HBVdb

Dataset for nucleotide sequence S of genotype F

[Download (right click)] [Alignment] [Repertoires]

577 sequence(s)

>gnl|hbvcds|AB036905_S_P-F Feature FT:CDS AB036905_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036906_S_P-F Feature FT:CDS AB036906_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-2). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaacaaacgggaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcct
gttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccactgt
ctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgttac
caattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036907_S_P-F Feature FT:CDS AB036907_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-2). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaacaaacgggaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcct
gttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccactgt
ctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgttac
caattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036908_S_P-F Feature FT:CDS AB036908_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8337). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaacaaacgggaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcct
gttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccactgt
ctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgttac
caattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036909_S_P-F Feature FT:CDS AB036909_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036910_S_P-F Feature FT:CDS AB036910_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8251). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036911_S_P-F Feature FT:CDS AB036911_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8255). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036912_S_P-F Feature FT:CDS AB036912_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8323). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036913_S_P-F Feature FT:CDS AB036913_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8346). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcgaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036914_S_P-F Feature FT:CDS AB036914_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8349). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036915_S_P-F Feature FT:CDS AB036915_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8351). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036916_S_P-F Feature FT:CDS AB036916_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8371). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036917_S_P-F Feature FT:CDS AB036917_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036918_S_P-F Feature FT:CDS AB036918_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036919_S_P-F Feature FT:CDS AB036919_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8381). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcmaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB036920_S_P-F Feature FT:CDS AB036920_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8624). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB037944_S_P-F Feature FT:CDS AB037944_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VnzHBS8375). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB037945_S_P-F Feature FT:CDS AB037945_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VnzHBS8349). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB037946_S_P-F Feature FT:CDS AB037946_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VnzHBS8624). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AB064316_S_P-F Feature FT:CDS AB064316_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB086397_S_P-F Feature FT:CDS AB086397_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate JPF1130). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacgtcaggactcctaggacccctgctcgtgttacaggcggcgtttttcttgttgataaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB116549_S_P-F Feature FT:CDS AB116549_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB116550_S_P-F Feature FT:CDS AB116550_S_P-F of [Viruses] Hepatitis B Virus genotype F. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctccgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB116551_S_P-F Feature FT:CDS AB116551_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB116552_S_P-F Feature FT:CDS AB116552_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AB116654_S_P-F Feature FT:CDS AB116654_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgggtgtcctggccaaaattcgc
tgtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttacac
tgctgttactaattttctgttatctgtgggtatccagttaa
>gnl|hbvcds|AB166850_S_P-F Feature FT:CDS AB166850_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL592). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AB214516_S_P-F Feature FT:CDS AB214516_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL597). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttaattatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AB365437_S_P-F Feature FT:CDS AB365437_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL113). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacaccacatcaggactccgaggacccctgctcgtgttacgggcggtgtgtttcttgttgacaaaaatccgcac
aatgccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctggtatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggagcatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacagaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttattagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
tgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AB365443_S_P-F Feature FT:CDS AB365443_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL584). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AB365444_S_P-F Feature FT:CDS AB365444_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL585). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggactacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctgtaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcytgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcactt
>gnl|hbvcds|AB365446_S_P-F Feature FT:CDS AB365446_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AB365449_S_P-F Feature FT:CDS AB365449_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL93). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttcttgtggacaaaaatcctcaa
aacaccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaacacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgtwcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AB365450_S_P-F Feature FT:CDS AB365450_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL102). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctmtatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagtyatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AB365453_S_P-F Feature FT:CDS AB365453_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL584). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AF043561_S_P-F Feature FT:CDS AF043561_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=675 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgtnnnctgtgggtatcc
>gnl|hbvcds|AF043573_S_P-F Feature FT:CDS AF043573_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF043577_S_P-F Feature FT:CDS AF043577_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF043578_S_P-F Feature FT:CDS AF043578_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF223962_S_P-F Feature FT:CDS AF223962_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AF223963_S_P-F Feature FT:CDS AF223963_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctccacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AF223964_S_P-F Feature FT:CDS AF223964_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AF223965_S_P-F Feature FT:CDS AF223965_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AF288623_S_P-F Feature FT:CDS AF288623_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA43). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggccttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF288624_S_P-F Feature FT:CDS AF288624_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA33). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcatgagtccctttatac
cgctgttaccaattntctgttacctgtgggtatccatt
>gnl|hbvcds|AF288625_S_P-F Feature FT:CDS AF288625_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA38). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcnncttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtagccatt
>gnl|hbvcds|AF288626_S_P-F Feature FT:CDS AF288626_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA36). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF288627_S_P-F Feature FT:CDS AF288627_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA40). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggacaacatcacatcaggactcctaggacccctgcacgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatt
>gnl|hbvcds|AF288628_S_P-F Feature FT:CDS AF288628_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=675 residues).
atggacaacatcacatcaggactcctaggccccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcc
>gnl|hbvcds|AY090455_S_P-F Feature FT:CDS AY090455_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcactttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY090456_S_P-F Feature FT:CDS AY090456_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccaccaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
taccctcctgctgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggcaaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccagttaa
>gnl|hbvcds|AY090458_S_C-F Feature FT:CDS AY090458_S_C-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY090459_S_P-F Feature FT:CDS AY090459_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY090461_S_P-F Feature FT:CDS AY090461_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY179735_S_P-F Feature FT:CDS AY179735_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264387_S_P-F Feature FT:CDS AY264387_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaaccggcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY264388_S_P-F Feature FT:CDS AY264388_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactaaccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264389_S_P-F Feature FT:CDS AY264389_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264390_S_P-F Feature FT:CDS AY264390_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagaccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264391_S_P-F Feature FT:CDS AY264391_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggctttcagctatatggatgatctggtattgggggccaaatctgtgcagcatcttgagaccctttatac
cgctgttaccaattttctgttatctgtgggtatccatctaa
>gnl|hbvcds|AY264392_S_P-F Feature FT:CDS AY264392_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264393_S_P-F Feature FT:CDS AY264393_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264394_S_P-F Feature FT:CDS AY264394_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264395_S_P-F Feature FT:CDS AY264395_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccactaccaccagcacgggaccatgcaaaacctgcacaactcctgctcaaagcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264396_S_P-F Feature FT:CDS AY264396_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaacccttggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattggggtcctaatctgtgcagcatcttgaggtcctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264397_S_P-F Feature FT:CDS AY264397_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacagccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264398_S_P-F Feature FT:CDS AY264398_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaacccttggacggaaactgcacctgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggctttcagctatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatctaa
>gnl|hbvcds|AY264399_S_P-F Feature FT:CDS AY264399_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264400_S_P-F Feature FT:CDS AY264400_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctaac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaga
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY264401_S_P-F Feature FT:CDS AY264401_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=672 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaacaaacggtaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctcct
gttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccactgt
ctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgttac
caattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|AY311347_S_P-F Feature FT:CDS AY311347_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD513). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggggcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY311355_S_P-F Feature FT:CDS AY311355_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14860). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
acggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttctggttgacaaaaatccgcaa
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311358_S_P-F Feature FT:CDS AY311358_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD17786). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtgggggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggcacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatctttggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cggtgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311360_S_P-F Feature FT:CDS AY311360_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD247276). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacatccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311361_S_P-F Feature FT:CDS AY311361_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD25021). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccgacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311362_S_P-F Feature FT:CDS AY311362_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD27855). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggactacccgagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311368_S_P-F Feature FT:CDS AY311368_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14654). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtgggggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctcaaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctagttggttcttctggactatcacggtatgttgcccgtttg
tcctctacttccaggatccacgaccacaagcacgggaccatgcaaaacctgcacagctcttgctcaaggaacctctatgg
ttccctcctggtgctataccaaaccctcggacagaaactgcacctgtattcccatcccatcacattgggctttaggaaaa
tccctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttaattacatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaactttctgttatctgtgggtatacatttaa
>gnl|hbvcds|AY311369_S_P-F Feature FT:CDS AY311369_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD4139). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY311370_S_P-F Feature FT:CDS AY311370_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14999). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggggtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|AY739216_S_P-F Feature FT:CDS AY739216_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgacaaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccaccgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|AY739217_S_P-F Feature FT:CDS AY739217_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaa
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgtccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaagtcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaacctgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ131124_S_P-F Feature FT:CDS DQ131124_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate M-F). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ131127_S_P-F Feature FT:CDS DQ131127_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate S-Fmut). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagcttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgcagttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ131128_S_P-F Feature FT:CDS DQ131128_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate S-Fwt). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ403173_S_P-F Feature FT:CDS DQ403173_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate S04007150). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgacctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ403174_S_P-F Feature FT:CDS DQ403174_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate S04007356). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgacctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ403175_S_P-F Feature FT:CDS DQ403175_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate s05024567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgacctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ776247_S_P-F Feature FT:CDS DQ776247_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|DQ823086_S_P-F Feature FT:CDS DQ823086_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|DQ823087_S_P-F Feature FT:CDS DQ823087_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|DQ823088_S_P-F Feature FT:CDS DQ823088_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|DQ823089_S_P-F Feature FT:CDS DQ823089_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ823090_S_P-F Feature FT:CDS DQ823090_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|DQ823091_S_P-F Feature FT:CDS DQ823091_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ823092_S_P-F Feature FT:CDS DQ823092_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ823093_S_P-F Feature FT:CDS DQ823093_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ823094_S_P-F Feature FT:CDS DQ823094_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ823095_S_P-F Feature FT:CDS DQ823095_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899142_S_P-F Feature FT:CDS DQ899142_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao152). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899143_S_P-F Feature FT:CDS DQ899143_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao189). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899144_S_P-F Feature FT:CDS DQ899144_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira75). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899145_S_P-F Feature FT:CDS DQ899145_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira76). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899146_S_P-F Feature FT:CDS DQ899146_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira80). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgccgcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899147_S_P-F Feature FT:CDS DQ899147_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgcaatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaacgaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899148_S_P-F Feature FT:CDS DQ899148_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Yanomami114). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|DQ899149_S_P-F Feature FT:CDS DQ899149_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Piaroa3019). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctttgggtatccatttaa
>gnl|hbvcds|DQ899150_S_P-F Feature FT:CDS DQ899150_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Colombia8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacaggaccatgcaagacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatcggtgggtatccatttaa
>gnl|hbvcds|EF397981_S_P-F Feature FT:CDS EF397981_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bucaramanga 11). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397982_S_P-F Feature FT:CDS EF397982_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bucaramanga 14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggtctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397983_S_P-F Feature FT:CDS EF397983_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397984_S_P-F Feature FT:CDS EF397984_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 33). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttactaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397985_S_P-F Feature FT:CDS EF397985_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 36). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397986_S_P-F Feature FT:CDS EF397986_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 63). Partial genome (Contains: HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctgtctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397987_S_P-F Feature FT:CDS EF397987_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 67). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatccggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctactggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397989_S_P-F Feature FT:CDS EF397989_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 70). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF397990_S_P-F Feature FT:CDS EF397990_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Bogota 72). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF398029_S_P-F Feature FT:CDS EF398029_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398030_S_P-F Feature FT:CDS EF398030_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 27). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398031_S_P-F Feature FT:CDS EF398031_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 29). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398032_S_P-F Feature FT:CDS EF398032_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 32). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398033_S_P-F Feature FT:CDS EF398033_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 55). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398034_S_P-F Feature FT:CDS EF398034_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 60). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgtcacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398035_S_P-F Feature FT:CDS EF398035_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 66). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398037_S_P-F Feature FT:CDS EF398037_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 82). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctactttcaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398038_S_P-F Feature FT:CDS EF398038_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 85). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398039_S_P-F Feature FT:CDS EF398039_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 94). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398040_S_P-F Feature FT:CDS EF398040_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 139). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|EF398041_S_P-F Feature FT:CDS EF398041_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira 121). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF576808_S_P-F Feature FT:CDS EF576808_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggactacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcgtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|EF576812_S_P-F Feature FT:CDS EF576812_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|EF690470_S_P-F Feature FT:CDS EF690470_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 325-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690484_S_P-F Feature FT:CDS EF690484_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 211-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690485_S_P-F Feature FT:CDS EF690485_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 321-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcaatttaa
>gnl|hbvcds|EF690486_S_P-F Feature FT:CDS EF690486_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 323-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcaatttaa
>gnl|hbvcds|EF690487_S_P-F Feature FT:CDS EF690487_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate apurina_01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaattgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690488_S_P-F Feature FT:CDS EF690488_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate apurina_02). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaattgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690489_S_P-F Feature FT:CDS EF690489_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate apurina_03). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaattgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690490_S_P-F Feature FT:CDS EF690490_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate apurina_04). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaattgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690491_S_P-F Feature FT:CDS EF690491_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate apurina_05). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaattgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690492_S_P-F Feature FT:CDS EF690492_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 213-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690493_S_P-F Feature FT:CDS EF690493_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 324-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690494_S_P-F Feature FT:CDS EF690494_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 222-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690495_S_P-F Feature FT:CDS EF690495_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690496_S_P-F Feature FT:CDS EF690496_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 016-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690497_S_P-F Feature FT:CDS EF690497_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 058-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690498_S_P-F Feature FT:CDS EF690498_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 002-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690499_S_P-F Feature FT:CDS EF690499_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 003-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690500_S_P-F Feature FT:CDS EF690500_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 004-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690501_S_P-F Feature FT:CDS EF690501_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 307-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690502_S_P-F Feature FT:CDS EF690502_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 238-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690503_S_P-F Feature FT:CDS EF690503_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 327-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690504_S_P-F Feature FT:CDS EF690504_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 313-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690505_S_P-F Feature FT:CDS EF690505_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 023-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatctttttaa
>gnl|hbvcds|EF690506_S_P-F Feature FT:CDS EF690506_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 227-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690507_S_P-F Feature FT:CDS EF690507_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 210-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttacatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690508_S_P-F Feature FT:CDS EF690508_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 052-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcgcaattttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccatcacgggaccctgcaaaacctgcacaactattgcacaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690509_S_P-F Feature FT:CDS EF690509_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 322-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggtctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacgtccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcatttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690510_S_P-F Feature FT:CDS EF690510_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aacaccacagagtctagactcgtggtggacttctctcaattttctaggggaactacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcgatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatattgatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690511_S_P-F Feature FT:CDS EF690511_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 179-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690512_S_P-F Feature FT:CDS EF690512_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 326-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcaatttaa
>gnl|hbvcds|EF690513_S_P-F Feature FT:CDS EF690513_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 221-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EF690514_S_P-F Feature FT:CDS EF690514_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 232-NE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU159674_S_P-F Feature FT:CDS EU159674_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Irish-18). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgttctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU366116_S_P-F Feature FT:CDS EU366116_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|EU366118_S_P-F Feature FT:CDS EU366118_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU366132_S_P-F Feature FT:CDS EU366132_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA95). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaagacccctgctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcac
aattccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctctaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccattgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|EU366133_S_P-F Feature FT:CDS EU366133_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA96). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU670260_S_P-F Feature FT:CDS EU670260_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 453). Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgcacgtgtcacaggcggtgtgttccttgttgacaaaaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU670261_S_P-F Feature FT:CDS EU670261_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 499). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcccaggacccctgctcgtgtcacaggcggtgtgttcctcgttgacaaaaatcctcac
aataccaaagaggctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccagaatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|EU670262_S_P-F Feature FT:CDS EU670262_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 549). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ589065_S_P-F Feature FT:CDS FJ589065_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_024). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccmgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ589066_S_P-F Feature FT:CDS FJ589066_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_054). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcaccttgaggccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ589067_S_P-F Feature FT:CDS FJ589067_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_083). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagaatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ589070_S_P-F Feature FT:CDS FJ589070_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgctatctgtgggtatccatttaa
>gnl|hbvcds|FJ657519_S_P-F Feature FT:CDS FJ657519_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA110). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|FJ657522_S_P-F Feature FT:CDS FJ657522_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|FJ657525_S_P-F Feature FT:CDS FJ657525_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA107). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcagttttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacttctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ657528_S_P-F Feature FT:CDS FJ657528_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA108). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|FJ657529_S_P-F Feature FT:CDS FJ657529_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA109). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709457_S_P-F Feature FT:CDS FJ709457_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709458_S_P-F Feature FT:CDS FJ709458_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709459_S_P-F Feature FT:CDS FJ709459_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709460_S_P-F Feature FT:CDS FJ709460_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709461_S_P-F Feature FT:CDS FJ709461_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709462_S_P-F Feature FT:CDS FJ709462_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709463_S_P-F Feature FT:CDS FJ709463_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttakac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709464_S_P-F Feature FT:CDS FJ709464_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709465_S_P-F Feature FT:CDS FJ709465_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709466_S_P-F Feature FT:CDS FJ709466_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aatgccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtggaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709468_S_P-F Feature FT:CDS FJ709468_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgggcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709469_S_P-F Feature FT:CDS FJ709469_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggaacasccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccacttaa
>gnl|hbvcds|FJ709473_S_P-F Feature FT:CDS FJ709473_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttccttgttgataaaaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709476_S_P-F Feature FT:CDS FJ709476_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709478_S_P-F Feature FT:CDS FJ709478_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttccttgttgataaaaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709480_S_P-F Feature FT:CDS FJ709480_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgttccttgttgacaaaaatcctcac
aataccacagagkctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709481_S_P-F Feature FT:CDS FJ709481_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709482_S_P-F Feature FT:CDS FJ709482_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI26). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggcaaaatctgtgcmgcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709484_S_P-F Feature FT:CDS FJ709484_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709485_S_P-F Feature FT:CDS FJ709485_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI31). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatcgatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709487_S_P-F Feature FT:CDS FJ709487_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI34). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709488_S_P-F Feature FT:CDS FJ709488_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI35). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709491_S_P-F Feature FT:CDS FJ709491_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI38). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709493_S_P-F Feature FT:CDS FJ709493_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI40). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709494_S_P-F Feature FT:CDS FJ709494_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI41). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709495_S_P-F Feature FT:CDS FJ709495_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI42). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|FJ709496_S_P-F Feature FT:CDS FJ709496_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI43). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486140_S_P-F Feature FT:CDS GQ486140_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcac
aatrccamagagtctagactcgtggtggacttctctcaattttctaggggractacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccytcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagwccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|GQ486468_S_P-F Feature FT:CDS GQ486468_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS433). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486493_S_P-F Feature FT:CDS GQ486493_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS458). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtggggctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486515_S_P-F Feature FT:CDS GQ486515_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS480). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggwctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggwatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtwccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|GQ486537_S_P-F Feature FT:CDS GQ486537_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS502). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486570_S_P-F Feature FT:CDS GQ486570_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS535). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccatgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486582_S_P-F Feature FT:CDS GQ486582_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS547). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486626_S_P-F Feature FT:CDS GQ486626_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS591). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggwctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtwccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|GQ486779_S_P-F Feature FT:CDS GQ486779_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS744). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcctaccagagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaycttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggracctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|GQ486830_S_P-F Feature FT:CDS GQ486830_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GS795). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccamagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccracttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggktcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcrtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggctttyagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttwccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|HE981181_S_P-F Feature FT:CDS HE981181_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|HE981182_S_P-F Feature FT:CDS HE981182_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HE981183_S_P-F Feature FT:CDS HE981183_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM101096_S_P-F Feature FT:CDS HM101096_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 36_HBVpv_1300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggctttcagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM101097_S_P-F Feature FT:CDS HM101097_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 17_HBVpv_1300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM101098_S_P-F Feature FT:CDS HM101098_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 18_HBVpv_1300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM101125_S_P-F Feature FT:CDS HM101125_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 02_HBVpv_1300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgcttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM101130_S_P-F Feature FT:CDS HM101130_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 11_HBVpv_1300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467760_S_P-F Feature FT:CDS HM467760_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1015_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcgcaattttctaggggacctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtggggctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467761_S_P-F Feature FT:CDS HM467761_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1021_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467762_S_P-F Feature FT:CDS HM467762_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1022_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtggggctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467771_S_P-F Feature FT:CDS HM467771_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1106_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcatatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467772_S_P-F Feature FT:CDS HM467772_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1107_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467783_S_P-F Feature FT:CDS HM467783_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1147_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467784_S_P-F Feature FT:CDS HM467784_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1148_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggaccacacgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467785_S_P-F Feature FT:CDS HM467785_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1149_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM467786_S_P-F Feature FT:CDS HM467786_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1151_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgagtgtcctggccaaaattcgc
agtccccaacctccaatcacttactaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585186_S_P-F Feature FT:CDS HM585186_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585187_S_P-F Feature FT:CDS HM585187_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585188_S_P-F Feature FT:CDS HM585188_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585189_S_P-F Feature FT:CDS HM585189_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585190_S_P-F Feature FT:CDS HM585190_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585191_S_P-F Feature FT:CDS HM585191_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585192_S_P-F Feature FT:CDS HM585192_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585193_S_P-F Feature FT:CDS HM585193_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585194_S_P-F Feature FT:CDS HM585194_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585195_S_P-F Feature FT:CDS HM585195_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585196_S_P-F Feature FT:CDS HM585196_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585197_S_P-F Feature FT:CDS HM585197_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585198_S_P-F Feature FT:CDS HM585198_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585199_S_P-F Feature FT:CDS HM585199_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM585200_S_P-F Feature FT:CDS HM585200_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM590471_S_P-F Feature FT:CDS HM590471_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM590472_S_P-F Feature FT:CDS HM590472_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM590473_S_P-F Feature FT:CDS HM590473_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM590474_S_P-F Feature FT:CDS HM590474_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH3). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactattaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaattcgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaatttgctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM622135_S_P-F Feature FT:CDS HM622135_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggacacctaggacccctgctcgtgttacaggcggtgtgttccttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HM627320_S_P-F Feature FT:CDS HM627320_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|HQ378247_S_P-F Feature FT:CDS HQ378247_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate IRL-2009). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JF439884_S_P-F Feature FT:CDS JF439884_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate ANG03G1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatcggtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JF439885_S_P-F Feature FT:CDS JF439885_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate ANG03G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatcggtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN226078_S_P-F Feature FT:CDS JN226078_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PTV709_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN604198_S_P-F Feature FT:CDS JN604198_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 477-4319-2). Partial genome (Contains: HBe, HBc, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
tgtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttagtagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN604201_S_P-F Feature FT:CDS JN604201_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 478-2026-3). Partial genome (Contains: HBe, HBc, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatccggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctattcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggyctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN604211_S_P-F Feature FT:CDS JN604211_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 476-7401-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccamagartctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|JN604225_S_P-F Feature FT:CDS JN604225_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 477-5408-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccgacttgtcctggctatcgctggatgtctctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacractcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggctaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN604233_S_P-F Feature FT:CDS JN604233_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 478-0355-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccaccacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
ctctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN604271_S_P-F Feature FT:CDS JN604271_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 476-8502-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN688691_S_P-F Feature FT:CDS JN688691_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV122). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN688699_S_P-F Feature FT:CDS JN688699_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV133). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN688701_S_P-F Feature FT:CDS JN688701_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV135). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgytgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|JN688703_S_P-F Feature FT:CDS JN688703_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV137). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN688709_S_P-F Feature FT:CDS JN688709_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV143). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacagggggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|JN688720_S_P-F Feature FT:CDS JN688720_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV224). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttctcgttgataaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|JN792914_S_P-F Feature FT:CDS JN792914_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8052-03506). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792916_S_P-F Feature FT:CDS JN792916_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7703-00047). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792917_S_P-F Feature FT:CDS JN792917_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-05260). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagcttcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792918_S_P-F Feature FT:CDS JN792918_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-03547). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792919_S_P-F Feature FT:CDS JN792919_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-13282). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792920_S_P-F Feature FT:CDS JN792920_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-05424). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792921_S_P-F Feature FT:CDS JN792921_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03738). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggamyacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgytggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatccacgaccaccagcacgggaccmtgcaaaacctgcacaactcttgcwcaaggaacctctatgt
ttccctcytgytgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtmgggctttc
ccccactgtytggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN792922_S_P-F Feature FT:CDS JN792922_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03301). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN811655_S_P-F Feature FT:CDS JN811655_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3Mg). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcgtgagtccctttatac
cgctgttaccaattttctgctatctgtgggtatccatttga
>gnl|hbvcds|JN811656_S_P-F Feature FT:CDS JN811656_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatcaatttga
>gnl|hbvcds|JN983942_S_P-F Feature FT:CDS JN983942_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8069). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN983943_S_P-F Feature FT:CDS JN983943_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8087). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcaacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN983944_S_P-F Feature FT:CDS JN983944_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8089). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcaa
aataccacagaatctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN983945_S_P-F Feature FT:CDS JN983945_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8093). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtcttccttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN983946_S_P-F Feature FT:CDS JN983946_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8125). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JN983947_S_P-F Feature FT:CDS JN983947_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8128). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgtcgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JQ272888_S_P-F Feature FT:CDS JQ272888_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccaccaccaccagcacgggaccatgcaaracctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|JX079936_S_P-F Feature FT:CDS JX079936_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JX079937_S_P-F Feature FT:CDS JX079937_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctcttatctgtgggtatccatttga
>gnl|hbvcds|JX849588_S_P-F Feature FT:CDS JX849588_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PTV709_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JX849635_S_P-F Feature FT:CDS JX849635_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PTV069). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcartttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|JX849637_S_P-F Feature FT:CDS JX849637_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 355_F). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113364_S_P-F Feature FT:CDS KC113364_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI07). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113368_S_P-F Feature FT:CDS KC113368_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI55-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcactttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113381_S_P-F Feature FT:CDS KC113381_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI239-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaaccggcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KC113383_S_P-F Feature FT:CDS KC113383_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI291-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccaccaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
taccctcctgctgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggcaaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccagttaa
>gnl|hbvcds|KC113386_S_P-F Feature FT:CDS KC113386_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI349-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113389_S_P-F Feature FT:CDS KC113389_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI390-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagaccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113393_S_P-F Feature FT:CDS KC113393_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI459-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113394_S_P-F Feature FT:CDS KC113394_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI481-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113395_S_P-F Feature FT:CDS KC113395_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI501-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113399_S_P-F Feature FT:CDS KC113399_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI642-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacagccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC113400_S_P-F Feature FT:CDS KC113400_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PI650-HBVHIV). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494394_S_P-F Feature FT:CDS KC494394_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR12-NORTH). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494395_S_P-F Feature FT:CDS KC494395_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR11-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494396_S_P-F Feature FT:CDS KC494396_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR10-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacatgcggtgtgtttcttgttgacaaaaatcctcac
aatgccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494397_S_P-F Feature FT:CDS KC494397_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR9-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacacttactcaggactcctaagacccctgctcgtgtcacaggcggtgtgttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgg
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494398_S_P-F Feature FT:CDS KC494398_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR8-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KC494399_S_P-F Feature FT:CDS KC494399_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR7-CENTRAL). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttcttgttgataaaaatcctcat
aatgccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494400_S_P-F Feature FT:CDS KC494400_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR6-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacaaagtctagactcgtggtggacttctctcaattttctagggcgaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494401_S_P-F Feature FT:CDS KC494401_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR5-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494402_S_P-F Feature FT:CDS KC494402_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR4-NORTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494403_S_P-F Feature FT:CDS KC494403_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR3-NORTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494404_S_P-F Feature FT:CDS KC494404_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR2-NORTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KC494405_S_P-F Feature FT:CDS KC494405_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR1-NORTHEAST). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF199901_S_P-F Feature FT:CDS KF199901_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RVLA). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaaccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414649_S_P-F Feature FT:CDS KF414649_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B412). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414650_S_P-F Feature FT:CDS KF414650_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B413). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtttgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414654_S_P-F Feature FT:CDS KF414654_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2106). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaatacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414655_S_P-F Feature FT:CDS KF414655_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414656_S_P-F Feature FT:CDS KF414656_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2176). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaacatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
attatcttcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggattgggcctcagcccgtttcccatggctcagttcactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414657_S_P-F Feature FT:CDS KF414657_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2245). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttaccggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctgactcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414658_S_P-F Feature FT:CDS KF414658_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2292). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414659_S_P-F Feature FT:CDS KF414659_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2337). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414661_S_P-F Feature FT:CDS KF414661_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2503). Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgacctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctggtatctgtgggtatccatttaa
>gnl|hbvcds|KF414662_S_P-F Feature FT:CDS KF414662_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B2517). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcacggtatattgcccgtttg
tcctctaattccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
ttcctatggggttgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagagctttc
ccccactgtctggcttttagttatattgatgatctggtattgggggccaaatctgtgcagcatcttgagtcactttatac
cgctgttaccaattttctggtatctgtgggtatacatttaa
>gnl|hbvcds|KF414664_S_P-F Feature FT:CDS KF414664_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B70r). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggcacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggttttgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttctgttatctctgggtatccatttaa
>gnl|hbvcds|KF414666_S_P-F Feature FT:CDS KF414666_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B112r). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414669_S_P-F Feature FT:CDS KF414669_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B140r). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgttgctgttccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414670_S_P-F Feature FT:CDS KF414670_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B159r). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggaaggaaattgcacctgtattcccatcccatcgtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtcttgcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414671_S_P-F Feature FT:CDS KF414671_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B233). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaccctctatgt
ttccctcttgctgctgttccaaacccttggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414672_S_P-F Feature FT:CDS KF414672_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B266). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcagaacctgcacaactcctgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414673_S_P-F Feature FT:CDS KF414673_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B409). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414674_S_P-F Feature FT:CDS KF414674_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B1528). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=674 residues).
acatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacca
cagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgcagtcccc
aacctccaatcacttactaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatct
tcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctcta
cttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccctc
ctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaatacctat
gggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccact
gtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcatcaccttgagtccctttataccgctgtt
accaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414675_S_P-F Feature FT:CDS KF414675_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B1646). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KF414676_S_P-F Feature FT:CDS KF414676_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B1788). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF414677_S_P-F Feature FT:CDS KF414677_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B1807). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KF779236_S_P-F Feature FT:CDS KF779236_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate DEN6107). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ586805_S_P-F Feature FT:CDS KJ586805_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ586806_S_P-F Feature FT:CDS KJ586806_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ586807_S_P-F Feature FT:CDS KJ586807_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctaaactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatgc
ctctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ586808_S_P-F Feature FT:CDS KJ586808_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacaaagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ638656_S_P-F Feature FT:CDS KJ638656_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacaccacatcaggacacctaggactcctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaa
aataccacagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccagaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgggcagcatcttgagtcactttatac
cgctgttaccaattttctgttatctgtggggatccatttaa
>gnl|hbvcds|KJ638657_S_P-F Feature FT:CDS KJ638657_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT013). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacrgagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactsttgctcaaggaacctctatgt
ttccctcttgctgctgttcmaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ638659_S_P-F Feature FT:CDS KJ638659_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT025). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgayaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ638660_S_P-F Feature FT:CDS KJ638660_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT030). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaawctgtgcmgcatcttgagtccctttatac
cgctgttaccaattttctgttatctttgggtatccatttaa
>gnl|hbvcds|KJ638662_S_P-F Feature FT:CDS KJ638662_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT040). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctcgcaattttctaggggaaatacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctttgggtatccatttaa
>gnl|hbvcds|KJ638663_S_P-F Feature FT:CDS KJ638663_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT047). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
agggacaacaccacatccggacacctagaacccctgcccgtgttacagggggtgttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccgacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
taccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgttcctcctggctcagtttactagtgcaatttgtwcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtacaccatctagagtccctttatac
cgctgttaccaattttctgttatcggtgggtatccatttaa
>gnl|hbvcds|KJ638664_S_P-F Feature FT:CDS KJ638664_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT049). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccattccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctattaccaattttctgttatctctgggcatccatttaa
>gnl|hbvcds|KJ676694_S_P-F Feature FT:CDS KJ676694_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtattacaggcggtgtctttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctcggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843163_S_P-F Feature FT:CDS KJ843163_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843164_S_P-F Feature FT:CDS KJ843164_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag02). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843167_S_P-F Feature FT:CDS KJ843167_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag05). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccatgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843168_S_P-F Feature FT:CDS KJ843168_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag06). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843169_S_P-F Feature FT:CDS KJ843169_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag07). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843170_S_P-F Feature FT:CDS KJ843170_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag08). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgttgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843171_S_P-F Feature FT:CDS KJ843171_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag09). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843174_S_P-F Feature FT:CDS KJ843174_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843175_S_P-F Feature FT:CDS KJ843175_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843176_S_P-F Feature FT:CDS KJ843176_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843177_S_P-F Feature FT:CDS KJ843177_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843178_S_P-F Feature FT:CDS KJ843178_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843179_S_P-F Feature FT:CDS KJ843179_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843180_S_P-F Feature FT:CDS KJ843180_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843181_S_P-F Feature FT:CDS KJ843181_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843185_S_P-F Feature FT:CDS KJ843185_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843189_S_P-F Feature FT:CDS KJ843189_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843190_S_P-F Feature FT:CDS KJ843190_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843191_S_P-F Feature FT:CDS KJ843191_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843193_S_P-F Feature FT:CDS KJ843193_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843194_S_P-F Feature FT:CDS KJ843194_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843195_S_P-F Feature FT:CDS KJ843195_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843196_S_P-F Feature FT:CDS KJ843196_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843197_S_P-F Feature FT:CDS KJ843197_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag36). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843198_S_P-F Feature FT:CDS KJ843198_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843199_S_P-F Feature FT:CDS KJ843199_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag38). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843200_S_P-F Feature FT:CDS KJ843200_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843201_S_P-F Feature FT:CDS KJ843201_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag41). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843202_S_P-F Feature FT:CDS KJ843202_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag42). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagagctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843203_S_P-F Feature FT:CDS KJ843203_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag43). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctctaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843204_S_P-F Feature FT:CDS KJ843204_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843205_S_P-F Feature FT:CDS KJ843205_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag45). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843206_S_P-F Feature FT:CDS KJ843206_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag46). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KJ843207_S_P-F Feature FT:CDS KJ843207_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag47). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843208_S_P-F Feature FT:CDS KJ843208_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag48). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843209_S_P-F Feature FT:CDS KJ843209_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag49). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843210_S_P-F Feature FT:CDS KJ843210_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag50). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843211_S_P-F Feature FT:CDS KJ843211_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843212_S_P-F Feature FT:CDS KJ843212_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag52). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843213_S_P-F Feature FT:CDS KJ843213_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag53). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843219_S_P-F Feature FT:CDS KJ843219_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843220_S_P-F Feature FT:CDS KJ843220_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843221_S_P-F Feature FT:CDS KJ843221_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr04). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843222_S_P-F Feature FT:CDS KJ843222_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr05). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843223_S_P-F Feature FT:CDS KJ843223_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr06). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccaattga
>gnl|hbvcds|KJ843224_S_P-F Feature FT:CDS KJ843224_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr07). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843225_S_P-F Feature FT:CDS KJ843225_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr08). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttcttgttgataaaaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KJ843226_S_P-F Feature FT:CDS KJ843226_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr09). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaarcctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KM233681_S_P-F Feature FT:CDS KM233681_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KM998715_S_P-F Feature FT:CDS KM998715_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718103_S_P-F Feature FT:CDS KP718103_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1214). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718104_S_P-F Feature FT:CDS KP718104_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CL0004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718106_S_P-F Feature FT:CDS KP718106_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1650). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccrtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctttgggtatccatttaa
>gnl|hbvcds|KP718107_S_P-F Feature FT:CDS KP718107_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT097). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttacyaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718109_S_P-F Feature FT:CDS KP718109_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7555_HIV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718110_S_P-F Feature FT:CDS KP718110_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8728_HIV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttactaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718111_S_P-F Feature FT:CDS KP718111_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8827_HIV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtggggctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718112_S_P-F Feature FT:CDS KP718112_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-4910). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP718113_S_P-F Feature FT:CDS KP718113_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-3634). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995085_S_P-F Feature FT:CDS KP995085_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 95-Chronic). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggactgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995086_S_P-F Feature FT:CDS KP995086_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 465-Cirrhosis). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995087_S_P-F Feature FT:CDS KP995087_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2515-Chronic). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctggtatctgtgggtatccatttaa
>gnl|hbvcds|KP995089_S_P-F Feature FT:CDS KP995089_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3009-HCC). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KP995090_S_P-F Feature FT:CDS KP995090_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 10958-HCC). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KP995097_S_P-F Feature FT:CDS KP995097_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aatgccacagagtctagacttgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995098_S_P-F Feature FT:CDS KP995098_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995101_S_P-F Feature FT:CDS KP995101_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 63-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995104_S_P-F Feature FT:CDS KP995104_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 81-Cirrhosis). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995105_S_P-F Feature FT:CDS KP995105_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 134-Cirrhosis). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatctaa
>gnl|hbvcds|KP995106_S_P-F Feature FT:CDS KP995106_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 143-Cirrhosis). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995107_S_P-F Feature FT:CDS KP995107_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 201-HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacaccacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995109_S_P-F Feature FT:CDS KP995109_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-Cirrhosis). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995110_S_P-F Feature FT:CDS KP995110_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaagacctgcacagctcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995111_S_P-F Feature FT:CDS KP995111_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 234-Cirrhosis). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactcccaaggtatgttgcccgtttg
tcctctacttccaggatccatgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctttggggatccatttaa
>gnl|hbvcds|KP995113_S_P-F Feature FT:CDS KP995113_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2351-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaaaactcctaggacccctgctcgtgttacagggggtgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccatttatac
cgctgtttctaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995114_S_P-F Feature FT:CDS KP995114_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2369-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaagacccctgctcgtgttacaggcggtgtctttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggacgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgcttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccattgtttggcttttagctatatggatgatctggtattgggggccaaatctgttcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtgtccatttaa
>gnl|hbvcds|KP995115_S_P-F Feature FT:CDS KP995115_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2370-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995116_S_P-F Feature FT:CDS KP995116_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2503-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctggtatctgtgggtatccatttaa
>gnl|hbvcds|KP995117_S_P-F Feature FT:CDS KP995117_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2504-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaa
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacacctcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcactttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgcacagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtggggatccatttaa
>gnl|hbvcds|KP995118_S_P-F Feature FT:CDS KP995118_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2517-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcacggtatattgcccgtttg
tcctctaattccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
ttcctatggggttgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagagctttc
ccccactgtctggcttttagttatattgatgatctggtattgggggccaaatctgtgcagcatcttgagtcactttatac
cgctgttaccaattttctggtatctgtgggtatccatttaa
>gnl|hbvcds|KP995119_S_P-F Feature FT:CDS KP995119_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2524-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995120_S_P-F Feature FT:CDS KP995120_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2579-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995123_S_P-F Feature FT:CDS KP995123_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X10-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995124_S_P-F Feature FT:CDS KP995124_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X11-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995125_S_P-F Feature FT:CDS KP995125_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X13-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP995126_S_P-F Feature FT:CDS KP995126_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X14-Chronic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP997611_S_P-F Feature FT:CDS KP997611_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 285_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP997612_S_P-F Feature FT:CDS KP997612_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 285_B). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP997613_S_P-F Feature FT:CDS KP997613_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 285_C). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KP997649_S_P-F Feature FT:CDS KP997649_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 308). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KT630606_S_P-F Feature FT:CDS KT630606_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgcgtacctannttttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KT630614_S_P-F Feature FT:CDS KT630614_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V254). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|KT630619_S_P-F Feature FT:CDS KT630619_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V370). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KT630622_S_P-F Feature FT:CDS KT630622_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V442). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatntggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatncatttaa
>gnl|hbvcds|KT630623_S_P-F Feature FT:CDS KT630623_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V443). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctntgggtatacatttaa
>gnl|hbvcds|KT630633_S_P-F Feature FT:CDS KT630633_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V262). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atgganaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgcgtatcacaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KT630634_S_P-F Feature FT:CDS KT630634_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate V263). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KT896494_S_P-F Feature FT:CDS KT896494_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MAN183). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847477_S_P-F Feature FT:CDS KU847477_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1007.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
twcctatgggagtgggtctcagyccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccaytgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847479_S_P-F Feature FT:CDS KU847479_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1015.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcagaactcctaggacccccgctcgggttacaggcggtgtgttcctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccycyaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacractcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggcyttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgkcgcatcttgagtccctttatac
cgctgtkacyaattttttgttatctgtkggtatccatttga
>gnl|hbvcds|KU847480_S_P-F Feature FT:CDS KU847480_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1017.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847485_S_P-F Feature FT:CDS KU847485_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1028.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcckcac
aayaccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847492_S_P-F Feature FT:CDS KU847492_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1062.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggsactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaracctgcacrrctcttgcacaaggaacctctatgt
ttccctcytgttgctgtwcmaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847496_S_P-F Feature FT:CDS KU847496_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1077.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847498_S_P-F Feature FT:CDS KU847498_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1081.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgrgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcytgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcttgttgctgttccaaaccytcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847502_S_P-F Feature FT:CDS KU847502_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1094.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcaccttgagtccctttatac
cgctgttaccaattttctattatctgtgggtatccatttaa
>gnl|hbvcds|KU847507_S_P-F Feature FT:CDS KU847507_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1106.1). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaagacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtagacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggktcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaagaacctctatgt
ttccctcctgatgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847512_S_P-F Feature FT:CDS KU847512_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1131.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847515_S_P-F Feature FT:CDS KU847515_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1138.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847516_S_P-F Feature FT:CDS KU847516_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1152.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaagactcccaagacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccctttctcctggagcagtttactagtgcaaattgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatatggtattgggggccaaatctgtgcagcatcttgagtccctctatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847522_S_P-F Feature FT:CDS KU847522_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1193.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847524_S_P-F Feature FT:CDS KU847524_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1196.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcacagttttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847525_S_P-F Feature FT:CDS KU847525_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1001.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgayaaaaatcctcac
aataccacrgagtctcgactcgtggtggacttctctcaattttctagggggaacaccmgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagyacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847528_S_P-F Feature FT:CDS KU847528_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1005.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgccgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatcagtgggtatccatttaa
>gnl|hbvcds|KU847536_S_P-F Feature FT:CDS KU847536_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1032.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggtggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctawgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaagtcctgcacgactcttgctcaaggaacctctatgt
ttccctcttgctgctgttcaaaaccctcggacggaaattgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggcatccatttaa
>gnl|hbvcds|KU847540_S_P-F Feature FT:CDS KU847540_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1037.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggsactacccgggtgtcctggccaaaattcgc
agtccccaayctccaatcactyaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtkcgtcgggctttc
ccccactgyttggcttttagttatatggatgatmtggtattgggrgccaaatctgtgcakcaycttgagkcmctytatac
cgctgttwccaattttctrttatctgtgggtatccatttaa
