HBVdb

Dataset for nucleotide sequence S of genotype H

[Download (right click)] [Alignment] [Repertoires]

131 sequence(s)

>gnl|hbvcds|AB059659_S_P-H Feature FT:CDS AB059659_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttcccgtgttacagggggtgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagaggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB059660_S_P-H Feature FT:CDS AB059660_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB059661_S_P-H Feature FT:CDS AB059661_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB064315_S_P-H Feature FT:CDS AB064315_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcttcaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcaacatcttgagtccatttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB179747_S_P-H Feature FT:CDS AB179747_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcwacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB205010_S_P-H Feature FT:CDS AB205010_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB266536_S_P-H Feature FT:CDS AB266536_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB275308_S_P-H Feature FT:CDS AB275308_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaccctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB353764_S_P-H Feature FT:CDS AB353764_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttggttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB353765_S_P-H Feature FT:CDS AB353765_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB353766_S_P-H Feature FT:CDS AB353766_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI02). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375159_S_P-H Feature FT:CDS AB375159_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375160_S_P-H Feature FT:CDS AB375160_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375161_S_P-H Feature FT:CDS AB375161_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttra
>gnl|hbvcds|AB375162_S_P-H Feature FT:CDS AB375162_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375163_S_P-H Feature FT:CDS AB375163_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AB375164_S_P-H Feature FT:CDS AB375164_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB818694_S_P-H Feature FT:CDS AB818694_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369531_S_P-H Feature FT:CDS AF369531_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX210). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369535_S_P-H Feature FT:CDS AF369535_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX3c). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcatcaaccaccagcacgggaccctgcaaaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AF369536_S_P-H Feature FT:CDS AF369536_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX182). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcgcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
tgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369537_S_P-H Feature FT:CDS AF369537_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX261). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369538_S_P-H Feature FT:CDS AF369538_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX2c). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369539_S_P-H Feature FT:CDS AF369539_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369540_S_P-H Feature FT:CDS AF369540_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX350). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaatttgttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369541_S_P-H Feature FT:CDS AF369541_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX571). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369542_S_P-H Feature FT:CDS AF369542_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX637). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369543_S_P-H Feature FT:CDS AF369543_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX562). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AF369545_S_P-H Feature FT:CDS AF369545_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX628). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tccctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctctaaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AY090454_S_C-H Feature FT:CDS AY090454_S_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AY090457_S_P-H Feature FT:CDS AY090457_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AY090460_S_P-H Feature FT:CDS AY090460_S_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaagaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236101_S_P-H Feature FT:CDS DQ236101_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236102_S_P-H Feature FT:CDS DQ236102_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcatcaaccaccagcacgggaccctgcaaaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236106_S_P-H Feature FT:CDS DQ236106_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaatttgttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236109_S_P-H Feature FT:CDS DQ236109_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtacctcccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctggtgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagctatatggatgatgtggtattgggggccaagtctgtgcagcatcctgagtccctttatac
cgctgttaccaattttctgttgtctgtgggcatacatttaa
>gnl|hbvcds|DQ236111_S_P-H Feature FT:CDS DQ236111_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaagttcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttgtaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236112_S_P-H Feature FT:CDS DQ236112_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaagttcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaaactctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttgtaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236113_S_P-H Feature FT:CDS DQ236113_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgttttttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacctgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggcttttcggaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236114_S_P-H Feature FT:CDS DQ236114_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtacctcccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
taccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236115_S_P-H Feature FT:CDS DQ236115_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236118_S_P-H Feature FT:CDS DQ236118_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236120_S_P-H Feature FT:CDS DQ236120_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236121_S_P-H Feature FT:CDS DQ236121_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236122_S_P-H Feature FT:CDS DQ236122_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaactaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236123_S_P-H Feature FT:CDS DQ236123_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|DQ236124_S_P-H Feature FT:CDS DQ236124_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgttccttgttgacaaaaatccgcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgttcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236125_S_P-H Feature FT:CDS DQ236125_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236126_S_P-H Feature FT:CDS DQ236126_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctaggggtaccaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgcctggctttcagttatatggatgatttggtattgggggccaaatctgcacaccatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236127_S_P-H Feature FT:CDS DQ236127_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacagggggtgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacgaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccatttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236129_S_P-H Feature FT:CDS DQ236129_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttcccgtgttacaggcggtgtgttccttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcttcaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgg
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcaacatctggagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236130_S_P-H Feature FT:CDS DQ236130_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcacctctcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236131_S_P-H Feature FT:CDS DQ236131_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|DQ236132_S_P-H Feature FT:CDS DQ236132_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacgtcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaatctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EF157291_S_P-H Feature FT:CDS EF157291_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EU159675_S_P-H Feature FT:CDS EU159675_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate Irish). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccgtcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EU498228_S_P-H Feature FT:CDS EU498228_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|FJ356715_S_P-H Feature FT:CDS FJ356715_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaagtcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|FJ356716_S_C-H Feature FT:CDS FJ356716_S_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|GQ486268_S_P-H Feature FT:CDS GQ486268_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate GS233). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtctttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcagttttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacagcaccttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|GQ486375_S_P-H Feature FT:CDS GQ486375_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate GS340). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgrgtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctacttccaggatctacgaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcarcatcttgagtccatttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|GQ486592_S_P-H Feature FT:CDS GQ486592_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate GS557). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|HM066946_S_P-H Feature FT:CDS HM066946_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HM117850_S_P-H Feature FT:CDS HM117850_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HM117851_S_P-H Feature FT:CDS HM117851_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtataaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HQ285946_S_P-H Feature FT:CDS HQ285946_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MXHBV102). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|JN604202_S_P-H Feature FT:CDS JN604202_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atgaagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcac
aataccccagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattygc
agtccccaatctccaatcacttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaat
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccattgtctggcctttagttatatggatgatttggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|JN604203_S_P-H Feature FT:CDS JN604203_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttacaaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|JN604310_S_P-H Feature FT:CDS JN604310_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|KC836829_S_P-H Feature FT:CDS KC836829_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate AH51). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM606705_S_P-H Feature FT:CDS KM606705_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate Cuba51a). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatccacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KM606937_S_P-H Feature FT:CDS KM606937_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate Cuba114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggcccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccccagagtctagactcgtggtggacttctctcagttttctaggggaaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatccacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctttatac
cgctgttaccaatttgttgttatctgtgggcatccatttga
>gnl|hbvcds|KM998717_S_P-H Feature FT:CDS KM998717_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtaytcccatcccatcatcttgggctttcggaaaa
tacctatgggggtgggcctcagcccgtttcttttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|KM998718_S_P-H Feature FT:CDS KM998718_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|KM998719_S_P-H Feature FT:CDS KM998719_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KM998720_S_P-H Feature FT:CDS KM998720_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcactttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KM998721_S_P-H Feature FT:CDS KM998721_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KM998722_S_P-H Feature FT:CDS KM998722_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcagaacctgcaccactcttgctcaaggaacctctatgt
ttccctcatgctgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KM998723_S_P-H Feature FT:CDS KM998723_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KP997512_S_P-H Feature FT:CDS KP997512_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 214_B). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KX264501_S_P-H Feature FT:CDS KX264501_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KX372218_S_P-H Feature FT:CDS KX372218_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B158_2013_H). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaactaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtggcgcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KY458059_S_P-H Feature FT:CDS KY458059_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|KY458060_S_P-H Feature FT:CDS KY458060_S_P-H of [Viruses] Hepatitis B Virus genotype H. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MF150691_S_P-H Feature FT:CDS MF150691_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX932M). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgagtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcaccttgaggccatttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MF150692_S_P-H Feature FT:CDS MF150692_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX931M). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgagtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggctaaatctgtggagcaccttgcgtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MF150695_S_P-H Feature FT:CDS MF150695_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX023N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgagcaacaccttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MF150696_S_P-H Feature FT:CDS MF150696_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEX019N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568522_S_P-H Feature FT:CDS MK568522_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568523_S_P-H Feature FT:CDS MK568523_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568524_S_P-H Feature FT:CDS MK568524_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568526_S_P-H Feature FT:CDS MK568526_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaagttcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MK568527_S_P-H Feature FT:CDS MK568527_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcccaggactccgtctcgtgttacaggcggtgtgtttctggttgacaaaaatccgcac
aatgccaaagaggctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
accatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacatcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568532_S_P-H Feature FT:CDS MK568532_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaagttcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MK568533_S_P-H Feature FT:CDS MK568533_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcaa
aataccacagagtctagactcgtggtggacttctctcaattctctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttacaaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568534_S_P-H Feature FT:CDS MK568534_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818829_S_P-H Feature FT:CDS MN818829_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9791). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818830_S_P-H Feature FT:CDS MN818830_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9788). Partial genome (Contains: Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacataaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818831_S_P-H Feature FT:CDS MN818831_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9787). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818832_S_P-H Feature FT:CDS MN818832_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818833_S_P-H Feature FT:CDS MN818833_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9795). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtcccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818834_S_P-H Feature FT:CDS MN818834_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9797). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818835_S_P-H Feature FT:CDS MN818835_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggatccctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818836_S_P-H Feature FT:CDS MN818836_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctgcttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MN818837_S_P-H Feature FT:CDS MN818837_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctctgtgtctgttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818838_S_P-H Feature FT:CDS MN818838_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttggttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818839_S_P-H Feature FT:CDS MN818839_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcaagggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818840_S_P-H Feature FT:CDS MN818840_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtactcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818841_S_P-H Feature FT:CDS MN818841_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9648). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaactaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgcagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MN818842_S_P-H Feature FT:CDS MN818842_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 9973). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT622523_S_P-H Feature FT:CDS MT622523_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 0211A172). Complete genome. [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT820154_S_P-H Feature FT:CDS MT820154_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820155_S_P-H Feature FT:CDS MT820155_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggacgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctgcttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcaacacctggagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820156_S_P-H Feature FT:CDS MT820156_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtatttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctgcttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcarcayctkgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820157_S_P-H Feature FT:CDS MT820157_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820158_S_P-H Feature FT:CDS MT820158_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtatttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcctgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820159_S_P-H Feature FT:CDS MT820159_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtatttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820160_S_P-H Feature FT:CDS MT820160_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820161_S_P-H Feature FT:CDS MT820161_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT820162_S_P-H Feature FT:CDS MT820162_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832839_S_P-H Feature FT:CDS MT832839_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832840_S_P-H Feature FT:CDS MT832840_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT832841_S_P-H Feature FT:CDS MT832841_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832842_S_P-H Feature FT:CDS MT832842_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832843_S_P-H Feature FT:CDS MT832843_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832844_S_P-H Feature FT:CDS MT832844_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832845_S_P-H Feature FT:CDS MT832845_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtatttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MT832846_S_P-H Feature FT:CDS MT832846_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcacggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MT832847_S_P-H Feature FT:CDS MT832847_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MEXOBI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Riboviria] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|U91819_S_P-H Feature FT:CDS U91819_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 2928NIC). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|U91827_S_P-H Feature FT:CDS U91827_S_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1853NIC). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgt
ttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggcatccatttaa
© 1998-2021Legal notice