HBVdb

Dataset for nucleotide sequence Genomes of genotype H

[Download (right click)] [Alignment] [Repertoires]

26 sequence(s)

>gnl|hbvnuc|AB059659_FT00000_P-H Feature FT:source AB059659_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttagatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttcccgtgttacagggggtgtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagaggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaaaggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttcct
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tccgtcaacaatacatgaccctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaggactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttctgccttctgacttctacccgtctgtccgggacctactcgacaccg
cttcagccctccaccgagatgccttagaatcacccgaacattgctccccccaccacactgctctcaggcaagctgtttcg
tgctggcgggaggtgacggacttcggtgactgggtgggcaataatttacaggatcaggcagcaagagatctagtagttaa
ttatgtcaatgctaacataggtctaaaaattagacaattactatggtttcacatttcctgccttacatttggaagagaaa
ctgtgattgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccatcttccaaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgcacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaattaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
gatcattactttaaaacgagacattatttgcatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
ccgggttcacacccccacacggtgggcttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaacaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB059660_FT00000_P-H Feature FT:source AB059660_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtatcttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattactgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgcctactgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcaccccccaccatactgccatcaggcaagttattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttaaatgatcctgcagccagagatctagtagttaa
ttatgtcaatactcatatgggcctaaaaattagacaattgttgtggtttcatatttcctgccttacgtttggaagagaaa
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatcctg
tcaacaattccggagacttgtgttattagacaacgaggcagggcccctagaggaagaactccctcgcctcgcagacgaag
atctaaatcaccgcgtcgcagaagatctccatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatttgatacaaaaatgtgaacaatttgtgggcccactcactacaaatgaaaggagacgattgaaaatgattatgc
cagctaggttttatcccaaagctaccaaatatttccctttggataaaggtattaaaccttactatccagagaatgtggtt
aatcattacttcaaaactagacactatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctccacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacagacaaggacaattggccaatggcaaacaaggtaggagcgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaaccttgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB059661_FT00000_P-H Feature FT:source AB059661_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgaggccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgcattactgctaaccaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcctgcgcggaacctttgaggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacgttatcggcactgacaactctgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacctttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagccagagatctagtagttaa
ttatgtcaatactaatatgggcctaaaaattagacaattattatggtttcatatttcctgccttacatttggaagagata
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcatttgca
tcaagatttgatacaaaaatgtgaacaatttgtgggcccactcactaaaaatgaaaggagacgattgaaactgattatgc
cagctaggttttatcccaaagtaaccaaatatttccctttggataaaggtattaaaccttactatccagagaatgtggtt
aatcattactttaaaactagacactatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctccacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaaccttgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB179747_FT00000_P-H Feature FT:source AB179747_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JBDH1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatcwacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattrccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgcccatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcttgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctaacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB205010_FT00000_P-H Feature FT:source AB205010_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBV-IM806-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtatcttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttatacccttcactttatgg
gttatagaattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggcacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgtcgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttttccacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccctagccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctggagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcttgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctaacaacctcgccacccgat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB266536_FT00000_P-H Feature FT:source AB266536_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HB-JAIW05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgttatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggctattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB275308_FT00000_P-H Feature FT:source AB275308_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaccctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgcccatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcaccgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
cagaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacctgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcttgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctaacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB353764_FT00000_P-H Feature FT:source AB353764_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate HBDI03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgttatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttggttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375159_FT00000_P-H Feature FT:source AB375159_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctaccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggtctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactaccaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375160_FT00000_P-H Feature FT:source AB375160_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctaggcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctaccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggtctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375161_FT00000_P-H Feature FT:source AB375161_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttraacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacsttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtraatagacccattgattggaaggtttgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttaccctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacrttatcggaactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgcccccttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctyrgaacttgccaacaaccttacataagagaactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggtctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375162_FT00000_P-H