HBVdb

Dataset for nucleotide sequence PreC of genotype H

[Download (right click)] [Alignment] [Repertoires]

40 sequence(s)

>gnl|hbvcds|AB059659_PreC_P-H Feature FT:CDS AB059659_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcatttctgccttctgacttctacc
cgtctgtccgggacctactcgacaccgcttcagccctccaccgagatgccttagaatcacccgaacattgctccccccac
cacactgctctcaggcaagctgtttcgtgctggcgggaggtgacggacttcggtgactgggtgggcaataatttacagga
tcaggcagcaagagatctagtagttaattatgtcaatgctaacataggtctaaaaattagacaattactatggtttcaca
tttcctgccttacatttggaagagaaactgtgattgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttccaaatgttag
>gnl|hbvcds|AB059660_PreC_P-H Feature FT:CDS AB059660_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcctactgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcaccccccac
catactgccatcaggcaagttattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttaaatga
tcctgcagccagagatctagtagttaattatgtcaatactcatatgggcctaaaaattagacaattgttgtggtttcata
tttcctgccttacgtttggaagagaaattgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctgtcaacaattccggagacttgtgttattagacaacgaggcagggcccctagagg
aagaactccctcgcctcgcagacgaagatctaaatcaccgcgtcgcagaagatctccatctccagcttcccaatgttag
>gnl|hbvcds|AB059661_PreC_P-H Feature FT:CDS AB059661_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagatactgttcttgagtatctggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB064315_PreC_P-H Feature FT:CDS AB064315_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgctacagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacgcttcctgagtgtactgttattagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB179747_PreC_P-H Feature FT:CDS AB179747_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JBDH1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205010_PreC_P-H Feature FT:CDS AB205010_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV-IM806-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaacttttccacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccctagc
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctggagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB266536_PreC_P-H Feature FT:CDS AB266536_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JAIW05). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB275308_PreC_P-H Feature FT:CDS AB275308_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacctgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB353764_PreC_P-H Feature FT:CDS AB353764_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375159_PreC_P-H Feature FT:CDS AB375159_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375160_PreC_P-H Feature FT:CDS AB375160_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375161_PreC_P-H Feature FT:CDS AB375161_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375162_PreC_P-H Feature FT:CDS AB375162_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactcycatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375163_PreC_P-H Feature FT:CDS AB375163_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgtactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB375164_PreC_P-H Feature FT:CDS AB375164_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB818694_PreC_P-H Feature FT:CDS AB818694_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY090454_PreC_C-H Feature FT:CDS AY090454_PreC_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattctgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttagagga
tcctgcggctagagatctagtagttaattatgtcaacactaatatgggcctaaaaattagacaattactatggtttcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY090457_PreC_P-H Feature FT:CDS AY090457_PreC_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatctcccgaacattgcacccccaac
catactgctctcaggcaagctattctgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttagagga
tcctgcggctagagatctagtagttaattatgtcaacactaatatgggcctaaaaattagacaattactatggtttcata
tttcctgccttacatttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY090460_PreC_P-H Feature FT:CDS AY090460_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LAS2523). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctgctcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EF157291_PreC_P-H Feature FT:CDS EF157291_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586-YKH94). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcttgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU498228_PreC_P-H Feature FT:CDS EU498228_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ356715_PreC_P-H Feature FT:CDS FJ356715_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=639 residues).
attcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgcctaatgacttcttcc
cgtctgtccgggatctactcgacaccgcttcagccctccaccgagaggccttagaatctcccgatcattgcacccccaac
cacactgctctcaggcaagctatttcgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacgcttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ356716_PreC_C-H Feature FT:CDS FJ356716_PreC_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=639 residues).
attcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctccaccgagatgccttagaatcacccgatcattgcacccccaac
cacactgctctcaggcaagctatttcgtgctggggtgagttgatgaacttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacytgct
tatagaccaccaaatgcccctatcctatccacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM066946_PreC_P-H Feature FT:CDS HM066946_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0114). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccagc
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatcttgtggttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccgcctggt
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttattagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM117850_PreC_P-H Feature FT:CDS HM117850_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0153). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM117851_PreC_P-H Feature FT:CDS HM117851_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0201). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctacagagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgactttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896124_PreC_P-H Feature FT:CDS JX896124_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-76). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattrtggtttcata
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896125_PreC_P-H Feature FT:CDS JX896125_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-92). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcwactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgtactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccartgttag
>gnl|hbvcds|JX896126_PreC_P-H Feature FT:CDS JX896126_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-101). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctyttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcagtactaacatgggcctaaaaattagacaattattatggtttcata
tttcctsccttacatttggaagagaaactgtgcttgagtatttggtgycttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896127_PreC_P-H Feature FT:CDS JX896127_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-104). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagtkactctcatttttgccttctgacttcttcc
cgtctgtccgggacctacycgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896128_PreC_P-H Feature FT:CDS JX896128_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-117H). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaataataatatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896129_PreC_P-H Feature FT:CDS JX896129_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-121). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctatccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgctcccccaac
cacactgctatcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggccataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgtactccacctcct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896130_PreC_P-H Feature FT:CDS JX896130_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactcycatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896131_PreC_P-H Feature FT:CDS JX896131_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-130). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagccagagatctagtagttaattatgtcaatactaatatgggcctaaaaattagacaattattatggtytcata
tttcctgccttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896132_PreC_P-H Feature FT:CDS JX896132_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-143H). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
crcactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgyagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX896133_PreC_P-H Feature FT:CDS JX896133_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-146). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggtctaaaaattagacaattattatggtttcaca
tttcctgcctaacatttggaagagaaactgtgcttgagtatttggtgtcttttggagggtggatccgcactccacctgct
tacagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgagcttcccaatgttag
>gnl|hbvcds|JX896134_PreC_P-H Feature FT:CDS JX896134_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-151). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcata
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX915624_PreC_P-H Feature FT:CDS JX915624_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBcMX-133). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
tttctcctctttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
catactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattgtggtttcata
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC836867_PreC_P-H Feature FT:CDS KC836867_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate AH51). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgacattggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KX264501_PreC_P-H Feature FT:CDS KX264501_PreC_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H-ajt). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttcttcc
cgtctgtccgggacctactcgacaccgcttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaac
cacactgctctcaggcaagctattttgtgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagagga
tcctgcagcaagagatctagtagttaattatgtcaatactaacatgggcctaaaaattagacaattattatggtttcaca
tttcctgccttacatttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
© 1998-2020Legal notice