HBVdb

Dataset for nucleotide sequence PreS2 of genotype H

[Download (right click)] [Alignment] [Repertoires]

40 sequence(s)

>gnl|hbvcds|AB059659_PreS2_P-H Feature FT:CDS AB059659_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttagatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttcccgtgttacagggggtgtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagaggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB059660_PreS2_P-H Feature FT:CDS AB059660_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtatcttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB059661_PreS2_P-H Feature FT:CDS AB059661_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB064315_PreS2_P-H Feature FT:CDS AB064315_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaactcaacacagttccaccaagcactgctggatccgagagtaaggggtcctgctggtggctccagttcaga
aacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatgg
agaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaata
ccacggagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtc
cccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcct
ctacttccaggatcttcaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttcc
ctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacc
tatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttccccc
actgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcaacatcttgagtccatttataccgct
gttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB179747_PreS2_P-H Feature FT:CDS AB179747_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JBDH1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcwacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB205010_PreS2_P-H Feature FT:CDS AB205010_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV-IM806-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtatcttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB266536_PreS2_P-H Feature FT:CDS AB266536_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JAIW05). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgtta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB275308_PreS2_P-H Feature FT:CDS AB275308_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaccctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB353764_PreS2_P-H Feature FT:CDS AB353764_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgtta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttggttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375159_PreS2_P-H Feature FT:CDS AB375159_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375160_PreS2_P-H Feature FT:CDS AB375160_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375161_PreS2_P-H Feature FT:CDS AB375161_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttra
>gnl|hbvcds|AB375162_PreS2_P-H Feature FT:CDS AB375162_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB375163_PreS2_P-H Feature FT:CDS AB375163_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggacccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtaggg
ctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AB375164_PreS2_P-H Feature FT:CDS AB375164_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AB818694_PreS2_P-H Feature FT:CDS AB818694_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgcgccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgtta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|AY090454_PreS2_C-H Feature FT:CDS AY090454_PreS2_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtcaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AY090457_PreS2_P-H Feature FT:CDS AY090457_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtatcttcctgctggtggctc
cagttcagaaacacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|AY090460_PreS2_P-H Feature FT:CDS AY090460_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LAS2523). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaagaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EF157291_PreS2_P-H Feature FT:CDS EF157291_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586-YKH94). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EU159675_PreS2_P-H Feature FT:CDS EU159675_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate Irish-17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccgtcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|EU498228_PreS2_P-H Feature FT:CDS EU498228_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgtta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|FJ356715_PreS2_P-H Feature FT:CDS FJ356715_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaatacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaagtc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtttggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|FJ356716_PreS2_C-H Feature FT:CDS FJ356716_PreS2_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
cgcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HM066946_PreS2_P-H Feature FT:CDS HM066946_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0114). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtgaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HM117850_PreS2_P-H Feature FT:CDS HM117850_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0153). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacaaaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HM117851_PreS2_P-H Feature FT:CDS HM117851_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0201). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtataaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|HQ285946_PreS2_P-H Feature FT:CDS HQ285946_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MXHBV102). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtgaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|JN604202_PreS2_P-H Feature FT:CDS JN604202_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479-0567-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgaaagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcgtcaatcttctcgaagactggggatcctgcta
tgaacatgaagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttctcgttgacaaaaatc
ctcacaataccccagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttygcagtccccaatctccaatcacttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttag
gaaattacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccattgtctggcctttagttatatggatgatttggtattgggggccaaatctgtgcaacatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|JN604203_PreS2_P-H Feature FT:CDS JN604203_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479-2619-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ckcacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttacaaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|JN604310_PreS2_P-H Feature FT:CDS JN604310_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 479-5454-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggacccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|KX264501_PreS2_P-H Feature FT:CDS KX264501_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H-ajt). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568522_PreS2_P-H Feature FT:CDS MK568522_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.238). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568523_PreS2_P-H Feature FT:CDS MK568523_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.419). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggctctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568524_PreS2_P-H Feature FT:CDS MK568524_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.424). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568526_PreS2_P-H Feature FT:CDS MK568526_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.593). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggacccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaag
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MK568527_PreS2_P-H Feature FT:CDS MK568527_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.603). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcacttttggatacgagagtaaagggtctgtatcttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctcacacatcatcaatcttatcgacgactggggaccctgcta
tgaacatggagaacatcacatcaggactcccaggactccgtctcgtgttacaggcggtgtgtttctggttgacaaaaatc
cgcacaatgccaaagaggctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttaccatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacatcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568532_PreS2_P-H Feature FT:CDS MK568532_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.910). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggacccgagagtaaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaag
ttcgcagtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttaa
>gnl|hbvcds|MK568533_PreS2_P-H Feature FT:CDS MK568533_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.946). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtgaggggtctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
cgcaaaataccacagagtctagactcgtggtggacttctctcaattctctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttacaaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
>gnl|hbvcds|MK568534_PreS2_P-H Feature FT:CDS MK568534_PreS2_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 1.251). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggctctgtattttcctgctggtggctc
cagttcagaaacacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgcta
tgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgccc
gtgtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctc
tatgtttccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtaggg
ctttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctt
tataccgctgttaccaattttttgttatctgtgggcatccatttga
© 1998-2020Legal notice