Feature FT:source AB375162_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagcaggtctggagcggacgttatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccattggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactcycatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggtctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggatccgcactccacctgcttacagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375163_FT00000_P-H Feature FT:source AB375163_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggacccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcytgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacgttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtaaatagacccattgattggaaggtctgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtatcaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggaactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgcccccttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcagagcttgccaacaaccttacataagagaactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagccagagatctagtagttaa
ttatgtcaatactaatatgggcctaaaaattagacaattattatggtttcatatttcctgccttacatttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgtactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactrtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctkggaacaagagctacagcatgggagcacctctctcaacggcragaaggggy
atgggacagaayctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB375164_FT00000_P-H Feature FT:source AB375164_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacctgaacctttaccccgttgctcggcaacggccgggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcagaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactctgttgtcctttctcggaagt
acacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccmccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaacctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattgggcaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB818694_FT00000_P-H Feature FT:source AB818694_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgcgccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgttatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagagtgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY090454_FT00000_C-H Feature FT:source AY090454_FT00000_C-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtcaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacattgcctcaggaacatattgtgcaaaaaatcaaaaattgctttcgcaaacttccc
gttaatcgacccattgattggaaagtctgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttatatgcctgtattaccgctaaacaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacattatcggcactgacaactccgttgtcctgtctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgcccccttctccgccttccgttccggccgacgac
agggcgcacctctctttacgcggactccccgcctgtgccttttcatcagccggcccgtgtgcacttcggttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcaaagcttgccaacacccttacataaaaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattctg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttagaggatcctgcggctagagatctagtagttaa
ttatgtcaacactaatatgggcctaaaaattagacaattactatggtttcatatttcctgccttacatttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgattggttaactccttcttttcctgacattcacctaca
tcaagatttgatacaaaaatgtgagcaatttgtgcgcccactcactaaaaatgaagtgagacgattgaaattaattatgc
cagcaaggttttatcccaaagctactaaatacttccctttggataaaggtattaaaccatattatccagagaatgtggtt
aatcattacttcaaaactacacactatttacatactttgtggaaggcaagaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagaactacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggctttggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcccgcttccaccaatcggaggtcaggaaggaaaccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY090457_FT00000_P-H Feature FT:source AY090457_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtatcttcctgctggtggctccagttcagaaa
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttaaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacattgcctcaggaacatattgtgcaaaaaatcaaagattgctttcgcaaacttcct
gttaatcgacccattgattggaaagtctgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttatatgcctgtattaccgctaaacaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacattatcggcactgacaactccgttgtcctgtctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgcccccttctccgccttccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcaaagcttgccaacaaccttacataagaggactcttggactttcacccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatctcccgaacattgcacccccaaccatactgctctcaggcaagctattctg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttagaggatcctgcggctagagatctagtagttaa
ttatgtcaacactaatatgggcctaaaaattagacaattactatggtttcatatttcctgccttacatttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgattggttaactccttcttttcctgacattcacctaca
tcaagatttgatacaaaaatgtgaacaatttgtaggcccactcactaaaaatgaagtgagacgattgaaattaattatgc
cagcaagattttatcccaaagttactaaatacttccctttggataaaggtattaaaccatattatccagagcatgtggtt
aatcattacttcaaaactagacactatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggctttggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccacccgat
ccacctcccgcttccaccaatcggaggtcaggaaggaaaccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY090460_FT00000_P-H Feature FT:source AY090460_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LAS2523). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaagaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactctgttgtcctttctcggaagt
acacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttgcataagaggactcttggtctttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctgctcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgtttttaatcctgactggctaactccctcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattacttcaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaacctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|EF157291_FT00000_P-H Feature FT:source EF157291_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate B3586-YKH94). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcttgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctaacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|EU498228_FT00000_P-H Feature FT:source EU498228_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate 141). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaagggggctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgttatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattcccttcactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgtcgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcaccagaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgacattggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ356715_FT00000_P-H Feature FT:source FJ356715_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate LL010169). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaatacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaagtcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaawggtggggttataccttacactttatgg
gttatagaattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttygcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactctgttgtcctttctcggaagt
acacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttatataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcatttttgcctaatgacttcttcccgtctgtccgggatctactcgacaccg
cttcagccctccaccgagaggccttagaatctcccgatcattgcacccccaaccacactgctctcaggcaagctatttcg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacgcttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggctaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaacggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaagctagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaacctttctgtgcccaatcctctgggattctttccmgaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggcyatgcagtggaa
>gnl|hbvnuc|FJ356716_FT00000_C-H Feature FT:source FJ356716_FT00000_C-H of [Viruses] Hepatitis B Virus genotype H (isolate CL150171). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cttgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaaaggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactctgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctccaccgagatgccttagaatcacccgatcattgcacccccaaccacactgctctcaggcaagctatttcg
tgctggggtgagttgatgaacttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatgctaacatgggcctaaaaattagacaattcttatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacytgcttatagaccaccaaatgcccctatccta
tccacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggctaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactaaacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaayctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM066946_FT00000_P-H Feature FT:source HM066946_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0114). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtgaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatatcattgggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacctattgattggaaggtttgtcaacgaattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattactgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacctgaacctttaccccgttgctcggcaacggccgggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggactacatcaaagactgtgtatttaaggactgggaggagtcaggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccagccatactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagccagagatcttgtggttaa
ttatgtcaatactaatatgggcctaaaaattagacaattattatggtttcatatttcctgccttacatttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccgcctggttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttattagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcatttgca
tcaagatttgatacaaaaatgtgaacaatttgtgggcccactcactaaaaatgaaaggagacgattgaaactgattatgc
cagctaggttttatcccaaagttaccaaatatttccctttggataaaggtattaaaccttactatccagagaatgtggtt
aatcattactttaaaactagacactatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctccacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaaccttgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM117850_FT00000_P-H Feature FT:source HM117850_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0153). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacaaaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagctgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgtttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagctgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagccagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcatatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctaacattcacttgca
tcaagatttgatacagaaatgtgagcaatttgtaggcccactcactaaaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccgtactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacatggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM117851_FT00000_P-H Feature FT:source HM117851_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate MX-HBV-0201). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtataaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatgtaattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagcccctttcactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
agtcaacgacctggattgaggaatacatcaaagactgtgtgtttaaggactgggaggagtcgggggaggagtcgaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctacagagatgccttagaatcacccgaacattgcacccccaaccatactgctctcaggcaagctattttg
tgctggggtgagttgatgactttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcatatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactaaaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaaggtactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggagccttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaagcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KX264501_FT00000_P-H Feature FT:source KX264501_FT00000_P-H of [Viruses] Hepatitis B Virus genotype H (isolate H-ajt). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacacagttccaccaagcactgttggatccgagagtaaggggtctgtattttcctgctggtggctccagttcagaaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactggggaccctgctatgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaccacccgggtgtcctggccaaaattcgcagtccc
caatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccactcttgctcaaggaacctctatgtttccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggcatccatttgaacacagctaaaacaaaatggtggggttattccttacactttatgg
gttatataattgggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgcaaacttccc
gtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttgggctttgcagccccttttactcaatgtgg
ttatcctgctctcatgcccttgtatgcctgtattaccgctaagcaggcttttgttttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcggacattatcggcactgacaactccgttgtcctttctcggaagt
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccggccgacgac
gggtcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggaacttgccaacaaccttacataagaggactcttggactttcgcccc
ggtcaacgacctggattgaggaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagttgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttcttcccgtctgtccgggacctactcgacaccg
cttcagccctctaccgagatgccttagaatcacccgaacattgcacccccaaccacactgctctcaggcaagctattttg
tgctggggtgagttgatgaccttggcttcctgggtgggcaataatttagaggatcctgcagcaagagatctagtagttaa
ttatgtcaatactaacatgggcctaaaaattagacaattattatggtttcacatttcctgccttacatttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttaccggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcctgacattcacttgca
tcaagatctgatacaaaaatgtgaacaatttgtaggcccactcactacaaatgaaaggagacgattgaaactaattatgc
cagctaggttttatcccaaagttactaaatacttccctttggataaaggtattaagccttactatccagagaatgtggtt
aatcattactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacggcgagaaggggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccaccagttggatccactattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggcttcggtc
cagggttcacacccccacacggtggccttctggggtggagccctcaggcacagggcattctgacaacctcgccaccagat
ccacctcctgcttccaccaatcggaggtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccaca
ggccatgcagtggaa
© 1998-2020Legal notice