HBVdb

Dataset for nucleotide sequence X of genotype F

[Download (right click)] [Alignment] [Repertoires]

394 sequence(s)

>gnl|hbvcds|AB036905_X_P-F Feature FT:CDS AB036905_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036906_X_P-F Feature FT:CDS AB036906_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036907_X_P-F Feature FT:CDS AB036907_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036908_X_P-F Feature FT:CDS AB036908_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8337). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036909_X_P-F Feature FT:CDS AB036909_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036910_X_P-F Feature FT:CDS AB036910_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8251). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036911_X_P-F Feature FT:CDS AB036911_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8255). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036912_X_P-F Feature FT:CDS AB036912_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8323). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036913_X_P-F Feature FT:CDS AB036913_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8346). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036914_X_P-F Feature FT:CDS AB036914_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8349). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036915_X_P-F Feature FT:CDS AB036915_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8351). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036916_X_P-F Feature FT:CDS AB036916_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8371). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036917_X_P-F Feature FT:CDS AB036917_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036918_X_P-F Feature FT:CDS AB036918_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036919_X_P-F Feature FT:CDS AB036919_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8381). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB036920_X_P-F Feature FT:CDS AB036920_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8624). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB064316_X_P-F Feature FT:CDS AB064316_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB086397_X_P-F Feature FT:CDS AB086397_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate JPF1130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116549_X_P-F Feature FT:CDS AB116549_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116550_X_P-F Feature FT:CDS AB116550_X_P-F of [Viruses] Hepatitis B Virus genotype F. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116551_X_P-F Feature FT:CDS AB116551_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccatggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116552_X_P-F Feature FT:CDS AB116552_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcgggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116654_X_P-F Feature FT:CDS AB116654_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgccctcttctccgtctgccgttccagccgacgacgggtcgtacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB166850_X_P-F Feature FT:CDS AB166850_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL592). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaatagtcttacataacaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB214516_X_P-F Feature FT:CDS AB214516_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL597). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggtctcgcctgctgttccttctcatgtgccgcatcgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB365446_X_P-F Feature FT:CDS AB365446_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcctggag
accaccgtgaacgccccctggagtttgccaatagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccagtcaactttttcacctctgcctaa
>gnl|hbvcds|AB365449_X_P-F Feature FT:CDS AB365449_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL93). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcrtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB365450_X_P-F Feature FT:CDS AB365450_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagycttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223962_X_P-F Feature FT:CDS AF223962_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223963_X_P-F Feature FT:CDS AF223963_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223964_X_P-F Feature FT:CDS AF223964_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223965_X_P-F Feature FT:CDS AF223965_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090455_X_P-F Feature FT:CDS AY090455_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090456_X_P-F Feature FT:CDS AY090456_X_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090458_X_C-F Feature FT:CDS AY090458_X_C-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcctgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090459_X_P-F Feature FT:CDS AY090459_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090461_X_P-F Feature FT:CDS AY090461_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY179735_X_P-F Feature FT:CDS AY179735_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY311369_X_P-F Feature FT:CDS AY311369_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD4139). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctactgttcaagcctacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY311370_X_P-F Feature FT:CDS AY311370_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629930_X_P-F Feature FT:CDS DQ629930_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1321m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactgggtcctccgcgggacggcctttatctacatcccgtcggcgctgactcccgcgg
acgatccctctcggggtcgcttggggttgtaccgcacccttctcagtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629931_X_P-F Feature FT:CDS DQ629931_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1430h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629932_X_P-F Feature FT:CDS DQ629932_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1481m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctggtatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaatatctttgttt
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629933_X_P-F Feature FT:CDS DQ629933_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1606h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcaactctgcctaa
>gnl|hbvcds|DQ629934_X_P-F Feature FT:CDS DQ629934_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1628h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctgggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagatcaggttacaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagccccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629935_X_P-F Feature FT:CDS DQ629935_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2028d). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaaatggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttttccacctctgcctaa
>gnl|hbvcds|DQ629937_X_P-F Feature FT:CDS DQ629937_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2589m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
atttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaagaactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaaatggtttgttcaccagccccatgcaactttttcacctctccttaa
>gnl|hbvcds|DQ629938_X_P-F Feature FT:CDS DQ629938_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2737m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgcgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttctccagcaccatgcaactttttcccctgcgcctaa
>gnl|hbvcds|DQ629940_X_P-F Feature FT:CDS DQ629940_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2833e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgctttacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629941_X_P-F Feature FT:CDS DQ629941_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2834e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtatcgccccatctcccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggtctcttggactttcaggatggtcaatgccctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggaggtgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629943_X_P-F Feature FT:CDS DQ629943_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgcagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggatatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgccaccttttcacctctgcctaa
>gnl|hbvcds|DQ629944_X_P-F Feature FT:CDS DQ629944_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3096e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgattcctctcggggtcgcttggggttgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaagagatcaggttaaaggtctttgtat
tattaggctgtaggcataaattggtctgttcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629945_X_P-F Feature FT:CDS DQ629945_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3254h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataaggggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629946_X_P-F Feature FT:CDS DQ629946_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3338m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccgggcccgcttggggcttacccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcgcgtcgcatggag
accaccctgagcccccctcggggtttgccaacagtctttcataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtattaaggacatgggaggagttgggggaggaaatcagggtaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629947_X_P-F Feature FT:CDS DQ629947_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3355h). Partial genome (Contains: HBe, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttaacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcctaccaacagtcttacatcagcggactcttggactctctggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgttggcataaattgggctgttcaccaccaccatgcaactttttcaccccttcctaa
>gnl|hbvcds|DQ629948_X_P-F Feature FT:CDS DQ629948_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3456h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629949_X_P-F Feature FT:CDS DQ629949_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 347h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaacggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629950_X_P-F Feature FT:CDS DQ629950_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3751m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629951_X_P-F Feature FT:CDS DQ629951_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3826e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaatgtctttctat
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629953_X_P-F Feature FT:CDS DQ629953_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4026e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgagacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629954_X_P-F Feature FT:CDS DQ629954_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4301e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629955_X_P-F Feature FT:CDS DQ629955_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 445e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaatgtctttctat
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629956_X_P-F Feature FT:CDS DQ629956_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4539e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctgggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629958_X_P-F Feature FT:CDS DQ629958_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4899m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgcccacagtcttacataaaaggactgttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629959_X_P-F Feature FT:CDS DQ629959_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4902e). Partial genome (Contains: HBe, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggttgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcacttcacatctgtaggtcccttgggg
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629960_X_P-F Feature FT:CDS DQ629960_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4904m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactctcaggccggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629961_X_P-F Feature FT:CDS DQ629961_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5251m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629962_X_P-F Feature FT:CDS DQ629962_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5252m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629963_X_P-F Feature FT:CDS DQ629963_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5399m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629964_X_P-F Feature FT:CDS DQ629964_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5433m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629965_X_P-F Feature FT:CDS DQ629965_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 551h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaagctgtaggcataaattggtctgttcaacagcaccatgcaattttttcacctctgcctaa
>gnl|hbvcds|DQ629966_X_P-F Feature FT:CDS DQ629966_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 575h). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629967_X_P-F Feature FT:CDS DQ629967_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5838m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccgaggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttcaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629968_X_P-F Feature FT:CDS DQ629968_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5840e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggccggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctctgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629969_X_P-F Feature FT:CDS DQ629969_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6026e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttctcctctgcctaa
>gnl|hbvcds|DQ629971_X_P-F Feature FT:CDS DQ629971_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6067m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctaaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629972_X_P-F Feature FT:CDS DQ629972_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6151m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaggactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctggctaa
>gnl|hbvcds|DQ629973_X_P-F Feature FT:CDS DQ629973_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6194m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtatgcatatgttggcctgttcaccggaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629974_X_P-F Feature FT:CDS DQ629974_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6217m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629975_X_P-F Feature FT:CDS DQ629975_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6290m2m). Partial genome (Contains: HBe, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaataggtctgttcaccagcaccatgcaactttttcatctctgcctaa
>gnl|hbvcds|DQ629977_X_P-F Feature FT:CDS DQ629977_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6400m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagacaaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629978_X_P-F Feature FT:CDS DQ629978_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6401m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggccggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaataggttaatgatctatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629979_X_P-F Feature FT:CDS DQ629979_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6403m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629981_X_P-F Feature FT:CDS DQ629981_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6484m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggttaaattat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629983_X_P-F Feature FT:CDS DQ629983_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6541m2m). Partial genome (Contains: HBe, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctgaagtttgccaacagtcttacataagaggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629985_X_P-F Feature FT:CDS DQ629985_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6544m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgcgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcacgttaaagatcattgatt
taggaggctgtatggataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629986_X_P-F Feature FT:CDS DQ629986_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6572m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaaaagtcttacataaaaggactgttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629987_X_P-F Feature FT:CDS DQ629987_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6593m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggttgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctccggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629988_X_P-F Feature FT:CDS DQ629988_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6604m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctacgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaccaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcacccgcaccatgcaactttttcacctcggcctaa
