HBVdb

Dataset for nucleotide sequence PreC of genotype G

[Download (right click)] [Alignment] [Repertoires]

47 sequence(s)

>gnl|hbvcds|AB056513_PreC_P-G Feature FT:CDS AB056513_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttactctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatt
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB056514_PreC_P-G Feature FT:CDS AB056514_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB056515_PreC_P-G Feature FT:CDS AB056515_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgttcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagagacaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB064310_PreC_P-G Feature FT:CDS AB064310_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB064311_PreC_P-G Feature FT:CDS AB064311_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB064312_PreC_P-G Feature FT:CDS AB064312_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatgcagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB064313_PreC_C-G Feature FT:CDS AB064313_PreC_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375165_PreC_P-G Feature FT:CDS AB375165_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375166_PreC_P-G Feature FT:CDS AB375166_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375167_PreC_P-G Feature FT:CDS AB375167_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375168_PreC_P-G Feature FT:CDS AB375168_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375169_PreC_P-G Feature FT:CDS AB375169_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AB375170_PreC_P-G Feature FT:CDS AB375170_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AF160501_PreC_C-G Feature FT:CDS AF160501_PreC_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|AF405706_PreC_P-G Feature FT:CDS AF405706_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|DQ207798_PreC_P-G Feature FT:CDS DQ207798_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacgtttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|EF464097_PreC_P-G Feature FT:CDS EF464097_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|EF464098_PreC_P-G Feature FT:CDS EF464098_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|EF634480_PreC_P-G Feature FT:CDS EF634480_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|GU563556_PreC_P-G Feature FT:CDS GU563556_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|GU565217_PreC_P-G Feature FT:CDS GU565217_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atggaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgatag
>gnl|hbvcds|HE981171_PreC_P-G Feature FT:CDS HE981171_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggcggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|HE981172_PreC_P-G Feature FT:CDS HE981172_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|HE981174_PreC_P-G Feature FT:CDS HE981174_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|HE981175_PreC_P-G Feature FT:CDS HE981175_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|HE981176_PreC_P-G Feature FT:CDS HE981176_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707436_PreC_P-G Feature FT:CDS JQ707436_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MC1_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaatc
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707657_PreC_P-G Feature FT:CDS JQ707657_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctcaagcttcccaatgttag
>gnl|hbvcds|JQ707660_PreC_P-G Feature FT:CDS JQ707660_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707666_PreC_P-G Feature FT:CDS JQ707666_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707668_PreC_P-G Feature FT:CDS JQ707668_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707671_PreC_P-G Feature FT:CDS JQ707671_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707673_PreC_P-G Feature FT:CDS JQ707673_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcggaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707677_PreC_P-G Feature FT:CDS JQ707677_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707678_PreC_P-G Feature FT:CDS JQ707678_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707679_PreC_P-G Feature FT:CDS JQ707679_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|JQ707680_PreC_P-G Feature FT:CDS JQ707680_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KF414679_PreC_P-G Feature FT:CDS KF414679_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KF767450_PreC_P-G Feature FT:CDS KF767450_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattcttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KF767451_PreC_P-G Feature FT:CDS KF767451_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_27). Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcasctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactccgcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KF767452_PreC_P-G Feature FT:CDS KF767452_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_7). Non-functional genomic sequence. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KJ194508_PreC_P-G Feature FT:CDS KJ194508_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KM998716_PreC_P-G Feature FT:CDS KM998716_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gccgaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KR230749_PreC_P-G Feature FT:CDS KR230749_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KX264500_PreC_P-G Feature FT:CDS KX264500_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
>gnl|hbvcds|KY004111_PreC_P-G Feature FT:CDS KY004111_PreC_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=675 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaagccttagagtcctttgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgat
gactctagccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctacatctccagcttcccaatgttag
>gnl|hbvcds|M74502_PreC_P-G Feature FT:CDS M74502_PreC_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=675 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctactg
tggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgg
gaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgat
gactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaata
tgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttg
gtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagac
tactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtc
gcagaagatctgcatctccagcttcccaatgttag
© 1998-2020Legal notice