059661_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB064315_SP_P-H Feature FT:CDS AB064315_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttcctgagtgtactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcttcaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB179747_SP_P-H Feature FT:CDS AB179747_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JBDH1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatcwacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205010_SP_P-H Feature FT:CDS AB205010_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV-IM806-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB266536_SP_P-H Feature FT:CDS AB266536_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JAIW05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB275308_SP_P-H Feature FT:CDS AB275308_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaccctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB353764_SP_P-H Feature FT:CDS AB353764_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB375159_SP_P-H Feature FT:CDS AB375159_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB375160_SP_P-H Feature FT:CDS AB375160_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB375161_SP_P-H Feature FT:CDS AB375161_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB375162_SP_P-H Feature FT:CDS AB375162_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB375163_SP_P-H Feature FT:CDS AB375163_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaaccaccagcac
gggaccctgcaaaacctgcaccactcytgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB375164_SP_P-H Feature FT:CDS AB375164_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB818694_SP_P-H Feature FT:CDS AB818694_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY090454_SP_C-H Feature FT:CDS AY090454_SP_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY090457_SP_P-H Feature FT:CDS AY090457_SP_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggtccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY090460_SP_P-H Feature FT:CDS AY090460_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LAS2523). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF157291_SP_P-H Feature FT:CDS EF157291_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586-YKH94). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU498228_SP_P-H Feature FT:CDS EU498228_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ356715_SP_P-H Feature FT:CDS FJ356715_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ356716_SP_C-H Feature FT:CDS FJ356716_SP_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM066946_SP_P-H Feature FT:CDS HM066946_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaagacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM117850_SP_P-H Feature FT:CDS HM117850_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0153). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggactgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|HM117851_SP_P-H Feature FT:CDS HM117851_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0201). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtataaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ285946_SP_P-H Feature FT:CDS HQ285946_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MXHBV102). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaagacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KX264501_SP_P-H Feature FT:CDS KX264501_SP_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H-ajt). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
© 1998-2020Legal notice