>gnl|hbvcds|DQ629989_X_P-F Feature FT:CDS DQ629989_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6649m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgcttccaacttgatcctacgcgggacgtcctttgtctacgtcccgtcggcgctaaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629990_X_P-F Feature FT:CDS DQ629990_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6653m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629991_X_P-F Feature FT:CDS DQ629991_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6682m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttacggactgggaggagttgggggaggagatcaggttcaagatccttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629992_X_P-F Feature FT:CDS DQ629992_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6760m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629993_X_P-F Feature FT:CDS DQ629993_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6781m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgctacacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtgt
taggaggctgtaggcataaatgggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629994_X_P-F Feature FT:CDS DQ629994_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6825m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaatgtctttctat
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629995_X_P-F Feature FT:CDS DQ629995_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 6891m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629996_X_P-F Feature FT:CDS DQ629996_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 865m). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcgaggtcgcttggggctgtaccgccccctttaccgtctgccactccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtcttttccttctcatctgccttaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggcgatgggggaggagatcaggttaaaggtctttgtat
taggaagctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ629997_X_P-F Feature FT:CDS DQ629997_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 920e). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|DQ776247_X_P-F Feature FT:CDS DQ776247_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823086_X_P-F Feature FT:CDS DQ823086_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttaggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823087_X_P-F Feature FT:CDS DQ823087_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttgcataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagtgccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823088_X_P-F Feature FT:CDS DQ823088_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggwtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctstaccgccctctactgcgtctgcygttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggwccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaraggactmttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823089_X_P-F Feature FT:CDS DQ823089_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823090_X_P-F Feature FT:CDS DQ823090_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823091_X_P-F Feature FT:CDS DQ823091_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823092_X_P-F Feature FT:CDS DQ823092_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823093_X_P-F Feature FT:CDS DQ823093_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823094_X_P-F Feature FT:CDS DQ823094_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ823095_X_P-F Feature FT:CDS DQ823095_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899142_X_P-F Feature FT:CDS DQ899142_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao152). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactggaaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899143_X_P-F Feature FT:CDS DQ899143_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao189). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899144_X_P-F Feature FT:CDS DQ899144_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacacaagaggactcttggactttcaggagggtcaatgacctg
gattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaagttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899145_X_P-F Feature FT:CDS DQ899145_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccccttgagtttgccaacagtcttacacaagaggactcttggactttcaggagggtcaatgacctg
gattgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899146_X_P-F Feature FT:CDS DQ899146_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtgctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactttcaggagggtcaatgacctg
gattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899147_X_P-F Feature FT:CDS DQ899147_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactttcaggagggtcaatgacctg
gattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899148_X_P-F Feature FT:CDS DQ899148_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Yanomami114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtccgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacattttcacctctgcctaa
>gnl|hbvcds|DQ899149_X_P-F Feature FT:CDS DQ899149_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Piaroa3019). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ899150_X_P-F Feature FT:CDS DQ899150_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Colombia8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatggaactttttcacctctgcctaa
>gnl|hbvcds|EF026745_X_P-F Feature FT:CDS EF026745_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttaggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026746_X_P-F Feature FT:CDS EF026746_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttgcataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagtgccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026747_X_P-F Feature FT:CDS EF026747_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggwtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctstaccgccctctactgcgtctgcygttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggwccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaraggactmttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026748_X_P-F Feature FT:CDS EF026748_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026749_X_P-F Feature FT:CDS EF026749_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026750_X_P-F Feature FT:CDS EF026750_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026751_X_P-F Feature FT:CDS EF026751_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026752_X_P-F Feature FT:CDS EF026752_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026753_X_P-F Feature FT:CDS EF026753_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF026754_X_P-F Feature FT:CDS EF026754_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF397982_X_P-F Feature FT:CDS EF397982_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bucaramanga 14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataaaaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggtataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF576808_X_P-F Feature FT:CDS EF576808_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccggccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF576812_X_P-F Feature FT:CDS EF576812_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU366116_X_P-F Feature FT:CDS EU366116_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU366118_X_P-F Feature FT:CDS EU366118_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU366132_X_P-F Feature FT:CDS EU366132_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU366133_X_P-F Feature FT:CDS EU366133_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU670260_X_P-F Feature FT:CDS EU670260_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 453). Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU670261_X_P-F Feature FT:CDS EU670261_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 499). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcgggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgacctttgtat
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU670262_X_P-F Feature FT:CDS EU670262_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 549). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgctcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|FJ589065_X_P-F Feature FT:CDS FJ589065_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_024). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgtttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcacctgcagcatgcttctttttcacctctgcctaa
>gnl|hbvcds|FJ589066_X_P-F Feature FT:CDS FJ589066_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_054). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaggactgggaggagctgggtgaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcannnnnnnnnnnnnnctttttcacctctgcctaa
