HBVdb

Dataset for nucleotide sequence PreS1 of genotype G

[Download (right click)] [Alignment] [Repertoires]

82 sequence(s)

>gnl|hbvcds|AB056513_PreS1_P-G Feature FT:CDS AB056513_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaatatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB056514_PreS1_P-G Feature FT:CDS AB056514_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=1191 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcagggttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatc
ttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcct
ggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttct
tctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtatt
cccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagt
gccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB056515_PreS1_P-G Feature FT:CDS AB056515_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccacctctaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaagattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagcgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtataaaaccttcggaaggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064310_PreS1_P-G Feature FT:CDS AB064310_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccctgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaatatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064311_PreS1_P-G Feature FT:CDS AB064311_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcccactgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064312_PreS1_P-G Feature FT:CDS AB064312_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaggaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
cagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064313_PreS1_C-G Feature FT:CDS AB064313_PreS1_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcccctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375165_PreS1_P-G Feature FT:CDS AB375165_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375166_PreS1_P-G Feature FT:CDS AB375166_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375167_PreS1_P-G Feature FT:CDS AB375167_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375168_PreS1_P-G Feature FT:CDS AB375168_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375169_PreS1_P-G Feature FT:CDS AB375169_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375170_PreS1_P-G Feature FT:CDS AB375170_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AF160501_PreS1_C-G Feature FT:CDS AF160501_PreS1_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccgccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AF405706_PreS1_P-G Feature FT:CDS AF405706_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ207798_PreS1_P-G Feature FT:CDS DQ207798_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=1197 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccgcacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactgagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctgcaaaatccca
aagtcaggggcctgtatcctgctggtggctccagttcaggaacagtgagccctgttccgactattgcctctcacatctcg
tcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
tagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaact
tgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtt
ggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgca
aaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacc
tgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattggg
ggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|EF464097_PreS1_P-G Feature FT:CDS EF464097_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactccacccagttccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagagacacagaaccctgttccgactattgcctctctcaca
tcatcaatcttctcgaagactgggggccctgcaccgaacatggagaacatcacatcaggactcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF464098_PreS1_P-G Feature FT:CDS EF464098_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactccacccagttccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagagacagcagaacctgctccgactattgcctctctcaca
tcatcaatcttctcgaagactgggggccctgcaccgaacatggagaacatcacatcaggactcctaggacccctgctcgt
gttacaggcggtgtgtttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF634480_PreS1_P-G Feature FT:CDS EF634480_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttctggggtggagccctcagtct
cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctccaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023674_PreS1_P-G Feature FT:CDS FJ023674_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate I2/C2_C04-0790). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggagggtggacatccacccctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccga
tcatcagttggatcctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
aagcccatcaggtaggagcgggagcattcgggccagggttcacccctccacacggaggtctgttggggtggagccctcag
gctcagggcatattaacaaatgtgccagcagttcctcctcctgcctcaaccaatcggcagtcaggacggcagcccactcc
catctctccacctctgagagacagycatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcargatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcac
atctcatcaatcttcgcaaggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgct
cgtgttacaggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcarggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggct
cagtttactagcgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaaatctgtacamcaccttgagtccatttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FR714503_PreS1_P-G Feature FT:CDS FR714503_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate TZ306). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcttccaaacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccga
tcatcagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
aagcccatcaggtaggagcgggagcattcgggccagggttcacccctcctcacggaggtcttttggggtggagccctcag
gctcagggcatattaacaaacgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcc
catatctccacctctaagagacagtcatcctcaggccatgcagtggaactccaccaccttccaccaagctctacaagatc
ccagaatcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcatcaatcttcacgaggattggggaccctgcaacgaacatggagaacatcacatcaggattcctcggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgaggccatttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|GU563556_PreS1_P-G Feature FT:CDS GU563556_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GU565217_PreS1_P-G Feature FT:CDS GU565217_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctccgtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981171_PreS1_P-G Feature FT:CDS HE981171_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=1188 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcagtcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttc
tccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggg
gtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggag
tgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggc
tatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttct
ggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgca
cgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattccc
atcccatcatcttgggctttcgcaaaatacctatgggagtgggtctcagtccgtttctcatggctcagtttactagtgcc
atttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatc
tgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|HE981172_PreS1_P-G Feature FT:CDS HE981172_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=1188 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcagtcctgctggtggctccagttcagggatagtgaaccttgttccgactattgcctctcacatctcgtcaatcttc
tccaggattggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggg
gtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggag
tgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggc
tatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttct
ggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgca
cgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattccc
atcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgcc
atttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatc
tgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|HE981174_PreS1_P-G Feature FT:CDS HE981174_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcaatct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981175_PreS1_P-G Feature FT:CDS HE981175_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981176_PreS1_P-G Feature FT:CDS HE981176_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439779_PreS1_P-G Feature FT:CDS JF439779_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03D1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439780_PreS1_P-G Feature FT:CDS JF439780_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03D4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
ggggaccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439781_PreS1_P-G Feature FT:CDS JF439781_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03G3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439782_PreS1_P-G Feature FT:CDS JF439782_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03E10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439784_PreS1_P-G Feature FT:CDS JF439784_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03E12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccacactgtctggctttcagctatgtggatgatattgtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439785_PreS1_P-G Feature FT:CDS JF439785_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
ggggaccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439786_PreS1_P-G Feature FT:CDS JF439786_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439787_PreS1_P-G Feature FT:CDS JF439787_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcaaggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439788_PreS1_P-G Feature FT:CDS JF439788_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattctaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatccaa
>gnl|hbvcds|JF439789_PreS1_P-G Feature FT:CDS JF439789_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439791_PreS1_P-G Feature FT:CDS JF439791_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccggcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttcaccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gtcacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439792_PreS1_P-G Feature FT:CDS JF439792_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2004G2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttctggggtggagccctcagtct
cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcactaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439793_PreS1_P-G Feature FT:CDS JF439793_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2004G4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttctggggtggagccctcagtct
cagggcacactaacaactttaccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcactaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439803_PreS1_P-G Feature FT:CDS JF439803_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439804_PreS1_P-G Feature FT:CDS JF439804_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439805_PreS1_P-G Feature FT:CDS JF439805_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439806_PreS1_P-G Feature FT:CDS JF439806_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439807_PreS1_P-G Feature FT:CDS JF439807_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439808_PreS1_P-G Feature FT:CDS JF439808_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439809_PreS1_P-G Feature FT:CDS JF439809_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439810_PreS1_P-G Feature FT:CDS JF439810_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439811_PreS1_P-G Feature FT:CDS JF439811_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439812_PreS1_P-G Feature FT:CDS JF439812_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctctcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439813_PreS1_P-G Feature FT:CDS JF439813_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439814_PreS1_P-G Feature FT:CDS JF439814_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439815_PreS1_P-G Feature FT:CDS JF439815_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439816_PreS1_P-G Feature FT:CDS JF439816_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439817_PreS1_P-G Feature FT:CDS JF439817_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439818_PreS1_P-G Feature FT:CDS JF439818_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctttccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcagtccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JN604208_PreS1_P-G Feature FT:CDS JN604208_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 476-6039-6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtgggggaagaatctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcaaggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcaggaatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtacccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcttgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707436_PreS1_P-G Feature FT:CDS JQ707436_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MC1_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=1197 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcg
tcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
tagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaact
tgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtt
ggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgca
aaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacc
tgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattggg
ggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707657_PreS1_P-G Feature FT:CDS JQ707657_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707660_PreS1_P-G Feature FT:CDS JQ707660_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707666_PreS1_P-G Feature FT:CDS JQ707666_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707668_PreS1_P-G Feature FT:CDS JQ707668_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707671_PreS1_P-G Feature FT:CDS JQ707671_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaactttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707673_PreS1_P-G Feature FT:CDS JQ707673_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707677_PreS1_P-G Feature FT:CDS JQ707677_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggatatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707678_PreS1_P-G Feature FT:CDS JQ707678_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatcgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707679_PreS1_P-G Feature FT:CDS JQ707679_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707680_PreS1_P-G Feature FT:CDS JQ707680_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF414679_PreS1_P-G Feature FT:CDS KF414679_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcactaatctcctgtcctcca
acttgtcctggctatcgctggatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767450_PreS1_P-G Feature FT:CDS KF767450_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767451_PreS1_P-G Feature FT:CDS KF767451_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_27). Non-functional genomic sequence. [Hepadnaviridae] (length=1197 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcg
tcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
tagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaact
tgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtt
ggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgca
aaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacc
tgtattcccatcccatcatcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattggg
ggccaaatctgtacagcatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767452_PreS1_P-G Feature FT:CDS KF767452_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_7). Non-functional genomic sequence. [Hepadnaviridae] (length=1197 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagtcggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtgctctacagcattccaccaagctctacaaaatcccaaag
tcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcg
tcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
tagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaact
tgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtt
ggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgca
aaacctgcacgtctcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacc
tgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattggg
ggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779233_PreS1_P-G Feature FT:CDS KF779233_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6090). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779235_PreS1_P-G Feature FT:CDS KF779235_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6106). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctacggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779267_PreS1_P-G Feature FT:CDS KF779267_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate JFA3956). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctgggattctttcccgatca
ccagttggacccagccttcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779357_PreS1_P-G Feature FT:CDS KF779357_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate PNF5187). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgaatattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtatttcgtgttgacaagattcttcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KJ194508_PreS1_P-G Feature FT:CDS KJ194508_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KM998716_PreS1_P-G Feature FT:CDS KM998716_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KR230749_PreS1_P-G Feature FT:CDS KR230749_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcgggggttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KX264500_PreS1_P-G Feature FT:CDS KX264500_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY004111_PreS1_P-G Feature FT:CDS KY004111_PreS1_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=1200 residues).
atggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatca
ccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagagg
ccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtct
cagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccat
ctctccaccactaagagacagtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatccca
aagtcaggggcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatc
tcgtcaatcttctccaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctcca
acttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
gttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtatt
gggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaa
© 1998-2020Legal notice