HBVdb

Dataset for nucleotide sequence PreC of genotype F

[Download (right click)] [Alignment] [Repertoires]

283 sequence(s)

>gnl|hbvcds|AB036905_PreC_P-F Feature FT:CDS AB036905_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036906_PreC_P-F Feature FT:CDS AB036906_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036907_PreC_P-F Feature FT:CDS AB036907_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036908_PreC_P-F Feature FT:CDS AB036908_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8337). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|AB036909_PreC_P-F Feature FT:CDS AB036909_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036910_PreC_P-F Feature FT:CDS AB036910_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8251). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtctcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036911_PreC_P-F Feature FT:CDS AB036911_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8255). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaattgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036912_PreC_P-F Feature FT:CDS AB036912_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8323). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036913_PreC_P-F Feature FT:CDS AB036913_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8346). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036914_PreC_P-F Feature FT:CDS AB036914_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8349). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036915_PreC_P-F Feature FT:CDS AB036915_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8351). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036916_PreC_P-F Feature FT:CDS AB036916_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8371). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036917_PreC_P-F Feature FT:CDS AB036917_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036919_PreC_P-F Feature FT:CDS AB036919_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8381). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB036920_PreC_P-F Feature FT:CDS AB036920_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8624). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB064316_PreC_P-F Feature FT:CDS AB064316_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB086397_PreC_P-F Feature FT:CDS AB086397_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate JPF1130). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcctctggatttcttcc
cgtcagctcgggatctactcgacaccgcttcagccctctaccgggaggctttagaatcaccagaacattgcacagctcac
cataccgctctcaggcaagctatattgtgctggggtgagttaacgactttggctacctgggtgggcaataatttggacga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaaccagacaattgctgtggtttcaca
tttcctgccttagttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgccgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AB116549_PreC_P-F Feature FT:CDS AB116549_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggatctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB116550_PreC_P-F Feature FT:CDS AB116550_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttttaaagaatttggagcttctgaggaattactctcttttttgcctcttgatttcttcc
cgaatgttcgggatctactcgacaccgcttcagccctttaccgggatgctcttgagtcatcggaacattgcaccccccat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgattttcgctgcttgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacgactgttgtggtttcaca
tttcctgtcttacttttggaagacaagtagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccagcaaatgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB116551_PreC_P-F Feature FT:CDS AB116551_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctgtcgtttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB116552_PreC_P-F Feature FT:CDS AB116552_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB116654_PreC_P-F Feature FT:CDS AB116654_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcctactgatttcttcc
cgtcagttcgggaccttctcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacactgcacagctcac
cataccgctatcaggcaaattgtattgtgctggggtgagttgatgactttggcttcctgggtgggcaataatttggacga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagacaaacagttctggagtatttggtgtcttttggagtgtggattcgcactcctattgct
tatagaccaccaaatgcccctatcttatccacacttccggagactactgttgttagaggacgacgcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|AB166850_PreC_P-F Feature FT:CDS AB166850_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL592). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgcttctgcggaattgctctcttttttgccttctgatttctttc
cgtcggttcgggatctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcactcccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
tttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccatacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB214516_PreC_P-F Feature FT:CDS AB214516_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL597). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgcttctgcggaattgctctcttttttgccttctgatttctttc
cgtcggttcgggatctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcactcccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaactattggggtttcaca
tttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB365446_PreC_P-F Feature FT:CDS AB365446_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL3). Complete genome. [Hepadnaviridae] (length=639 residues).
agtcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgaatgttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
tttcctgcctttsttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|AB365449_PreC_P-F Feature FT:CDS AB365449_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL93). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggaggctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttgcagga
ccctgcagcaagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB365450_PreC_P-F Feature FT:CDS AB365450_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL102). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctamtgattwctwcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattkcaccccccat
catamcgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctytggagtgtggatacgcactcctccasct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttrttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB365453_PreC_P-F Feature FT:CDS AB365453_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL584). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcgtctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttagggacctaatcgacaccgctacagctctctacagggatgacttagagtcaccggaacattgcaccgcccat
cataccgctctcaggcaagctattgtgtgttggggtgaagtaatgactttggcttcctgggtgggcaataatttggacga
ccctggagccagggatttagtagttaactatgttaacactcacatgggcctaaagattagacaattattgtggtttcaca
tttcctgtcttatgtttggaagacaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccacaaaatgcccctatcctatccacacttcctgaaactactgttgttagaccacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AF223962_PreC_P-F Feature FT:CDS AF223962_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AF223963_PreC_P-F Feature FT:CDS AF223963_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagctctgtaccgggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacttagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AF223964_PreC_P-F Feature FT:CDS AF223964_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AF223965_PreC_P-F Feature FT:CDS AF223965_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY090455_PreC_P-F Feature FT:CDS AY090455_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatttcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggacttagttgttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|AY090458_PreC_C-F Feature FT:CDS AY090458_PreC_C-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY090459_PreC_P-F Feature FT:CDS AY090459_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
tcctgcagatagggacytagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttag
>gnl|hbvcds|AY090461_PreC_P-F Feature FT:CDS AY090461_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY179735_PreC_P-F Feature FT:CDS AY179735_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY254498_PreC_P-F Feature FT:CDS AY254498_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 14). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgtgcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttcttcc
cttcggttcgagacctactagacaccgcttcagctctttaccgggatgctttagagtctcctgaacattgctctcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY311369_PreC_P-F Feature FT:CDS AY311369_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD4139). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY311370_PreC_P-F Feature FT:CDS AY311370_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14999). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacgtttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcgtcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ776247_PreC_P-F Feature FT:CDS DQ776247_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823086_PreC_P-F Feature FT:CDS DQ823086_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823087_PreC_P-F Feature FT:CDS DQ823087_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtgcct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|DQ823088_PreC_P-F Feature FT:CDS DQ823088_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823089_PreC_P-F Feature FT:CDS DQ823089_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823090_PreC_P-F Feature FT:CDS DQ823090_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823091_PreC_P-F Feature FT:CDS DQ823091_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823092_PreC_P-F Feature FT:CDS DQ823092_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823093_PreC_P-F Feature FT:CDS DQ823093_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823094_PreC_P-F Feature FT:CDS DQ823094_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ823095_PreC_P-F Feature FT:CDS DQ823095_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899142_PreC_P-F Feature FT:CDS DQ899142_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao152). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899143_PreC_P-F Feature FT:CDS DQ899143_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao189). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899144_PreC_P-F Feature FT:CDS DQ899144_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira75). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttccgatttctttc
catcggttcgggacctactcgacaccgcttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaat
cacactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggagga
ccctgctgccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899145_PreC_P-F Feature FT:CDS DQ899145_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttccgatttctttc
catcggttcgggacctactggacaccgcttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaat
cacactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggagga
ccctgctgccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899146_PreC_P-F Feature FT:CDS DQ899146_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira80). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttccgatttctttc
catcggttcgggacctattcgacaccgcttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaat
cacactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggagga
ccctgctgccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899147_PreC_P-F Feature FT:CDS DQ899147_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttccgatttctttc
catcggttcgggacctactcgacaccgcttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaat
cacactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggagga
ccctgctgccagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899148_PreC_P-F Feature FT:CDS DQ899148_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Yanomami114). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaacattttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cttctgttcgggacctactcgacaccgcttcagccttgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaactatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899149_PreC_P-F Feature FT:CDS DQ899149_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Piaroa3019). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcctcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatggccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ899150_PreC_P-F Feature FT:CDS DQ899150_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Colombia8). Complete genome. [Hepadnaviridae] (length=639 residues).
atggaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatctagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaattgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EF576808_PreC_P-F Feature FT:CDS EF576808_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctactgatttcttcc
cgtcagctcgggacctattcgacaccgcttcagctctctacagggatgctttagagtcaccgcaacattgcaccccccat
cataccgctctcaggcaagctattttgtgttggggtgaattaacgactctggcttcctgggtgggcaataatttggagga
ccctgcatccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtttttggtgtcctttggagtgtggattcgcactcctccagct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccggcttcccaatgttag
>gnl|hbvcds|EF576812_PreC_P-F Feature FT:CDS EF576812_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU185743_PreC_P-F Feature FT:CDS EU185743_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MSM6). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
catacagctctcaggcaagctatattgtgctggggtgagttaatgactttggcttccttggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacraggcaggtcccctcgaag
aagaactccctcgcctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttctcaatgttag
>gnl|hbvcds|EU185744_PreC_P-F Feature FT:CDS EU185744_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MSM7). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacraaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttctcaatgttag
>gnl|hbvcds|EU366116_PreC_P-F Feature FT:CDS EU366116_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU366118_PreC_P-F Feature FT:CDS EU366118_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU366132_PreC_P-F Feature FT:CDS EU366132_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA95). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctagggaattgctctcttttttgcctaatgatttctacc
cgtcggctcgggacctactcgacaccgctacagccctctacagggatgctttagagtcaccggaacattgctccccccat
cataccgttatcaggcaagctgttttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagtgaactatgttaacactaccgtgggcctaaagcttagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttgttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU366133_PreC_P-F Feature FT:CDS EU366133_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA96). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU670261_PreC_P-F Feature FT:CDS EU670261_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 499). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaat
catactgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU670262_PreC_P-F Feature FT:CDS EU670262_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 549). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaat
catactgctctcagacaagctatattgtgctggggtgagttagtgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ589065_PreC_P-F Feature FT:CDS FJ589065_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_024). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=639 residues).
atgcttctttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ589066_PreC_P-F Feature FT:CDS FJ589066_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_054). Complete genome. [Hepadnaviridae] (length=639 residues).
nnnnnnctttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctcacttttttgccttctgatttcttcc
cgtctattcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgctccccccat
cataccgctctcaggcaagctattttgtgctggggtgagttaatggttttcgcttcctgggtgggcaataatttggaaga
tcctgcagctagggatttagtagttaattatgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagatacagttattcagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagaccacgaggcaggacccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgggtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|FJ589067_PreC_P-F Feature FT:CDS FJ589067_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_083). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctcttgagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtctgacttttggaagagacacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctcct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|FJ657519_PreC_P-F Feature FT:CDS FJ657519_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA110). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ657522_PreC_P-F Feature FT:CDS FJ657522_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ657525_PreC_P-F Feature FT:CDS FJ657525_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA107). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcctctgtggaattactctcttttttgccttctgatttctacc
cgtcagttcgggacctactcgacaccgcttcagccctctatcgggatgctttggaatcaccagaacattgctcacctcac
cataccgctctcaggcaagttagtttgtgctggagtgagttaatgactttcgctatctgggtgggcaataatttggaaga
tcctgctgctagggatctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacr
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttgttagaggacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|FJ657528_PreC_P-F Feature FT:CDS FJ657528_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA108). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ657529_PreC_P-F Feature FT:CDS FJ657529_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA109). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709457_PreC_P-F Feature FT:CDS FJ709457_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709458_PreC_P-F Feature FT:CDS FJ709458_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagtacgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709459_PreC_P-F Feature FT:CDS FJ709459_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagtacgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709460_PreC_P-F Feature FT:CDS FJ709460_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709462_PreC_P-F Feature FT:CDS FJ709462_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709463_PreC_P-F Feature FT:CDS FJ709463_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709464_PreC_P-F Feature FT:CDS FJ709464_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709465_PreC_P-F Feature FT:CDS FJ709465_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ709494_PreC_P-F Feature FT:CDS FJ709494_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI41). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HE981181_PreC_P-F Feature FT:CDS HE981181_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HE981182_PreC_P-F Feature FT:CDS HE981182_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585186_PreC_P-F Feature FT:CDS HM585186_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585187_PreC_P-F Feature FT:CDS HM585187_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585188_PreC_P-F Feature FT:CDS HM585188_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgagatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585189_PreC_P-F Feature FT:CDS HM585189_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585190_PreC_P-F Feature FT:CDS HM585190_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585191_PreC_P-F Feature FT:CDS HM585191_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagtacgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585192_PreC_P-F Feature FT:CDS HM585192_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585193_PreC_P-F Feature FT:CDS HM585193_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcata
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585194_PreC_P-F Feature FT:CDS HM585194_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585195_PreC_P-F Feature FT:CDS HM585195_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagtacgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585196_PreC_P-F Feature FT:CDS HM585196_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585197_PreC_P-F Feature FT:CDS HM585197_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585198_PreC_P-F Feature FT:CDS HM585198_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagtacgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585199_PreC_P-F Feature FT:CDS HM585199_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM585200_PreC_P-F Feature FT:CDS HM585200_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM590471_PreC_P-F Feature FT:CDS HM590471_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM590472_PreC_P-F Feature FT:CDS HM590472_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM590473_PreC_P-F Feature FT:CDS HM590473_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgagatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM590474_PreC_P-F Feature FT:CDS HM590474_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH3). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgctcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM622135_PreC_P-F Feature FT:CDS HM622135_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaattactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM627320_PreC_P-F Feature FT:CDS HM627320_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctyaggcaarytatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacga
tcctgctgctagggacctagtggttaactatgtcaatactmacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaryagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccacmaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ378247_PreC_P-F Feature FT:CDS HQ378247_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate IRL-2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ420165_PreC_P-F Feature FT:CDS HQ420165_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttctcaatgttag
>gnl|hbvcds|HQ420166_PreC_P-F Feature FT:CDS HQ420166_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5Mg). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttctcaatgttag
>gnl|hbvcds|JN688691_PreC_P-F Feature FT:CDS JN688691_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV122). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN688699_PreC_P-F Feature FT:CDS JN688699_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV133). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattanacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctngaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN688701_PreC_P-F Feature FT:CDS JN688701_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV135). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcgattcgggacctactcgacaccgcttcagccctctacagggawgctttagagtcaccggaacattgcacccacmat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgaatttggcttcctgggtgggcaataatttggayga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagatacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN688703_PreC_P-F Feature FT:CDS JN688703_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV137). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN688709_PreC_P-F Feature FT:CDS JN688709_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV143). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctyttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgmtctcttttttgccttctgatttcttcc
cgtcrgttcgggacctactcgacaccgcttcagccctcttcagggatgctttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattgtgtgttggggtgaagtawcgactttkgcttcctgggtgggccataatttrgagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgcmttayttttggaagagatacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcmagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|JN688720_PreC_P-F Feature FT:CDS JN688720_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV224). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctgttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgccgtctgatttcttcc
cgtcggctcgggacctactcgacaccgctkcagccctctacagggatgctttagagtcaccggaacattgcaccccccat
cataccgctatcaggcaagctgttttgtgttggaatgaattaatgactttcgcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagacaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccacaaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792914_PreC_P-F Feature FT:CDS JN792914_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8052-03506). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792916_PreC_P-F Feature FT:CDS JN792916_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7703-00047). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggacgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacc
tttcctgcattacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactcccacgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792917_PreC_P-F Feature FT:CDS JN792917_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-05260). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttgcaaga
tcctgctgctagggaccaagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792918_PreC_P-F Feature FT:CDS JN792918_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-03547). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacatcac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792919_PreC_P-F Feature FT:CDS JN792919_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-13282). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgattttcgcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatattaacatgggcctaaaaattagacgattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792920_PreC_P-F Feature FT:CDS JN792920_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-05424). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctggtgctagggacctagtggttaactatgtcaatamtaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcytsct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN792921_PreC_P-F Feature FT:CDS JN792921_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03738). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccttataaagaatttggagcttctgtggarttactctcktttttgcctkctgatttcttcc