>gnl|hbvcds|KU847549_S_P-F Feature FT:CDS KU847549_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1055.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatctkgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847550_S_P-F Feature FT:CDS KU847550_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1056.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847562_S_P-F Feature FT:CDS KU847562_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1088.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcgtgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847566_S_P-F Feature FT:CDS KU847566_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1098.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847569_S_P-F Feature FT:CDS KU847569_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1111.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgt
ttccctcctgttgctgtatcaaaccctcggaaggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggtctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccattgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctstgggtatccatttaa
>gnl|hbvcds|KU847576_S_P-F Feature FT:CDS KU847576_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1124.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847580_S_P-F Feature FT:CDS KU847580_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1133.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847586_S_P-F Feature FT:CDS KU847586_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1145.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaatctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccgggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgttcagcatatggagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847590_S_P-F Feature FT:CDS KU847590_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1150.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggyggtgtgttycttgttgayaaaaatccycam
aataccacagagtctagactcgtggtggacttctctcarttttctaggggractaccmgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847600_S_P-F Feature FT:CDS KU847600_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1166.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggractacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggktcttctggactatcaaggtatgktgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaracctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccytcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggctttyagytatatggatgatmtggtattgggggccaaatctgtkcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctstgggtatccatttaa
>gnl|hbvcds|KU847606_S_P-F Feature FT:CDS KU847606_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1173.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
ayggacaacatcacatcaggactcctaggacccctgckcgtgttacaggyggtstkttccttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctaggggraacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacwtgtcctggctatcgctggatgtgtctgcggcrtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacractcttgctcaaggaacctctatgt
ttccctcttgctgctgttcmaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttmggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcakcatcttgagtccctttatac
mgctgttaccaattttctgttatctstgggtatccatttaa
>gnl|hbvcds|KU847608_S_P-F Feature FT:CDS KU847608_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1177.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacactacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccamagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
taccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847612_S_P-F Feature FT:CDS KU847612_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1186.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgcccgtgttacaggcggtgtgttccttgttgacaaaaatccgcac
aataccmaagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847613_S_P-F Feature FT:CDS KU847613_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1187.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtstttcttgttgayaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggsactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcytgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaracctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcarcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847616_S_P-F Feature FT:CDS KU847616_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1197.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcarttttctagggggactrcccgrgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcmaaaccytcggacggaaactgcacwtgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccstttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847620_S_P-F Feature FT:CDS KU847620_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1202.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847627_S_P-F Feature FT:CDS KU847627_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1210.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtyctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847628_S_P-F Feature FT:CDS KU847628_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1211.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatctycctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847653_S_P-F Feature FT:CDS KU847653_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0123.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggsactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccytgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctgkctcagtttactagtgcaatttgttcggtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847686_S_P-F Feature FT:CDS KU847686_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0089.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggtggygtttttctygttgacaaaaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagagggaatacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaagacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847689_S_P-F Feature FT:CDS KU847689_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0123.2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=680 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccattta
>gnl|hbvcds|KU847694_S_P-F Feature FT:CDS KU847694_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0148.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggcaaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847723_S_P-F Feature FT:CDS KU847723_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0235.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KU847728_S_P-F Feature FT:CDS KU847728_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 0241.1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttctcgttgataaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggtctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgccgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgagcggcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264496_S_P-F Feature FT:CDS KX264496_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1-ame). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264497_S_P-F Feature FT:CDS KX264497_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F2-ame). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264498_S_P-F Feature FT:CDS KX264498_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F3-ame). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttttgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264499_S_P-F Feature FT:CDS KX264499_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4-ame). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KX264660_S_P-F Feature FT:CDS KX264660_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Q69). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctagnacccntgytcgtgttacnggcggtgtgtttnttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtgganttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcanttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcagaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264661_S_P-F Feature FT:CDS KX264661_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Q15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccgggatccacgaccaccagcacgggaccctgcagaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KX264662_S_P-F Feature FT:CDS KX264662_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate AF75). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KX757665_S_P-F Feature FT:CDS KX757665_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate TH6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY382411_S_P-F Feature FT:CDS KY382411_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_wt). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KY382415_S_P-F Feature FT:CDS KY382415_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_wt). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY382416_S_P-F Feature FT:CDS KY382416_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_double_mut). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY382417_S_P-F Feature FT:CDS KY382417_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_quadruple_mut). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY458061_S_P-F Feature FT:CDS KY458061_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY458062_S_P-F Feature FT:CDS KY458062_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY458063_S_P-F Feature FT:CDS KY458063_S_P-F of [Viruses] Hepatitis B Virus genotype F. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476322_S_P-F Feature FT:CDS KY476322_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476323_S_P-F Feature FT:CDS KY476323_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476324_S_P-F Feature FT:CDS KY476324_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgytgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476325_S_P-F Feature FT:CDS KY476325_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatctggagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476326_S_P-F Feature FT:CDS KY476326_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacrggcggtgtgtttctggttgacaaaaatccgcaa
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaagaaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgagcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KY476327_S_P-F Feature FT:CDS KY476327_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476328_S_P-F Feature FT:CDS KY476328_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476329_S_P-F Feature FT:CDS KY476329_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttaacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggcacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtatggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476330_S_P-F Feature FT:CDS KY476330_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcgcaattttctaggggaaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY476332_S_P-F Feature FT:CDS KY476332_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV47). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatctaa
>gnl|hbvcds|KY809938_S_P-F Feature FT:CDS KY809938_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagagggaccacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctacttccaggatccacgaccaccagcacgggaccctgcaagacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY809939_S_P-F Feature FT:CDS KY809939_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccatttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|KY809940_S_P-F Feature FT:CDS KY809940_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_33). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatccgcaa
aataccacagagtctagacttgtggtggacttctctcaattttctaggggcactacccgagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY809941_S_P-F Feature FT:CDS KY809941_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_96). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcccaggacccctgctcgtgttacaggcggtgtttttctggttgataaaaatccccac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctggtgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgttcctcctagctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY809942_S_P-F Feature FT:CDS KY809942_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_163). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgctatctgtgggtatccatttaa
>gnl|hbvcds|KY809943_S_P-F Feature FT:CDS KY809943_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgagcagcaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY809944_S_P-F Feature FT:CDS KY809944_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_176). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgagcagcaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|KY809945_S_P-F Feature FT:CDS KY809945_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_185). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttctggttgacaaaaatccgcac
aataccacagaagctagactcgtggtggacttctctcagttttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggaaggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggcatccatttga
>gnl|hbvcds|KY809946_S_P-F Feature FT:CDS KY809946_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RP_85). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MF150688_S_P-F Feature FT:CDS MF150688_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MEX935M). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MF150689_S_P-F Feature FT:CDS MF150689_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MEX934M). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MF150690_S_P-F Feature FT:CDS MF150690_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MEX933M). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MF150693_S_P-F Feature FT:CDS MF150693_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MEX027N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MF150694_S_P-F Feature FT:CDS MF150694_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MEX026N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MG098564_S_P-F Feature FT:CDS MG098564_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_050). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatctcgggctttaggaaaa
tacctatgggagtgtgcctcagcccgtttctcctggctcattttactagtgcaatttgttcagtggtgcgtagggttttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098565_S_P-F Feature FT:CDS MG098565_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_111). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctgsccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctcmaacttgtcctgtctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtgttgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098566_S_P-F Feature FT:CDS MG098566_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_113). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactygtkgtggacttctctcarttttctaggggaactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatctggagtcgctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098569_S_P-F Feature FT:CDS MG098569_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aatrccacagagtctagactcgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctgsctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098570_S_P-F Feature FT:CDS MG098570_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_117). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatctacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctaggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatakggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098573_S_P-F Feature FT:CDS MG098573_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_121). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctgsccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgaacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggaaggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctytatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098574_S_P-F Feature FT:CDS MG098574_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_122). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcsc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcatggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggntttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098575_S_P-F Feature FT:CDS MG098575_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_123). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccaccacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcancccgtttctcatggctcaatttactagtgcaatttgttcagtggtgcgaagggctttc
ccccattgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctytatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098577_S_P-F Feature FT:CDS MG098577_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_125). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttganaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaamttgtcctgkttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacaaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatctttggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctagctcattttactagtgcaatctgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098578_S_P-F Feature FT:CDS MG098578_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_126). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggaccgctgctcgtgttacaggcggtgtgtatcttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggtctacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccatttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098579_S_P-F Feature FT:CDS MG098579_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_127). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
acggacagcatcacatcagaacacctaccacccctgctcgtgtcatcggcggtgtcttccttgttgacaagaatccgcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagtacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgmtctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctattatctgtgggtatccatttga
>gnl|hbvcds|MG098580_S_P-F Feature FT:CDS MG098580_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_128). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098582_S_P-F Feature FT:CDS MG098582_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_142). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggacmatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcmaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098583_S_P-F Feature FT:CDS MG098583_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_146). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggrtgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccatcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaw
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgaagccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|MG098584_S_P-F Feature FT:CDS MG098584_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate D42). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtattacaggcggtgtgtttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggactacccgagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgcagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgttcaccaccttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MG839213_S_P-F Feature FT:CDS MG839213_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FSW039). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MH051986_S_P-F Feature FT:CDS MH051986_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B106W). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MH051987_S_P-F Feature FT:CDS MH051987_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B127W). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|MH051988_S_P-F Feature FT:CDS MH051988_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B115W). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|MH051989_S_P-F Feature FT:CDS MH051989_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B117W). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|MH051990_S_P-F Feature FT:CDS MH051990_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B123W). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcccggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|MH051992_S_P-F Feature FT:CDS MH051992_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B173W). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatacatttaa
>gnl|hbvcds|MK058437_S_P-F Feature FT:CDS MK058437_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcttgctgctgttccaaaccctcggaaggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91803_S_P-F Feature FT:CDS U91803_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SC1214 Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91805_S_P-F Feature FT:CDS U91805_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8884H Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91806_S_P-F Feature FT:CDS U91806_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7768H Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91807_S_P-F Feature FT:CDS U91807_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7242BSJ Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91808_S_P-F Feature FT:CDS U91808_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 70H Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91811_S_P-F Feature FT:CDS U91811_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 567TEG Honduras). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91812_S_P-F Feature FT:CDS U91812_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 553TEG Honduras). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91813_S_P-F Feature FT:CDS U91813_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 543TEG Honduras). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91814_S_P-F Feature FT:CDS U91814_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 529TEG Honduras). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91815_S_P-F Feature FT:CDS U91815_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 496TEG Honduras). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91817_S_P-F Feature FT:CDS U91817_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3607PP Costa Rica). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91818_S_P-F Feature FT:CDS U91818_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3504G Guatemala). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91821_S_P-F Feature FT:CDS U91821_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2187NIC Nicaragua). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttttctgtgggtatccatttaa
>gnl|hbvcds|U91822_S_P-F Feature FT:CDS U91822_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2091NIC Nicaragua). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91823_S_P-F Feature FT:CDS U91823_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1980NIC Nicaragua). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccaccaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggaacctctatgt
taccctcctgctgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggcaaaatctgtgcagcatgttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccagttaa
>gnl|hbvcds|U91825_S_P-F Feature FT:CDS U91825_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1889NIC Nicaragua). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacaaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91826_S_P-F Feature FT:CDS U91826_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1879SAL El Salvador). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91828_S_P-F Feature FT:CDS U91828_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1575SAL El Salvador). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91829_S_P-F Feature FT:CDS U91829_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1116SAL El Salvador). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91830_S_P-F Feature FT:CDS U91830_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1073SAL El Salvador). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|U91831_S_P-F Feature FT:CDS U91831_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 1024SAL El Salvador). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|X69798_S_P-F Feature FT:CDS X69798_S_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttc
ccccactgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
>gnl|hbvcds|X75658_S_C-F Feature FT:CDS X75658_S_C-F of [Viruses] Hepatitis B Virus genotype F (isolate Fou). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggagccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttga
>gnl|hbvcds|X75661_S_P-F Feature FT:CDS X75661_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Car). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttgtctgtgggtatccatttga
>gnl|hbvcds|X75663_S_P-F Feature FT:CDS X75663_S_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9203). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgcgcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggactacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacagctcttgctcaaggaacctctatgt
ttccctcctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttc
ccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatac
cgctgttaccaattttctgttatctgtgggtatccatttaa
© 1998-2020Legal notice