HBVdb

Dataset for nucleotide sequence SP of genotype F

[Download (right click)] [Alignment] [Repertoires]

279 sequence(s)

>gnl|hbvcds|AB036905_SP_P-F Feature FT:CDS AB036905_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036909_SP_P-F Feature FT:CDS AB036909_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036910_SP_P-F Feature FT:CDS AB036910_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8251). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036911_SP_P-F Feature FT:CDS AB036911_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8255). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036912_SP_P-F Feature FT:CDS AB036912_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8323). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036913_SP_P-F Feature FT:CDS AB036913_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8346). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036914_SP_P-F Feature FT:CDS AB036914_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8349). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036915_SP_P-F Feature FT:CDS AB036915_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8351). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036916_SP_P-F Feature FT:CDS AB036916_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8371). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036917_SP_P-F Feature FT:CDS AB036917_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036918_SP_P-F Feature FT:CDS AB036918_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036919_SP_P-F Feature FT:CDS AB036919_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8381). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcmaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB036920_SP_P-F Feature FT:CDS AB036920_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8624). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB064316_SP_P-F Feature FT:CDS AB064316_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB086397_SP_P-F Feature FT:CDS AB086397_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate JPF1130). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgccgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB116549_SP_P-F Feature FT:CDS AB116549_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|AB116550_SP_P-F Feature FT:CDS AB116550_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|AB116551_SP_P-F Feature FT:CDS AB116551_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB116552_SP_P-F Feature FT:CDS AB116552_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB116654_SP_P-F Feature FT:CDS AB116654_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagactactgttgttagaggacgacgcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB166850_SP_P-F Feature FT:CDS AB166850_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL592). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccatacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB214516_SP_P-F Feature FT:CDS AB214516_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL597). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB365446_SP_P-F Feature FT:CDS AB365446_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB365449_SP_P-F Feature FT:CDS AB365449_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL93). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaacacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB365450_SP_P-F Feature FT:CDS AB365450_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL102). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctmtatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB365453_SP_P-F Feature FT:CDS AB365453_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL584). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttcctgaaactactgttgttagaccacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223962_SP_P-F Feature FT:CDS AF223962_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223963_SP_P-F Feature FT:CDS AF223963_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223964_SP_P-F Feature FT:CDS AF223964_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223965_SP_P-F Feature FT:CDS AF223965_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090455_SP_P-F Feature FT:CDS AY090455_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccaggttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090456_SP_P-F Feature FT:CDS AY090456_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccaccaccaccagcac
gggaccatgcagaacctgcacaactcttgctcaaggaacctctatgttaccctcctgctgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090458_SP_C-F Feature FT:CDS AY090458_SP_C-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090459_SP_P-F Feature FT:CDS AY090459_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090461_SP_P-F Feature FT:CDS AY090461_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY179735_SP_P-F Feature FT:CDS AY179735_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY311369_SP_P-F Feature FT:CDS AY311369_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD4139). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY311370_SP_P-F Feature FT:CDS AY311370_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cgtcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggcacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ776247_SP_P-F Feature FT:CDS DQ776247_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823086_SP_P-F Feature FT:CDS DQ823086_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823087_SP_P-F Feature FT:CDS DQ823087_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823088_SP_P-F Feature FT:CDS DQ823088_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823089_SP_P-F Feature FT:CDS DQ823089_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823090_SP_P-F Feature FT:CDS DQ823090_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823091_SP_P-F Feature FT:CDS DQ823091_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823092_SP_P-F Feature FT:CDS DQ823092_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823093_SP_P-F Feature FT:CDS DQ823093_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823094_SP_P-F Feature FT:CDS DQ823094_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ823095_SP_P-F Feature FT:CDS DQ823095_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ899142_SP_P-F Feature FT:CDS DQ899142_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao152). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ899143_SP_P-F Feature FT:CDS DQ899143_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao189). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ899144_SP_P-F Feature FT:CDS DQ899144_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ899145_SP_P-F Feature FT:CDS DQ899145_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ899146_SP_P-F Feature FT:CDS DQ899146_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira80). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcaatttactag
>gnl|hbvcds|DQ899147_SP_P-F Feature FT:CDS DQ899147_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaacgaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcaatttactag
>gnl|hbvcds|DQ899148_SP_P-F Feature FT:CDS DQ899148_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Yanomami114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ899149_SP_P-F Feature FT:CDS DQ899149_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Piaroa3019). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatggccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ899150_SP_P-F Feature FT:CDS DQ899150_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Colombia8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaattgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
aggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF576808_SP_P-F Feature FT:CDS EF576808_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccggcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF576812_SP_P-F Feature FT:CDS EF576812_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU366116_SP_P-F Feature FT:CDS EU366116_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU366118_SP_P-F Feature FT:CDS EU366118_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU366132_SP_P-F Feature FT:CDS EU366132_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA95). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU366133_SP_P-F Feature FT:CDS EU366133_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA96). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU670260_SP_P-F Feature FT:CDS EU670260_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 453). Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU670261_SP_P-F Feature FT:CDS EU670261_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 499). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaataatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU670262_SP_P-F Feature FT:CDS EU670262_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 549). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ589065_SP_P-F Feature FT:CDS FJ589065_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_024). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ589066_SP_P-F Feature FT:CDS FJ589066_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_054). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagaccacgaggcaggacccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgggtcgcagaagatctcaatctccatcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ589067_SP_P-F Feature FT:CDS FJ589067_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_083). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ657519_SP_P-F Feature FT:CDS FJ657519_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA110). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ657522_SP_P-F Feature FT:CDS FJ657522_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ657525_SP_P-F Feature FT:CDS FJ657525_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagaggacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacttctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ657528_SP_P-F Feature FT:CDS FJ657528_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA108). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ657529_SP_P-F Feature FT:CDS FJ657529_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709457_SP_P-F Feature FT:CDS FJ709457_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ709458_SP_P-F Feature FT:CDS FJ709458_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709459_SP_P-F Feature FT:CDS FJ709459_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709460_SP_P-F Feature FT:CDS FJ709460_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709462_SP_P-F Feature FT:CDS FJ709462_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ709463_SP_P-F Feature FT:CDS FJ709463_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709464_SP_P-F Feature FT:CDS FJ709464_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709465_SP_P-F Feature FT:CDS FJ709465_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ709494_SP_P-F Feature FT:CDS FJ709494_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HE981181_SP_P-F Feature FT:CDS HE981181_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HE981182_SP_P-F Feature FT:CDS HE981182_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HE981183_SP_P-F Feature FT:CDS HE981183_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585186_SP_P-F Feature FT:CDS HM585186_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585187_SP_P-F Feature FT:CDS HM585187_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585188_SP_P-F Feature FT:CDS HM585188_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585189_SP_P-F Feature FT:CDS HM585189_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585190_SP_P-F Feature FT:CDS HM585190_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585191_SP_P-F Feature FT:CDS HM585191_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585192_SP_P-F Feature FT:CDS HM585192_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585193_SP_P-F Feature FT:CDS HM585193_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585194_SP_P-F Feature FT:CDS HM585194_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585195_SP_P-F Feature FT:CDS HM585195_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585196_SP_P-F Feature FT:CDS HM585196_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585197_SP_P-F Feature FT:CDS HM585197_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585198_SP_P-F Feature FT:CDS HM585198_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585199_SP_P-F Feature FT:CDS HM585199_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM585200_SP_P-F Feature FT:CDS HM585200_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|HM590471_SP_P-F Feature FT:CDS HM590471_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM590472_SP_P-F Feature FT:CDS HM590472_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM590473_SP_P-F Feature FT:CDS HM590473_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM590474_SP_P-F Feature FT:CDS HM590474_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM622135_SP_P-F Feature FT:CDS HM622135_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaattactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM627320_SP_P-F Feature FT:CDS HM627320_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccytcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ378247_SP_P-F Feature FT:CDS HQ378247_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate IRL-2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF439884_SP_P-F Feature FT:CDS JF439884_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate ANG03G1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF439885_SP_P-F Feature FT:CDS JF439885_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate ANG03G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688691_SP_P-F Feature FT:CDS JN688691_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688699_SP_P-F Feature FT:CDS JN688699_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV133). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctngaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688701_SP_P-F Feature FT:CDS JN688701_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV135). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688703_SP_P-F Feature FT:CDS JN688703_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV137). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688709_SP_P-F Feature FT:CDS JN688709_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV143). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688720_SP_P-F Feature FT:CDS JN688720_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV224). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792914_SP_P-F Feature FT:CDS JN792914_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8052-03506). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792916_SP_P-F Feature FT:CDS JN792916_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7703-00047). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactcccacg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792917_SP_P-F Feature FT:CDS JN792917_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-05260). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792918_SP_P-F Feature FT:CDS JN792918_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-03547). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792919_SP_P-F Feature FT:CDS JN792919_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-13282). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792920_SP_P-F Feature FT:CDS JN792920_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-05424). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792921_SP_P-F Feature FT:CDS JN792921_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03738). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcytatccacacttccggaaactactattattagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccggcttcccgatgatccacgaccaccagcac
gggaccmtgcaaaacctgcacaactcttgcwcaaggaacctctatgtttccctcytgytgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792922_SP_P-F Feature FT:CDS JN792922_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03301). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccytcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN811655_SP_P-F Feature FT:CDS JN811655_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3Mg). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN811656_SP_P-F Feature FT:CDS JN811656_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ272888_SP_P-F Feature FT:CDS JQ272888_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgatccaccaccaccagcac
gggaccatgcaaracctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JX079936_SP_P-F Feature FT:CDS JX079936_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccaccttcccactgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX079937_SP_P-F Feature FT:CDS JX079937_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccstagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494394_SP_P-F Feature FT:CDS KC494394_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR12-NORTH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494395_SP_P-F Feature FT:CDS KC494395_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR11-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494396_SP_P-F Feature FT:CDS KC494396_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR10-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494397_SP_P-F Feature FT:CDS KC494397_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR9-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatggttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494398_SP_P-F Feature FT:CDS KC494398_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR8-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494399_SP_P-F Feature FT:CDS KC494399_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR7-CENTRAL). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494400_SP_P-F Feature FT:CDS KC494400_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR6-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaagttctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KC494401_SP_P-F Feature FT:CDS KC494401_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR5-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaccaggcaggtcccctagaaaaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KC494402_SP_P-F Feature FT:CDS KC494402_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR4-NORTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494403_SP_P-F Feature FT:CDS KC494403_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR3-NORTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494404_SP_P-F Feature FT:CDS KC494404_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR2-NORTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC494405_SP_P-F Feature FT:CDS KC494405_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR1-NORTHEAST). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF199901_SP_P-F Feature FT:CDS KF199901_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RVLA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgaaccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ586805_SP_P-F Feature FT:CDS KJ586805_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ586806_SP_P-F Feature FT:CDS KJ586806_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ586807_SP_P-F Feature FT:CDS KJ586807_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ586808_SP_P-F Feature FT:CDS KJ586808_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ638656_SP_P-F Feature FT:CDS KJ638656_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaacgactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccagaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ638657_SP_P-F Feature FT:CDS KJ638657_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT013). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactsttgctcaaggaacctctatgtttccctcttgctgctgttcmaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ638659_SP_P-F Feature FT:CDS KJ638659_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT025). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KJ638660_SP_P-F Feature FT:CDS KJ638660_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT030). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagtagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KJ638662_SP_P-F Feature FT:CDS KJ638662_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT040). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KJ638663_SP_P-F Feature FT:CDS KJ638663_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT047). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactgctgttgttagacgacgagtcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagattcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgttaccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgttcctcc
tggctcagtttactag
>gnl|hbvcds|KJ638664_SP_P-F Feature FT:CDS KJ638664_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT049). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaacaagggttattagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccattccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ676694_SP_P-F Feature FT:CDS KJ676694_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843163_SP_P-F Feature FT:CDS KJ843163_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag01). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843164_SP_P-F Feature FT:CDS KJ843164_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag02). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843167_SP_P-F Feature FT:CDS KJ843167_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccatgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843168_SP_P-F Feature FT:CDS KJ843168_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag06). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843169_SP_P-F Feature FT:CDS KJ843169_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag07). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactgctgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843170_SP_P-F Feature FT:CDS KJ843170_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag08). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgttgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843171_SP_P-F Feature FT:CDS KJ843171_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag09). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843174_SP_P-F Feature FT:CDS KJ843174_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843175_SP_P-F Feature FT:CDS KJ843175_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843176_SP_P-F Feature FT:CDS KJ843176_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843177_SP_P-F Feature FT:CDS KJ843177_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843178_SP_P-F Feature FT:CDS KJ843178_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843179_SP_P-F Feature FT:CDS KJ843179_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843180_SP_P-F Feature FT:CDS KJ843180_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843181_SP_P-F Feature FT:CDS KJ843181_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843185_SP_P-F Feature FT:CDS KJ843185_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcttcgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843189_SP_P-F Feature FT:CDS KJ843189_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843190_SP_P-F Feature FT:CDS KJ843190_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843191_SP_P-F Feature FT:CDS KJ843191_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaracgaagatctcaatcgccgcgtcgccgcaratctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843193_SP_P-F Feature FT:CDS KJ843193_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843194_SP_P-F Feature FT:CDS KJ843194_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843195_SP_P-F Feature FT:CDS KJ843195_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843196_SP_P-F Feature FT:CDS KJ843196_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843197_SP_P-F Feature FT:CDS KJ843197_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843198_SP_P-F Feature FT:CDS KJ843198_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843199_SP_P-F Feature FT:CDS KJ843199_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843200_SP_P-F Feature FT:CDS KJ843200_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843201_SP_P-F Feature FT:CDS KJ843201_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843202_SP_P-F Feature FT:CDS KJ843202_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843203_SP_P-F Feature FT:CDS KJ843203_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctctaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843204_SP_P-F Feature FT:CDS KJ843204_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843205_SP_P-F Feature FT:CDS KJ843205_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843206_SP_P-F Feature FT:CDS KJ843206_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843207_SP_P-F Feature FT:CDS KJ843207_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843208_SP_P-F Feature FT:CDS KJ843208_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843209_SP_P-F Feature FT:CDS KJ843209_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843210_SP_P-F Feature FT:CDS KJ843210_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843211_SP_P-F Feature FT:CDS KJ843211_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843212_SP_P-F Feature FT:CDS KJ843212_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843213_SP_P-F Feature FT:CDS KJ843213_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843219_SP_P-F Feature FT:CDS KJ843219_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr01). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843220_SP_P-F Feature FT:CDS KJ843220_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KJ843221_SP_P-F Feature FT:CDS KJ843221_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr04). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843222_SP_P-F Feature FT:CDS KJ843222_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843223_SP_P-F Feature FT:CDS KJ843223_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr06). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843224_SP_P-F Feature FT:CDS KJ843224_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr07). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843225_SP_P-F Feature FT:CDS KJ843225_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr08). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaattactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843226_SP_P-F Feature FT:CDS KJ843226_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr09). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaarcctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM233681_SP_P-F Feature FT:CDS KM233681_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM998715_SP_P-F Feature FT:CDS KM998715_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718103_SP_P-F Feature FT:CDS KP718103_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP718104_SP_P-F Feature FT:CDS KP718104_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CL0004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgttgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718106_SP_P-F Feature FT:CDS KP718106_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1650). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccratgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccrtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718107_SP_P-F Feature FT:CDS KP718107_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT097). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccytcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718109_SP_P-F Feature FT:CDS KP718109_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7555_HIV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718110_SP_P-F Feature FT:CDS KP718110_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8728_HIV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718111_SP_P-F Feature FT:CDS KP718111_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8827_HIV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtggggctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718112_SP_P-F Feature FT:CDS KP718112_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-4910). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP718113_SP_P-F Feature FT:CDS KP718113_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-3634). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgttgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995097_SP_P-F Feature FT:CDS KP995097_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaatgcttccggaagttgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995098_SP_P-F Feature FT:CDS KP995098_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995101_SP_P-F Feature FT:CDS KP995101_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 63-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagaggacgaggcagggcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtggcagaagatctcaatctccgtcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995104_SP_P-F Feature FT:CDS KP995104_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 81-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995105_SP_P-F Feature FT:CDS KP995105_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 134-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggcacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995106_SP_P-F Feature FT:CDS KP995106_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 143-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995107_SP_P-F Feature FT:CDS KP995107_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 201-HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP995109_SP_P-F Feature FT:CDS KP995109_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995110_SP_P-F Feature FT:CDS KP995110_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaagacctgcacagctcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995111_SP_P-F Feature FT:CDS KP995111_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 234-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccatgaccaccagcac
gggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995113_SP_P-F Feature FT:CDS KP995113_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2351-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995114_SP_P-F Feature FT:CDS KP995114_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2369-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995115_SP_P-F Feature FT:CDS KP995115_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2370-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccatcttcccgatgatccacgaccaccagcac
gggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccctcctgttgctgtaccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995116_SP_P-F Feature FT:CDS KP995116_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2503-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KP995117_SP_P-F Feature FT:CDS KP995117_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2504-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacacctcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP995118_SP_P-F Feature FT:CDS KP995118_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2517-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgttgctgttcaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttaggaaaattcctatggggttgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995119_SP_P-F Feature FT:CDS KP995119_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2524-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995120_SP_P-F Feature FT:CDS KP995120_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2579-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KP995123_SP_P-F Feature FT:CDS KP995123_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X10-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995124_SP_P-F Feature FT:CDS KP995124_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X11-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcagaacctgcacaactcttgctcaaggcacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995125_SP_P-F Feature FT:CDS KP995125_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X13-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995126_SP_P-F Feature FT:CDS KP995126_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X14-Chronic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcagaacctgcacaactcttgctcaaggcacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT896494_SP_P-F Feature FT:CDS KT896494_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MAN183). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctaaatctccatcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX264496_SP_P-F Feature FT:CDS KX264496_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1-ame). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX264497_SP_P-F Feature FT:CDS KX264497_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F2-ame). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX264498_SP_P-F Feature FT:CDS KX264498_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F3-ame). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX264499_SP_P-F Feature FT:CDS KX264499_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4-ame). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX757665_SP_P-F Feature FT:CDS KX757665_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate TH6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctmgaagaagaactccctcg
cctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgctgctgttccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KY382411_SP_P-F Feature FT:CDS KY382411_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_wt). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY382415_SP_P-F Feature FT:CDS KY382415_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_wt). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcascccgtttctcc
tggctcaktttactag
>gnl|hbvcds|KY382416_SP_P-F Feature FT:CDS KY382416_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_double_mut). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcascccgtttctcc
tggctcaktttactag
>gnl|hbvcds|KY382417_SP_P-F Feature FT:CDS KY382417_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_quadruple_mut). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcascccgtttctcc
tggctcaktttactag
>gnl|hbvcds|KY458061_SP_P-F Feature FT:CDS KY458061_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY458062_SP_P-F Feature FT:CDS KY458062_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476322_SP_P-F Feature FT:CDS KY476322_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV01). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476323_SP_P-F Feature FT:CDS KY476323_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476324_SP_P-F Feature FT:CDS KY476324_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgytgttcaaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476325_SP_P-F Feature FT:CDS KY476325_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476326_SP_P-F Feature FT:CDS KY476326_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactgctgttgttagaggacgaggcrggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaagaaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476327_SP_P-F Feature FT:CDS KY476327_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476328_SP_P-F Feature FT:CDS KY476328_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttrttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476329_SP_P-F Feature FT:CDS KY476329_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaagctactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476330_SP_P-F Feature FT:CDS KY476330_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccaggttcccgatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY476332_SP_P-F Feature FT:CDS KY476332_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098564_SP_P-F Feature FT:CDS MG098564_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_050). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccttatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatctcgggctttaggaaaatacctatgggagtgtgcctcagcccgtttctcc
tggctcattttactag
>gnl|hbvcds|MG098565_SP_P-F Feature FT:CDS MG098565_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_111). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098566_SP_P-F Feature FT:CDS MG098566_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcacacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcaacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|MG098569_SP_P-F Feature FT:CDS MG098569_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098570_SP_P-F Feature FT:CDS MG098570_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_117). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactggtgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccactgatctacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctaggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098573_SP_P-F Feature FT:CDS MG098573_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_121). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgaagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgaacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggaag
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098574_SP_P-F Feature FT:CDS MG098574_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacaaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggntttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098575_SP_P-F Feature FT:CDS MG098575_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_123). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacatcgaggcaggtccactagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtctcaaaagatctcaatctccagcttcccaatgatctacgaccaccaccac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcancccgtttctca
tggctcaatttactag
>gnl|hbvcds|MG098577_SP_P-F Feature FT:CDS MG098577_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_125). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgaaaacgaaggtctcaatcgccgcgtcgcaaaaaatctcaatctccagcttcccaatgatctacaaccaccagcac
gggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatctttggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tagctcattttactag
>gnl|hbvcds|MG098578_SP_P-F Feature FT:CDS MG098578_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcaaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098579_SP_P-F Feature FT:CDS MG098579_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_127). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaarttactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccactgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098580_SP_P-F Feature FT:CDS MG098580_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098582_SP_P-F Feature FT:CDS MG098582_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_142). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccttatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcggaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggacmatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttcmaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098583_SP_P-F Feature FT:CDS MG098583_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_146). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatctacgaccaccatcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaawtacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MG098584_SP_P-F Feature FT:CDS MG098584_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate D42). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctaaaacaagaactccctcg
cctcgcaracgaaggtctcaatcgccgcgccgcaaaagatctcaatctccagcttcccactgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH051986_SP_P-F Feature FT:CDS MH051986_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B106W). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH051987_SP_P-F Feature FT:CDS MH051987_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B127W). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctggcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK058437_SP_P-F Feature FT:CDS MK058437_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcttgctgctgttccaaaccctcggaag
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X69798_SP_P-F Feature FT:CDS X69798_SP_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X75658_SP_C-F Feature FT:CDS X75658_SP_C-F of [Viruses] Hepatitis B Virus genotype F (isolate Fou). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatctacgaccaccagcac
gggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X75663_SP_P-F Feature FT:CDS X75663_SP_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9203). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatccacgaccaccagcac
gggaccatgcaaaacctgcacagctcttgctcaaggaacctctatgtttccctcctgttgctgttccaaaccctcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
© 1998-2020Legal notice