crtcrgttcgggacctactcgacaccgcttcagcyctytaccgggatgctttagartcaccwgaacattgcacwccyaac
catacygctctcaggcaagctatwttgtgytggggtgagttaatgactttggcttcctgggtgggcaataatttggarga
ycctgswgctagggayytagtrgttaactatgtyaayactaacatgggcctmaaaattagacaaytrytgtggtttcaca
tttcctgccttacttttggaagagaaryagttctwgagtatttggtgtcytttggagtgtggattcgcactcctcctgct
tayagaccaccaaatgcccctatcytatccacacttccggaaactactattattagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccggcttcccgatgttag
>gnl|hbvcds|JN792922_PreC_P-F Feature FT:CDS JN792922_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03301). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN811655_PreC_P-F Feature FT:CDS JN811655_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3Mg). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JN811656_PreC_P-F Feature FT:CDS JN811656_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ272888_PreC_P-F Feature FT:CDS JQ272888_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttctttc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcacctgaacattgcaccccccat
cataccgctatcaggcaagctatattgtgttggggcgaattaatggttttcgcttcctgggtgggcaataatttgcaaga
cgctgcagccagggatttagtagtcgactatgttaacactcacatgggcttaaagattagacatttattgtggtttcacc
tttcctgccttatgtttggaagagatacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactgctgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgttag
>gnl|hbvcds|JX079936_PreC_P-F Feature FT:CDS JX079936_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccaccttcccactgttag
>gnl|hbvcds|JX079937_PreC_P-F Feature FT:CDS JX079937_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccstagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JX899376_PreC_P-F Feature FT:CDS JX899376_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBcMX-115). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgcctcctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494394_PreC_P-F Feature FT:CDS KC494394_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR12-NORTH). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctcccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494395_PreC_P-F Feature FT:CDS KC494395_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR11-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacaccaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494396_PreC_P-F Feature FT:CDS KC494396_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR10-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttctttc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactccccac
cataccgctctcaggcaagctattttatgttggggtgagttaatgactttggcttcctgggtgggcaataatttggacga
ccctggagctagggatttagtagttaactatgttaacactaacatgggcctaaaagttagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctcgagtatttggtgtcctttggagtgtggattcgcactcctccggct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494397_PreC_P-F Feature FT:CDS KC494397_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR9-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494398_PreC_P-F Feature FT:CDS KC494398_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR8-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcacttttgtttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494399_PreC_P-F Feature FT:CDS KC494399_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR7-CENTRAL). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttaccttctgatttctacc
catcggttcgggacctaatcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgctctccccac
catacggctctcaggcaagctgttgggtgttggggtgaggtatcgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcctaaaacttagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttgtagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccagtaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494400_PreC_P-F Feature FT:CDS KC494400_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR6-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaaatatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaagttctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494401_PreC_P-F Feature FT:CDS KC494401_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR5-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaccaggcaggtcccctagaaa
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494402_PreC_P-F Feature FT:CDS KC494402_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR4-NORTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494403_PreC_P-F Feature FT:CDS KC494403_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR3-NORTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgtcaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494404_PreC_P-F Feature FT:CDS KC494404_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR2-NORTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcattttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KC494405_PreC_P-F Feature FT:CDS KC494405_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR1-NORTHEAST). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcacctttttcacctctgcctaatcattttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcacacctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF199901_PreC_P-F Feature FT:CDS KF199901_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RVLA). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586805_PreC_P-F Feature FT:CDS KJ586805_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgactttttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctttcaggcaagctatattgtgctggggggagttaatgactttggcttcctgggggggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctggggtttcaca
tttcctcccttacttttggaagagaaacagttcttgagtatttggtgttttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586806_PreC_P-F Feature FT:CDS KJ586806_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggggagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586807_PreC_P-F Feature FT:CDS KJ586807_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ586808_PreC_P-F Feature FT:CDS KJ586808_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttaaaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638656_PreC_P-F Feature FT:CDS KJ638656_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctatcgggatgctttagaatcaccagaacattgcacacctcac
cataccgctatcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgcagctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagacaaacagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaacgactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638657_PreC_P-F Feature FT:CDS KJ638657_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT013). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggrcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagagcattgcacacctmac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttsgcttcctgggtgggcaataatttggaaga
tcctgsagctaggracctagtggttractatgtcaataytaacatgggcctaaaaattagacawttactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638659_PreC_P-F Feature FT:CDS KJ638659_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT025). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggatctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggactgaggtaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638660_PreC_P-F Feature FT:CDS KJ638660_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT030). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacatygacccttataaagaatttggmgcttctttagaattgctctcttttttgcctyctgatttctttc
cgtcgrytcgggacctcatcgacaccgcttcagccctctaccgggatgcattagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattgtgtgttggggtgaggtaatgactttggctgcctgggtgggccataatttggagga
ccctgcagctagggatttagtagtgaattatgtcaatactaacatgggcctaaaaattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaagtagttcttgagyatttggtgtccttcggagtgtggattcgcactcctcctgcg
tataggccaccaaatgcccctatcctatccacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaag
tagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638662_PreC_P-F Feature FT:CDS KJ638662_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT040). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtagaattgctctcttttttgccttctgatttctttc
cgtcggttcgggacctcctcgacaccgcttcagccctctaccgggatgctttagagtcaccggaacattgcaccccccat
cataccgctctyagrcaarttattttgtgttggggtgagttaacgaatttgggttcctgggtgggcaataatttggagga
cmctgcagctagggattyagtagtgaattatgtcaatactaacatgggcctaaaaactagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcg
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ638663_PreC_P-F Feature FT:CDS KJ638663_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT047). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagcwcgggacctactcgamaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
catacagctctcaggcaagctgtattgtgctggactgaggtaatgactttggctacctgggtgggccataatttggacga
tcctgcagctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacggttcttaactatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactgctgttgttagacgacgagtcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagattcccgatgttag
>gnl|hbvcds|KJ638664_PreC_P-F Feature FT:CDS KJ638664_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT049). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgaggaattactctcttttttgcctcttgatttcttcc
cgtcagctcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctcaggcaagctatattgtgctggaatgaggtaacgactttggcttcctgggtgggcaataatttggaaga
tcctgcagctagggaccaagtggttaactatgtcaatactaacatgggcctaaaaattagacaactactgtggtttcaca
tttcctgccttacttttggaagaactacagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccagcaaatgcccctatcttatccacacttccggaaacaagggttattagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ676694_PreC_P-F Feature FT:CDS KJ676694_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcnncttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggcgcttctctggaattgctctcttttttgccttctgatttctacc
cttcggttcgggacctaatcgacaccgcttcagccctctacagggatgcgttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattttgtgttggacagaggtaatgactctggcttcctgggtgggcaataatttggaaga
ccctgcagctagggatttagtagttaactatgttaacactcacatgggcctaaagatyagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctaca
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|KJ843163_PreC_P-F Feature FT:CDS KJ843163_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag01). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843164_PreC_P-F Feature FT:CDS KJ843164_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag02). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843167_PreC_P-F Feature FT:CDS KJ843167_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag05). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgggctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtctttgggagtgtggattcgcactcctcctgct
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843168_PreC_P-F Feature FT:CDS KJ843168_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag06). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843169_PreC_P-F Feature FT:CDS KJ843169_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag07). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactgctgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843170_PreC_P-F Feature FT:CDS KJ843170_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag08). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843171_PreC_P-F Feature FT:CDS KJ843171_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag09). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843174_PreC_P-F Feature FT:CDS KJ843174_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttggggggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843175_PreC_P-F Feature FT:CDS KJ843175_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843176_PreC_P-F Feature FT:CDS KJ843176_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagacctccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843177_PreC_P-F Feature FT:CDS KJ843177_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843178_PreC_P-F Feature FT:CDS KJ843178_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843179_PreC_P-F Feature FT:CDS KJ843179_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843180_PreC_P-F Feature FT:CDS KJ843180_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843181_PreC_P-F Feature FT:CDS KJ843181_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagctctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843185_PreC_P-F Feature FT:CDS KJ843185_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843189_PreC_P-F Feature FT:CDS KJ843189_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843190_PreC_P-F Feature FT:CDS KJ843190_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatctggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843191_PreC_P-F Feature FT:CDS KJ843191_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttaragtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttttagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaracgaagatctcaatcgccgcgtcgccgcaratctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843193_PreC_P-F Feature FT:CDS KJ843193_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag32). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatctggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843194_PreC_P-F Feature FT:CDS KJ843194_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843195_PreC_P-F Feature FT:CDS KJ843195_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctctggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggagtgaggtaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843196_PreC_P-F Feature FT:CDS KJ843196_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag35). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843197_PreC_P-F Feature FT:CDS KJ843197_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag36). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843198_PreC_P-F Feature FT:CDS KJ843198_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcacccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843199_PreC_P-F Feature FT:CDS KJ843199_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag38). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattaracaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843200_PreC_P-F Feature FT:CDS KJ843200_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag39). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843201_PreC_P-F Feature FT:CDS KJ843201_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag41). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843202_PreC_P-F Feature FT:CDS KJ843202_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag42). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaacactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843203_PreC_P-F Feature FT:CDS KJ843203_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag43). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843204_PreC_P-F Feature FT:CDS KJ843204_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843205_PreC_P-F Feature FT:CDS KJ843205_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag45). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843206_PreC_P-F Feature FT:CDS KJ843206_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag46). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843207_PreC_P-F Feature FT:CDS KJ843207_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag47). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843208_PreC_P-F Feature FT:CDS KJ843208_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag48). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843209_PreC_P-F Feature FT:CDS KJ843209_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag49). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843210_PreC_P-F Feature FT:CDS KJ843210_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag50). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagacgaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843211_PreC_P-F Feature FT:CDS KJ843211_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843212_PreC_P-F Feature FT:CDS KJ843212_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag52). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttctcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843213_PreC_P-F Feature FT:CDS KJ843213_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843219_PreC_P-F Feature FT:CDS KJ843219_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr01). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843220_PreC_P-F Feature FT:CDS KJ843220_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843221_PreC_P-F Feature FT:CDS KJ843221_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr04). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843222_PreC_P-F Feature FT:CDS KJ843222_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr05). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843223_PreC_P-F Feature FT:CDS KJ843223_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr06). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843224_PreC_P-F Feature FT:CDS KJ843224_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr07). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KJ843225_PreC_P-F Feature FT:CDS KJ843225_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr08). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaattactgttgttagacaacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|KJ843226_PreC_P-F Feature FT:CDS KJ843226_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr09). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgaatatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KM233681_PreC_P-F Feature FT:CDS KM233681_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KM998715_PreC_P-F Feature FT:CDS KM998715_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718103_PreC_P-F Feature FT:CDS KP718103_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1214). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgaatatttggtgtcctttggggtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718104_PreC_P-F Feature FT:CDS KP718104_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CL0004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcacctgaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttag
>gnl|hbvcds|KP718106_PreC_P-F Feature FT:CDS KP718106_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1650). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctycaagctgtgccttgggtggct
ttgggacatggacattgaccmttataaagaatttggagcttctgyggaattgctctcttttttgccttctgatttcttcc
cgtctgytcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccctaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtmataatttggaara
ccctgcwgctagggatttartarttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgartatttggtgtcctttggagtgtggattcscactccacctgct
tatasaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccratgttag
>gnl|hbvcds|KP718107_PreC_P-F Feature FT:CDS KP718107_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT097). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttaacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgcagctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagrcaattactgtggtttcaca
tttcctgccttacttttggaagmaacacagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718109_PreC_P-F Feature FT:CDS KP718109_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7555_HIV). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tattgtccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718110_PreC_P-F Feature FT:CDS KP718110_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8728_HIV). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgcctactgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagctctcttccgggatgctttagaatcaccagaacattgctcacatcac
cataccgccctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgcagctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgcattatttttggaagagatatagttcttgartatttggtgtcttttggggtgtggattcgcactcctactgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718111_PreC_P-F Feature FT:CDS KP718111_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8827_HIV). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718112_PreC_P-F Feature FT:CDS KP718112_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-4910). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP718113_PreC_P-F Feature FT:CDS KP718113_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-3634). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctttaccgggatgctttagaatcacctgaacattgcacacctaac
cataccgctctcaggcaagctatcttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggacctagtggttaactatgttaatactaatatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttag
>gnl|hbvcds|KP995097_PreC_P-F Feature FT:CDS KP995097_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgcttctgtggagttactctcgtttttacctgctgatttcttcc
cttcggctcgggacctattcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactccccac
catactgctctcaggcaagctattttgtgttggggtgagttaacgactttggcttcctgggtgggcaataatttggatga
cgctgcagctagggatttagtagttaactatgttaacactcacatgggcctaaaaattagacaattgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttgttcagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatcaatgcttccggaagttgctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995098_PreC_P-F Feature FT:CDS KP995098_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995101_PreC_P-F Feature FT:CDS KP995101_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 63-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
catctgttcgggacctactcgacaccgctgcagccctttaccgggatgctcttgagtcaccggaacattgctccccccat
cacaccgctatcaggcaaattattttgtgctggggtgagttaatgtctttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacaataatatgggcctgaaaattagacaaatgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactccacctccc
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagaggacgaggcagggcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtggcagaagatctcaatctccgtcttcccgatgttag
>gnl|hbvcds|KP995104_PreC_P-F Feature FT:CDS KP995104_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 81-Cirrhosis). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttcttcc
catcggttcgggatctactcgacaccgcttcagctctttaccgggatgctctagagtcacctgagcattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995105_PreC_P-F Feature FT:CDS KP995105_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 134-Cirrhosis). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgctcgggacctactcgacaccgcttcagccctttaccggcaagctctagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattttgtgctggggtgaattaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagacacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagacctccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995106_PreC_P-F Feature FT:CDS KP995106_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 143-Cirrhosis). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctggagtccccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctaaaaattagacaaatgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacaggct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995107_PreC_P-F Feature FT:CDS KP995107_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 201-HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtctcactgttcaagcctccaagctgtgccttgggtggct
ttgaggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgctctcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtctcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995109_PreC_P-F Feature FT:CDS KP995109_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-Cirrhosis). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctgtcatttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctggagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattgtgtgctggggtgaggtaatgactttggcttcctgggtgggtcataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgtt
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995110_PreC_P-F Feature FT:CDS KP995110_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995111_PreC_P-F Feature FT:CDS KP995111_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 234-Cirrhosis). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaattgctctcttttttgcctattgatttcttcc
cgtctgttcgggacctactcgacaccgctacagccctataccgggatgctctagagtcaccggaacattgcaccccccat
cataccgctctcaggcaaactgttttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctcct
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttaa
>gnl|hbvcds|KP995113_PreC_P-F Feature FT:CDS KP995113_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2351-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaattcggagcttctgtggagttactctcgtttttgcctcctgatttcttcc
catcggttcgggacctaatcgacaccgcttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaac
catactgctatcaggcaagttcttttgtgctggaatgagttaatgacttttgcttcctgggtgggcgagaatttggatga
ccctgcagctaggaattcagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgcctcacttttggaacacaaacagttgttgagtatttggtgtcttttggagtgtggattcgcactcctcttcct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995114_PreC_P-F Feature FT:CDS KP995114_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2369-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgatttcttcc
catcggttcgggatctactcgacaccgcttcagctcttcaccgggatgctttagagtcacctgagcattgctctccccac
catactgctatcaggcaagctgtttcgtgttggggtgaattaataactttggcttcctgggtgggcaataatttggatga
ccctgcagctagggatttagtagttaactatgttaacactcacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgcctcacttttggaagacaagtagttcttgagtatttggtgtcttttggagtgtggattcgcactcctgctcct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995115_PreC_P-F Feature FT:CDS KP995115_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2370-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttgctctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagccctttaccgggatgccttggagtcacctgagcattgctctccccac
catactgctctcaggcaagctattttgtgttgggatgagttaatgattttcgcttcctgggtgggcaataatttggacga
ccctgcatctagggatttagtagttaactatgttaacattaacatgggcctcaaaattagacgactgttgtggtttcaca
tttcctgcatcatgtttggaagagacctagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccaaat
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccatcttcccgatgttag
>gnl|hbvcds|KP995116_PreC_P-F Feature FT:CDS KP995116_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2503-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctataccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995117_PreC_P-F Feature FT:CDS KP995117_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2504-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgcggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995118_PreC_P-F Feature FT:CDS KP995118_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2517-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgagatgcgctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
tcctgcagctagggatttagtagttaattatgtcaacacaaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995119_PreC_P-F Feature FT:CDS KP995119_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2524-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctactgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccagaacattgcaccccccat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacaataatatgggcctgaaaattagacaactgttatggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995120_PreC_P-F Feature FT:CDS KP995120_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2579-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgctactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995123_PreC_P-F Feature FT:CDS KP995123_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X10-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995124_PreC_P-F Feature FT:CDS KP995124_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X11-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995125_PreC_P-F Feature FT:CDS KP995125_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X13-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP995126_PreC_P-F Feature FT:CDS KP995126_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X14-Chronic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttggtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KT896494_PreC_P-F Feature FT:CDS KT896494_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MAN183). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtctcactgttcaagcctccaagctgtgccttgggtggct
ttgrggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggctcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactccccac
catactgctctcaggcaagctattttgtgttgggttgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcctatccacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctaaatctccatcttcccaatgttag
>gnl|hbvcds|KX264496_PreC_P-F Feature FT:CDS KX264496_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1-ame). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KX264497_PreC_P-F Feature FT:CDS KX264497_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F2-ame). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KX264498_PreC_P-F Feature FT:CDS KX264498_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F3-ame). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tataggccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KX264499_PreC_P-F Feature FT:CDS KX264499_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4-ame). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KX757665_PreC_P-F Feature FT:CDS KX757665_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate TH6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=639 residues).
atgcaactttttsacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaactactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagaatcaccggaacattgcacmccyaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtggggaataatttggaaga
tcctgcagctagggatctagtggttaactatgtcaacactaatatgggcctgaaaattagacaattactgtggtttcaca
tctcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcytttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctmgaag
aagaactccctcgcctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY382411_PreC_P-F Feature FT:CDS KY382411_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_wt). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY382415_PreC_P-F Feature FT:CDS KY382415_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_wt). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY382416_PreC_P-F Feature FT:CDS KY382416_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_double_mut). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY382417_PreC_P-F Feature FT:CDS KY382417_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_quadruple_mut). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagyggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY458061_PreC_P-F Feature FT:CDS KY458061_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY458062_PreC_P-F Feature FT:CDS KY458062_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgccagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476322_PreC_P-F Feature FT:CDS KY476322_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV01). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476323_PreC_P-F Feature FT:CDS KY476323_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctcgtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476324_PreC_P-F Feature FT:CDS KY476324_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttctacc
cgtcagttcgggacttactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacttagtggttaactatgtcaatactcacatgggcctaaagattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaagtagttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|KY476325_PreC_P-F Feature FT:CDS KY476325_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcaactcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccggaacattgcacccatcac
cataccgctctcaggcaagctatagtgtgctggttggaggtaacgactttggcttcctgggtgggcaataatttggacga
tcctgctgctagggacctcgtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctattgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476326_PreC_P-F Feature FT:CDS KY476326_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgytccccccat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaaga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagaccaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcctatccacacttccggaaactgctgttgttagaggacgaggcrggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476327_PreC_P-F Feature FT:CDS KY476327_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctcttgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacttagtggttaactatgtcaatactaacatgggcctaaagattagacaattactgtggtttcaca
tttcctgccttacgtttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476328_PreC_P-F Feature FT:CDS KY476328_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctgrtgatttcttyc
cgtcaattcgggacctactcgacaccgctgcagccctctaccgggatgctttagaatcatcggaacattgcacccatcac
cataccgctctcaggcaagctatattgtgctggggtgaggtaatgaatttggcttcctgggtgggcaataatttgcaaga
tcctgctgcaagggacctcgtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacg
tttcctgccttacttttggaagagaagtagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttrttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476329_PreC_P-F Feature FT:CDS KY476329_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaattcggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcaattcgggacctactcgacaccgcttcagccctctaccgggatgctttagagtcacctgaacattgctcacctaac
cataccgctctccggcaagctatattgtgctggaatgaggtaacggagtttggtaactgggtgggcaataatttggaaga
tcctgctgccagggacttagtggttgactatgtcaatactaacatgggcctaaagattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaagtagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaagctactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|KY476330_PreC_P-F Feature FT:CDS KY476330_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatatggagcttccgcggaattactctcttttttgcctactgatttctacc
cgtcagttcgggacctactcgacaccgctcaagcccttttccgggatgctttagaatcaccagaacattgcacacctcac
cataccgctctcaggcatgttatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcaca
cttcctgccttacttttggaagagaagtagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccaggttcccgatgttag
>gnl|hbvcds|KY476331_PreC_P-F Feature FT:CDS KY476331_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV43). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacttagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgtt
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY476332_PreC_P-F Feature FT:CDS KY476332_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV47). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098564_PreC_P-F Feature FT:CDS MG098564_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_050). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcnacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccttatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098565_PreC_P-F Feature FT:CDS MG098565_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_111). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcaccccctct
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgtcaacaataacatgggcttaaagattagacaattattgtggtttcaca
tttcctgcctaacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098566_PreC_P-F Feature FT:CDS MG098566_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_113). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttctacc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccagaacattgcacccaccat
cataccgctctcaggcaagctattttgtgttggaatgaattaatgacttttgcttcctgggtgggcaataatttggatga
ccctgcagccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaactattgtggtttcacg
tttcctgccttacttttggaagagaagtacttcttgagtatttggtgtcctttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcacacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MG098569_PreC_P-F Feature FT:CDS MG098569_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctcatgatttctacc
cgtccattcgggacctactcgacaccgctgcagctctcttcagggatgctttagagtcaccggaacattgcaccccccac
catacagctatcaggcaagctattttgtgttggggtgaattaatggttttcgcttcctgggtgggcaacaatttgcagga
ccctgcatccagggatttagtagttgactatgttaacattaacatgggcttaaagattacacaattattgtggtttcaca
tttcctgcctaacttttgaaagagaaacagttcttgagtatttggtgtcctttggagtgtggcttcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgttag
>gnl|hbvcds|MG098570_PreC_P-F Feature FT:CDS MG098570_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_117). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgacttcttcc
cgccggttcgggacctactcgacaccgcttcagccctatacagggatgctttagagtcaccggaacattgcactccccat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacaataacatgggcttaaaaattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaantagttcttgagtatttggtgtcctttggggtgtggatacgcactcctctacct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactggtgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|MG098573_PreC_P-F Feature FT:CDS MG098573_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_121). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgcttctgtggaattgctctcttttttgcctattgatttcttcc
cgtcggctcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgctccccccat
cataccgctatcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgcctaatgtttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccagcaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgaagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098574_PreC_P-F Feature FT:CDS MG098574_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_122). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgattttggcttcctgggggggcaatattttggagaa
ccctgcagccggggatttattagttaactctgttaacactcacgtgggcttaaagatgaaacaattattgtggtttcaca
tttcctgcctaatttttgaaagaaaaacagttcttgagtatttggagtactttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098575_PreC_P-F Feature FT:CDS MG098575_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_123). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaanctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttctacc
cgtcagttcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccaaaacattgctccccccat
cataccgctatcaggcaagctgttttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcttaaagattagacaattattgtggtttcaca
tttcctgccttacttttggaagacaaacagttattgagtatttggtgtcctttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacatcgaggcaggtccactagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtctcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098577_PreC_P-F Feature FT:CDS MG098577_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_125). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcctttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctaatgatttcttcc
cgtcggctcgggacctactcgacaccgcttcagctctctacagggatgctttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttgggatgaattaatgacttttgctgcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacattaacatgggcttaaagattagacaattattgtggtttcaca
tttcctgcctaacttttggaagagaaacagttsttcagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgaaaacgaaggtctcaatcgccgcgtcgcaaaaaatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098578_PreC_P-F Feature FT:CDS MG098578_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_126). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgcctwctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctctacagggatgctttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgccgccagggatttagtagttaactatgttaacactcatatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagaccaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctgcacct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagaggacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098579_PreC_P-F Feature FT:CDS MG098579_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_127). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacatygacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgctwcagccctcttcaaggatgctttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctgttttgtgttggggtgaattaatgaatttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacavtcacatgggattaaagattagacaaatattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctgcacct
tatagaccaccaaatgcccctatcctatccacacttccggaarttactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|MG098580_PreC_P-F Feature FT:CDS MG098580_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_128). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcacttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagccctcttcagggatgctttagagtcaccggaacattgcaccccccat
cataccgctctcaggcaagctattgtgtgttggaatgaggtaatagctttggcttcctgggtgggcaataatttggatga
ccctgcagccagggatttagtagttaactatgttaacactaacatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttgggagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098582_PreC_P-F Feature FT:CDS MG098582_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_142). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcggaacctactcaaccccgcttcacccctccacagcgatgctttaaagtccccggaactttgcccccccaat
cataccgctctcaggcaasttatttcgtgttggggtgaattaataactttggcttccggggtgggcaataatttgaagaa
ccctgctgccagggatttattatttaactatgttaacactaatatgggcttaaagataaaacaactatgatggtttcaca
tttcctgccttagttttgaaagagaaacatttcttgagtatttggtgtcttttgaagtgtggattcgcactcctccagct
tatagaccaccaaatgcccttatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcggaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG098583_PreC_P-F Feature FT:CDS MG098583_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_146). Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggtgcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtcggttcgggacctactcgacaccgcttcagctctctacagggattctttagagtcaccggaacattgctccccccat
cataccgctctcaggcaagctatttcgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactcacatgggcgtaaagatgagacaatatttgtggtttcacg
tttcctgccttatgtttggaagagatacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccacaaaatgcccctatcctatccacacttccggaaacttctgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MG098584_PreC_P-F Feature FT:CDS MG098584_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate D42). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcacttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttgctctcttttttgccttctgatttctttc
cttcggttcgggacctactcracaccgcttcasccctcttcagggatgctttaragtcaccggaacwttgcaccccccat
cataccgctctcaggcaagctattgtgtgttgaaatgaggtaatagctctagcttcctgggtgggcaataatttgratga
acctgcatctagggatttagtagttaactatgttaacactaatatgggcctaaagatcaaacaactatngtggtttcaca
tttcctgccttacttttgggagagaaacagttcttgagtatttggtgtcctttggagtgtggattcccactcctcctgca
tataaaccacaaaatgcccctatcctatccacacttccggaaactactgttgttagacgaagaggcaggtcccctaaaac
aagaactccctcgcctcgcaracgaaggtctcaatcgccgcgccgcaaaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|MH051986_PreC_P-F Feature FT:CDS MH051986_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B106W). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
catactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH051987_PreC_P-F Feature FT:CDS MH051987_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B127W). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcc
cgtctgttcgggacctactcgacaccgcttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaat
catactgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctggcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK058437_PreC_P-F Feature FT:CDS MK058437_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgacttcttcc
cgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaac
cataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaaga
tcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X69798_PreC_P-F Feature FT:CDS X69798_PreC_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcc
catcggttcgggacctactcgacaccgcttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaac
catactgctctcaggcaagctattttgtgttggggtgagttaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagctagggatttagtagttaactatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X75658_PreC_C-F Feature FT:CDS X75658_PreC_C-F of [Viruses] Hepatitis B Virus genotype F (isolate Fou). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtttatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgttctcttttttgccttctgacttctttc
cgtcaatccgagaccttctcgacaccgcctcagctctgtatcgggatgcgttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgttggggtgaattaatgactttggcttcctgggtgggcaataatttggagga
ccctgcagccagggatttagtagttaactatgttaacactaatatgggcttaaagattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X75663_PreC_P-F Feature FT:CDS X75663_PreC_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9203). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattgttctcttttttggcttctgacttctttc
cgtctgttcgggacctcctcgacaccgcctcagccctgtaccgggatgccttagagtcaccggaacattgcacccccaat
cataccgctctcaggcaagctattttgtgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaaga
ccctgcagctagggatttagtagttaattatgtcaacactaatatgggcttaaagattagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgct
tatagaccaccaaatgcccctatcctatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
© 1998-2020Legal notice