>gnl|hbvcds|FJ589067_X_P-F Feature FT:CDS FJ589067_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_083). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaccaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ657519_X_P-F Feature FT:CDS FJ657519_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA110). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ657522_X_P-F Feature FT:CDS FJ657522_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ657525_X_P-F Feature FT:CDS FJ657525_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgcgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggacttgcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttgcggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ657528_X_P-F Feature FT:CDS FJ657528_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ657529_X_P-F Feature FT:CDS FJ657529_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709457_X_P-F Feature FT:CDS FJ709457_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709458_X_P-F Feature FT:CDS FJ709458_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709459_X_P-F Feature FT:CDS FJ709459_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709460_X_P-F Feature FT:CDS FJ709460_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709462_X_P-F Feature FT:CDS FJ709462_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709463_X_P-F Feature FT:CDS FJ709463_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709464_X_P-F Feature FT:CDS FJ709464_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709465_X_P-F Feature FT:CDS FJ709465_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ709494_X_P-F Feature FT:CDS FJ709494_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE981181_X_P-F Feature FT:CDS HE981181_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggagtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE981182_X_P-F Feature FT:CDS HE981182_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE981183_X_P-F Feature FT:CDS HE981183_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585186_X_P-F Feature FT:CDS HM585186_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585187_X_P-F Feature FT:CDS HM585187_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585188_X_P-F Feature FT:CDS HM585188_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585189_X_P-F Feature FT:CDS HM585189_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585190_X_P-F Feature FT:CDS HM585190_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcgggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585191_X_P-F Feature FT:CDS HM585191_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585192_X_P-F Feature FT:CDS HM585192_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585193_X_P-F Feature FT:CDS HM585193_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585194_X_P-F Feature FT:CDS HM585194_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585195_X_P-F Feature FT:CDS HM585195_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585196_X_P-F Feature FT:CDS HM585196_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585197_X_P-F Feature FT:CDS HM585197_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585198_X_P-F Feature FT:CDS HM585198_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585199_X_P-F Feature FT:CDS HM585199_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM585200_X_P-F Feature FT:CDS HM585200_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM590471_X_P-F Feature FT:CDS HM590471_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM590472_X_P-F Feature FT:CDS HM590472_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM590473_X_P-F Feature FT:CDS HM590473_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM590474_X_P-F Feature FT:CDS HM590474_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgcttggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagccttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM622135_X_P-F Feature FT:CDS HM622135_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggcttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM627320_X_P-F Feature FT:CDS HM627320_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ378247_X_P-F Feature FT:CDS HQ378247_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate IRL-2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911673_X_P-F Feature FT:CDS JF911673_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA66). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
acccccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggaggtgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911674_X_P-F Feature FT:CDS JF911674_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911675_X_P-F Feature FT:CDS JF911675_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA70). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtct
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911676_X_P-F Feature FT:CDS JF911676_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA71). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaagcataaattgggctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911677_X_P-F Feature FT:CDS JF911677_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA75). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911678_X_P-F Feature FT:CDS JF911678_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA55). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtcttgttat
taagaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911679_X_P-F Feature FT:CDS JF911679_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911680_X_P-F Feature FT:CDS JF911680_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911692_X_P-F Feature FT:CDS JF911692_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA68). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttatataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttacagactgggaggagttgggggaggagagcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911693_X_P-F Feature FT:CDS JF911693_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA58). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctcacgccctcttctccgtctgccgttccttccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactctcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911694_X_P-F Feature FT:CDS JF911694_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA73). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgacgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagtccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcatctttttcacctctgcctaa
>gnl|hbvcds|JF911695_X_P-F Feature FT:CDS JF911695_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA60). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atgggtgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctccgtctgccgttccttccgacgacgggtcgcacctct
ctttacgcggactccccatctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggagtctgccaacagtcttacataagaggactcttggactctcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtct
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911696_X_P-F Feature FT:CDS JF911696_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA69). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggatctaccgccctcttctgcgtctgccgttccggccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttatataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688691_X_P-F Feature FT:CDS JN688691_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688699_X_P-F Feature FT:CDS JN688699_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV133). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtangcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688701_X_P-F Feature FT:CDS JN688701_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV135). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactactggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688703_X_P-F Feature FT:CDS JN688703_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV137). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688709_X_P-F Feature FT:CDS JN688709_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV143). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgacnacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcntctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggagganatcaggttaaaggtctttgtac
taggaggctgtasgcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688720_X_P-F Feature FT:CDS JN688720_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV224). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactttcaggacggttcatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792914_X_P-F Feature FT:CDS JN792914_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8052-03506). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacaatcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792916_X_P-F Feature FT:CDS JN792916_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7703-00047). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792917_X_P-F Feature FT:CDS JN792917_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-05260). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcagggaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792918_X_P-F Feature FT:CDS JN792918_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-03547). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtccgcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttctcttcacctctgcacgtctcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcagggaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792919_X_P-F Feature FT:CDS JN792919_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-13282). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtaccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792920_X_P-F Feature FT:CDS JN792920_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-05424). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcattgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792921_X_P-F Feature FT:CDS JN792921_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03738). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctmggwtgtgctgcmaactggatcctrcgcgggacgtcctttgtttacgtcccrtcggcgctgaatccmgcgg
acgayccctcycggggtcgcttggggctgtaycgcccycttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggmctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792922_X_P-F Feature FT:CDS JN792922_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03301). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN811655_X_P-F Feature FT:CDS JN811655_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3Mg). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN811656_X_P-F Feature FT:CDS JN811656_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatagaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272888_X_P-F Feature FT:CDS JQ272888_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272889_X_P-F Feature FT:CDS JQ272889_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ1). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272890_X_P-F Feature FT:CDS JQ272890_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ2). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcccctctgcacgtcgcatggag
accaccgtaaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcgcctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272891_X_P-F Feature FT:CDS JQ272891_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ3). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttctcttcatctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272892_X_P-F Feature FT:CDS JQ272892_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ4). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272893_X_P-F Feature FT:CDS JQ272893_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ6). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272894_X_P-F Feature FT:CDS JQ272894_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ7). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctatatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttccggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272895_X_P-F Feature FT:CDS JQ272895_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ8). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattgggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272898_X_P-F Feature FT:CDS JQ272898_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ11). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272899_X_P-F Feature FT:CDS JQ272899_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ12). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272900_X_P-F Feature FT:CDS JQ272900_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ13). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgtacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|JQ272901_X_P-F Feature FT:CDS JQ272901_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ14). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272904_X_P-F Feature FT:CDS JQ272904_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ17). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272905_X_P-F Feature FT:CDS JQ272905_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ18). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggaaattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272906_X_P-F Feature FT:CDS JQ272906_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ19). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272907_X_P-F Feature FT:CDS JQ272907_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ20). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272908_X_P-F Feature FT:CDS JQ272908_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ21). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272909_X_P-F Feature FT:CDS JQ272909_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ22). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272910_X_P-F Feature FT:CDS JQ272910_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ23). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272913_X_P-F Feature FT:CDS JQ272913_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ27). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272914_X_P-F Feature FT:CDS JQ272914_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ28). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX079936_X_P-F Feature FT:CDS JX079936_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX079937_X_P-F Feature FT:CDS JX079937_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttccggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494394_X_P-F Feature FT:CDS KC494394_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR12-NORTH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgagcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttccaccgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494395_X_P-F Feature FT:CDS KC494395_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR11-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494396_X_P-F Feature FT:CDS KC494396_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR10-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatactgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttccggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggaaagtaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494397_X_P-F Feature FT:CDS KC494397_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR9-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494398_X_P-F Feature FT:CDS KC494398_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR8-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggagtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494399_X_P-F Feature FT:CDS KC494399_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR7-CENTRAL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccmctggagtttgccaacagccttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494400_X_P-F Feature FT:CDS KC494400_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR6-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494401_X_P-F Feature FT:CDS KC494401_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR5-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtcttcttat
taagaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494402_X_P-F Feature FT:CDS KC494402_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR4-NORTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494403_X_P-F Feature FT:CDS KC494403_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR3-NORTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494404_X_P-F Feature FT:CDS KC494404_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR2-NORTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC494405_X_P-F Feature FT:CDS KC494405_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR1-NORTHEAST). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgtcaaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|KF199901_X_P-F Feature FT:CDS KF199901_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RVLA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctagaaacttkyymacmkyykymyawwmryskwytsttsatstyyyaskrwkgtmracymcmwg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ586805_X_P-F Feature FT:CDS KJ586805_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagccccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ586806_X_P-F Feature FT:CDS KJ586806_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ586807_X_P-F Feature FT:CDS KJ586807_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ586808_X_P-F Feature FT:CDS KJ586808_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638656_X_P-F Feature FT:CDS KJ638656_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctccggacggtcaatgacctg
gatcgaagaatacttcaaagactgtgtatttaatgactgggaggagctgggggaggagatttggttaaagatttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638657_X_P-F Feature FT:CDS KJ638657_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT013). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtwtcgcccccttctccgtctgccgttccagccracgacgggtcgcccctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638659_X_P-F Feature FT:CDS KJ638659_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT025). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638660_X_P-F Feature FT:CDS KJ638660_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT030). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctttrccgccctcttctccgtctcccgttccagccgacgacgggtcgcacctct
cttttcgcggactccccgtytgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acaaccgtgaacgccccctggagtttgccaacagccttacataagcggactcttggactgtcaggacggtcaatgacctg
gatcgaagattacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagataaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638662_X_P-F Feature FT:CDS KJ638662_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT040). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctttgccgccctcttctccgtctcccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactgtcaggacggtcaatgacctg
gatcgaagattacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagataaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ638663_X_P-F Feature FT:CDS KJ638663_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT047). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactctccggacggtcaatgacctg
gatcgaaggatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtccgttcacccgcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|KJ638664_X_P-F Feature FT:CDS KJ638664_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT049). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtctcgcccccttctccgtctgccgttccacccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactctcgggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ676694_X_P-F Feature FT:CDS KJ676694_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctccgtctgccgttcctkccracgacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgmatggag
accaccgtgaacgcccacyggagtytgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgnncaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843163_X_P-F Feature FT:CDS KJ843163_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843164_X_P-F Feature FT:CDS KJ843164_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag02). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843167_X_P-F Feature FT:CDS KJ843167_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843168_X_P-F Feature FT:CDS KJ843168_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag06). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843169_X_P-F Feature FT:CDS KJ843169_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag07). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843170_X_P-F Feature FT:CDS KJ843170_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag08). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843171_X_P-F Feature FT:CDS KJ843171_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag09). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843174_X_P-F Feature FT:CDS KJ843174_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843175_X_P-F Feature FT:CDS KJ843175_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaacggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843176_X_P-F Feature FT:CDS KJ843176_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843177_X_P-F Feature FT:CDS KJ843177_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843178_X_P-F Feature FT:CDS KJ843178_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843179_X_P-F Feature FT:CDS KJ843179_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843180_X_P-F Feature FT:CDS KJ843180_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843181_X_P-F Feature FT:CDS KJ843181_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843185_X_P-F Feature FT:CDS KJ843185_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttaggggaggagatcagggcaaaggtctttgtac
taggaggctgtaggcataaaaaggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843189_X_P-F Feature FT:CDS KJ843189_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843190_X_P-F Feature FT:CDS KJ843190_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843191_X_P-F Feature FT:CDS KJ843191_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggcttttcaggaaggtcccagacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggsgakgagattaggttaaaggtctttgtat
taggaggctgtaggcmtaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843193_X_P-F Feature FT:CDS KJ843193_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaggactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843194_X_P-F Feature FT:CDS KJ843194_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843195_X_P-F Feature FT:CDS KJ843195_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagtttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843196_X_P-F Feature FT:CDS KJ843196_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843197_X_P-F Feature FT:CDS KJ843197_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843198_X_P-F Feature FT:CDS KJ843198_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843199_X_P-F Feature FT:CDS KJ843199_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843200_X_P-F Feature FT:CDS KJ843200_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843201_X_P-F Feature FT:CDS KJ843201_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaagggtaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843202_X_P-F Feature FT:CDS KJ843202_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843203_X_P-F Feature FT:CDS KJ843203_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843204_X_P-F Feature FT:CDS KJ843204_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843205_X_P-F Feature FT:CDS KJ843205_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843206_X_P-F Feature FT:CDS KJ843206_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843207_X_P-F Feature FT:CDS KJ843207_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843208_X_P-F Feature FT:CDS KJ843208_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843209_X_P-F Feature FT:CDS KJ843209_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag49). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843210_X_P-F Feature FT:CDS KJ843210_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843211_X_P-F Feature FT:CDS KJ843211_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843212_X_P-F Feature FT:CDS KJ843212_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttctcacctctgcctaa
>gnl|hbvcds|KJ843213_X_P-F Feature FT:CDS KJ843213_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843219_X_P-F Feature FT:CDS KJ843219_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843220_X_P-F Feature FT:CDS KJ843220_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtwm
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843221_X_P-F Feature FT:CDS KJ843221_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr04). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843222_X_P-F Feature FT:CDS KJ843222_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843223_X_P-F Feature FT:CDS KJ843223_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr06). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctgggggtctaccgacctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataacaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttamagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843224_X_P-F Feature FT:CDS KJ843224_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr07). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843225_X_P-F Feature FT:CDS KJ843225_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr08). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcctctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggtgtttgccaacagtcttatataacaggactattggactttccggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843226_X_P-F Feature FT:CDS KJ843226_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr09). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM233681_X_P-F Feature FT:CDS KM233681_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcaaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM659861_X_P-F Feature FT:CDS KM659861_X_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM998715_X_P-F Feature FT:CDS KM998715_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718103_X_P-F Feature FT:CDS KP718103_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1214). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttccggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718104_X_P-F Feature FT:CDS KP718104_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CL0004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718106_X_P-F Feature FT:CDS KP718106_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1650). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaawgrtctttgtac
taggaggctgtaggyataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718107_X_P-F Feature FT:CDS KP718107_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT097). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctccggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtct
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttaacctctgcctaa
>gnl|hbvcds|KP718109_X_P-F Feature FT:CDS KP718109_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7555_HIV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgtacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718110_X_P-F Feature FT:CDS KP718110_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8728_HIV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaagatttatgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718111_X_P-F Feature FT:CDS KP718111_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8827_HIV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718112_X_P-F Feature FT:CDS KP718112_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-4910). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgtacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcacgttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718113_X_P-F Feature FT:CDS KP718113_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-3634). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactctcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995097_X_P-F Feature FT:CDS KP995097_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcgccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KP995098_X_P-F Feature FT:CDS KP995098_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995101_X_P-F Feature FT:CDS KP995101_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 63-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcatctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataaaaggactcttggacttttaggaaggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagacaaggttaaagatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995104_X_P-F Feature FT:CDS KP995104_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 81-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccttttttccgtctaccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggaatttgccaacagccttacataagaggactcttggactttcaggatggtcaatgacccg
gatcgatgaatacatcaaagactgtgtatttaaggactgggaggagttgggtcaggagagtaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995105_X_P-F Feature FT:CDS KP995105_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 134-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcctggag
accaccgtgaacaccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacccg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttggac
taggaggctggaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995106_X_P-F Feature FT:CDS KP995106_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 143-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaccaggttaatgacctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995107_X_P-F Feature FT:CDS KP995107_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 201-HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995109_X_P-F Feature FT:CDS KP995109_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995110_X_P-F Feature FT:CDS KP995110_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttacggactgggaggagttgggtgaggagactaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995111_X_P-F Feature FT:CDS KP995111_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 234-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995113_X_P-F Feature FT:CDS KP995113_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2351-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggatgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatcagccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995114_X_P-F Feature FT:CDS KP995114_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2369-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995115_X_P-F Feature FT:CDS KP995115_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2370-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgattggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcccacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995116_X_P-F Feature FT:CDS KP995116_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2503-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995117_X_P-F Feature FT:CDS KP995117_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2504-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995118_X_P-F Feature FT:CDS KP995118_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2517-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatatgccaacagtcttatataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttacggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995119_X_P-F Feature FT:CDS KP995119_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2524-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtatcgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995120_X_P-F Feature FT:CDS KP995120_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2579-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgcccacagtcttacataagaggactcttggactttcaggagggtcaatgccctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|KP995123_X_P-F Feature FT:CDS KP995123_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X10-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcccatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995124_X_P-F Feature FT:CDS KP995124_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X11-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995125_X_P-F Feature FT:CDS KP995125_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X13-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995126_X_P-F Feature FT:CDS KP995126_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X14-Chronic). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggaatgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT896494_X_P-F Feature FT:CDS KT896494_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MAN183). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatatatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX264496_X_P-F Feature FT:CDS KX264496_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1-ame). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX264497_X_P-F Feature FT:CDS KX264497_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F2-ame). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX264498_X_P-F Feature FT:CDS KX264498_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F3-ame). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX264499_X_P-F Feature FT:CDS KX264499_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4-ame). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX757665_X_P-F Feature FT:CDS KX757665_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate TH6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgtttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttsacctctgcctaa
>gnl|hbvcds|KY382411_X_P-F Feature FT:CDS KY382411_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_wt). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382415_X_P-F Feature FT:CDS KY382415_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_wt). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382416_X_P-F Feature FT:CDS KY382416_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_double_mut). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382417_X_P-F Feature FT:CDS KY382417_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_quadruple_mut). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY458061_X_P-F Feature FT:CDS KY458061_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY458062_X_P-F Feature FT:CDS KY458062_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476322_X_P-F Feature FT:CDS KY476322_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476323_X_P-F Feature FT:CDS KY476323_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476324_X_P-F Feature FT:CDS KY476324_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtactgccaactggatcctacgmgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476325_X_P-F Feature FT:CDS KY476325_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaagatcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476326_X_P-F Feature FT:CDS KY476326_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgccctctcttgcgtctgccgttccggccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476327_X_P-F Feature FT:CDS KY476327_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcagggaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476328_X_P-F Feature FT:CDS KY476328_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaagatcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476329_X_P-F Feature FT:CDS KY476329_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtgtcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagattacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtcggttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY476330_X_P-F Feature FT:CDS KY476330_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaaggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KY476331_X_P-F Feature FT:CDS KY476331_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccgcgaagcttgccaacagtcttacataagcggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KY476332_X_P-F Feature FT:CDS KY476332_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactttcaggaaggtcaatgacctg
gatcgaaggatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|MF593354_X_P-F Feature FT:CDS MF593354_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ31). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagccttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccascaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593356_X_P-F Feature FT:CDS MF593356_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ33). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtmggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593360_X_P-F Feature FT:CDS MF593360_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ37). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccascaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593367_X_P-F Feature FT:CDS MF593367_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ47). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtmggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593371_X_P-F Feature FT:CDS MF593371_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ53). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgacccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593376_X_P-F Feature FT:CDS MF593376_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ58). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtaggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF593380_X_P-F Feature FT:CDS MF593380_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ62). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaaraatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG001258_X_P-F Feature FT:CDS MG001258_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RI.98). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG001259_X_P-F Feature FT:CDS MG001259_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 33.1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttctcctctgcctaa
>gnl|hbvcds|MG098564_X_P-F Feature FT:CDS MG098564_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_050). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098565_X_P-F Feature FT:CDS MG098565_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_111). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggggctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggaccccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaaagtcaatgacctg
gatcgaagaatacatcccatactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098566_X_P-F Feature FT:CDS MG098566_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccccggagcttgccaacagtcttacataaacggactattggactttcgggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttacagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098569_X_P-F Feature FT:CDS MG098569_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctctyctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaaagtcaatgacctg
gatcgaagaatacatcactgactgtgtatttaaagactgggaggagttgggggaggagtccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|MG098570_X_P-F Feature FT:CDS MG098570_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_117). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcmggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098573_X_P-F Feature FT:CDS MG098573_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_121). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactttcaggacggtcaatgacctg
gatcgaagaatacatcacagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098574_X_P-F Feature FT:CDS MG098574_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaagrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098575_X_P-F Feature FT:CDS MG098575_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_123). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagagtgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098577_X_P-F Feature FT:CDS MG098577_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_125). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcaggaaggtcaatggcctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098578_X_P-F Feature FT:CDS MG098578_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgactacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcaggamrgtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098579_X_P-F Feature FT:CDS MG098579_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_127). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaaagtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098580_X_P-F Feature FT:CDS MG098580_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_128). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgacgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtcc
ttggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098582_X_P-F Feature FT:CDS MG098582_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_142). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttagggctctaccgccctcttctccgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttacagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098583_X_P-F Feature FT:CDS MG098583_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_146). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgccctcttctgcatctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|MG098584_X_P-F Feature FT:CDS MG098584_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate D42). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggggtctaccgccctcttctccgtctgccgttccttccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtctgccaacagtcttatataagaggactcttggactttcaggacggtcaatgacctg
gatcgaaraatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtcc
ttggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH051986_X_P-F Feature FT:CDS MH051986_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B106W). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH051987_X_P-F Feature FT:CDS MH051987_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B127W). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK058437_X_P-F Feature FT:CDS MK058437_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK808039_X_P-F Feature FT:CDS MK808039_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaaggtcaatcacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK808040_X_P-F Feature FT:CDS MK808040_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X69798_X_P-F Feature FT:CDS X69798_X_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactttcaggatggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X75658_X_C-F Feature FT:CDS X75658_X_C-F of [Viruses] Hepatitis B Virus genotype F (isolate Fou). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgaaccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggacggtcaatgacctg
gatcgaagaatacatcaaagactgtgtatttaaagactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X75663_X_P-F Feature FT:CDS X75663_X_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9203). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgaaccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaacgggtcgcacctct
ctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggacggtcaatgacctg
gatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
© 1998-2020Legal notice