HBVdb

Dataset for nucleotide sequence X of genotype G

[Download (right click)] [Alignment] [Repertoires]

83 sequence(s)

>gnl|hbvcds|AB056513_X_P-G Feature FT:CDS AB056513_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB056514_X_P-G Feature FT:CDS AB056514_X_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgaccccttctccgtttgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB056515_X_P-G Feature FT:CDS AB056515_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtgtttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB056516_X_P-G Feature FT:CDS AB056516_X_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB064310_X_P-G Feature FT:CDS AB064310_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB064311_X_P-G Feature FT:CDS AB064311_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctatcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB064312_X_P-G Feature FT:CDS AB064312_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB064313_X_C-G Feature FT:CDS AB064313_X_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgcaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375165_X_P-G Feature FT:CDS AB375165_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375166_X_P-G Feature FT:CDS AB375166_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375167_X_P-G Feature FT:CDS AB375167_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375168_X_P-G Feature FT:CDS AB375168_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttgaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375169_X_P-G Feature FT:CDS AB375169_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB375170_X_P-G Feature FT:CDS AB375170_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AF160501_X_C-G Feature FT:CDS AF160501_X_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagtggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AF405706_X_P-G Feature FT:CDS AF405706_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|DQ207798_X_P-G Feature FT:CDS DQ207798_X_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|EF464097_X_P-G Feature FT:CDS EF464097_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccatatcgaccctttcagggacgtcctttgtttacgtcccgtcagcgttgaatccagcgg
acgacccctcctggggtcgtttggggatctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctcccggtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|EF464098_X_P-G Feature FT:CDS EF464098_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=465 residues).
atggcagctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|EF634480_X_P-G Feature FT:CDS EF634480_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgtcgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|FJ023674_X_P-G Feature FT:CDS FJ023674_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate I2/C2_C04-0790). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccctctcggggccggttggggatctaccgtccccttctccgtctgccgtaccggccgwccacggggcgcacctct
ctttacgcggactccccgagtgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FR714503_X_P-G Feature FT:CDS FR714503_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate TZ306). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacttgagcttgcccaaggtattgcataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563556_X_P-G Feature FT:CDS GU563556_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaatgggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU565217_X_P-G Feature FT:CDS GU565217_X_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactattggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|HE981171_X_P-G Feature FT:CDS HE981171_X_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE981172_X_P-G Feature FT:CDS HE981172_X_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE981174_X_P-G Feature FT:CDS HE981174_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgtcgttcctgccgaccacggggcgcacctct
atttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|HE981175_X_P-G Feature FT:CDS HE981175_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|HE981176_X_P-G Feature FT:CDS HE981176_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|JQ707436_X_P-G Feature FT:CDS JQ707436_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MC1_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
ctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707657_X_P-G Feature FT:CDS JQ707657_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707660_X_P-G Feature FT:CDS JQ707660_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707666_X_P-G Feature FT:CDS JQ707666_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccacctggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707668_X_P-G Feature FT:CDS JQ707668_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707671_X_P-G Feature FT:CDS JQ707671_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707673_X_P-G Feature FT:CDS JQ707673_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707677_X_P-G Feature FT:CDS JQ707677_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgacagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707678_X_P-G Feature FT:CDS JQ707678_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707679_X_P-G Feature FT:CDS JQ707679_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707680_X_P-G Feature FT:CDS JQ707680_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgcccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF414679_X_P-G Feature FT:CDS KF414679_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF767450_X_P-G Feature FT:CDS KF767450_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KF767451_X_P-G Feature FT:CDS KF767451_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_27). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KF767452_X_P-G Feature FT:CDS KF767452_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ194508_X_P-G Feature FT:CDS KJ194508_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=465 residues).
ctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KM998716_X_P-G Feature FT:CDS KM998716_X_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcctctgccaaagcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR230749_X_P-G Feature FT:CDS KR230749_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR811460_X_P-G Feature FT:CDS KR811460_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811461_X_P-G Feature FT:CDS KR811461_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811765_X_P-G Feature FT:CDS KR811765_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.01). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811767_X_P-G Feature FT:CDS KR811767_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.03). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgccccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctccgccaaggcagttatataagaggactcttggactgtttgctatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811768_X_P-G Feature FT:CDS KR811768_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.04). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811770_X_P-G Feature FT:CDS KR811770_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.06). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811771_X_P-G Feature FT:CDS KR811771_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.10). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811772_X_P-G Feature FT:CDS KR811772_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.11). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811773_X_P-G Feature FT:CDS KR811773_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.13). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811774_X_P-G Feature FT:CDS KR811774_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.15). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
tccgccatgaacaactctcatccactgccaaggcagttatataaggggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtacgcctaaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811775_X_P-G Feature FT:CDS KR811775_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.16). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgctccacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgcagagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811776_X_P-G Feature FT:CDS KR811776_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.17). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811777_X_P-G Feature FT:CDS KR811777_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.18). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctaccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactcccatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811780_X_P-G Feature FT:CDS KR811780_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.24). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaaccctcatcatctgccaaggcagttatataagaggactcttggactgtttgtagtgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811781_X_P-G Feature FT:CDS KR811781_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.25). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811782_X_P-G Feature FT:CDS KR811782_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.26). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811783_X_P-G Feature FT:CDS KR811783_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.27). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttccgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgctatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811784_X_P-G Feature FT:CDS KR811784_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.28). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcccttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811785_X_P-G Feature FT:CDS KR811785_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2T.29). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcaccgctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtagctttttcacctctgcctaa
>gnl|hbvcds|KR811786_X_P-G Feature FT:CDS KR811786_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.01). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
tagggggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811788_X_P-G Feature FT:CDS KR811788_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.03). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811789_X_P-G Feature FT:CDS KR811789_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.04). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811790_X_P-G Feature FT:CDS KR811790_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.05). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811791_X_P-G Feature FT:CDS KR811791_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.08). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgattattgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811792_X_P-G Feature FT:CDS KR811792_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.09). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgctatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811793_X_P-G Feature FT:CDS KR811793_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.12). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttacgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811794_X_P-G Feature FT:CDS KR811794_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.13). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttcctcctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811795_X_P-G Feature FT:CDS KR811795_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.15). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811797_X_P-G Feature FT:CDS KR811797_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.17). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811800_X_P-G Feature FT:CDS KR811800_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.20). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaacgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811802_X_P-G Feature FT:CDS KR811802_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.24). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811804_X_P-G Feature FT:CDS KR811804_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.28). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811806_X_P-G Feature FT:CDS KR811806_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.30). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgaacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaataggtccaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KR811807_X_P-G Feature FT:CDS KR811807_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 2NT.31). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacaactctcatcctctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
gatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KX264500_X_P-G Feature FT:CDS KX264500_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KY004111_X_P-G Feature FT:CDS KY004111_X_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccagcgg
acgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttacatggaa
accgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgttatgtcaacaaccgg
ggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
© 1998-2020Legal notice