HBVdb

Dataset for nucleotide sequence Genomes of genotype F

[Download (right click)] [Alignment] [Repertoires]

258 sequence(s)

>gnl|hbvnuc|AB036911_FT00000_P-F Feature FT:source AB036911_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8255). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaattgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036913_FT00000_P-F Feature FT:source AB036913_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8346). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcgaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036914_FT00000_P-F Feature FT:source AB036914_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8349). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggyacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036916_FT00000_P-F Feature FT:source AB036916_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8371). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaacctcgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB116549_FT00000_P-F Feature FT:source AB116549_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactcactacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacaaaaaatcaaagattgttttcggaaacttcct
gtaaatcgaccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaccattatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggatctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgctttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB116552_FT00000_P-F Feature FT:source AB116552_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaacttaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcaaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcgggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB166850_FT00000_P-F Feature FT:source AB166850_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL592). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtctcctcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaaaactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatatcattggtagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttttgggctttgctgctcctttcacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgcaaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaatagtcttacataacaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggcgcttctgcggaattgctctcttttttgccttctgatttctttccgtcggttcgggatctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcactcccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaaaattagacaactattgtggtttcacatttcttgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccatacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttccgctggagaaaggcattaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatcctctcgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcaaagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggagcatacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcctccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AB365446_FT00000_P-F Feature FT:source AB365446_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcgggacagacaactctgttgtcctctctmggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcctggagaccaccgtgaacgccccctggagtttgccaatagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccagtcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgaatgttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaattattgtggtttcacatttcctgcctttsttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|AB365449_FT00000_P-F Feature FT:source AB365449_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL93). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactccyaggacccctgctcgtgttacaggcggtgtgtttcttgtggacaaaaatcctcaaaacacc
acagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaacacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgtwcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacataaaatcaaagaatgttttagaaaacttcct
gtaaatcgcccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctmggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcrtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggaggctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttgcaggaccctgcagcaagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggt
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AB365450_FT00000_P-F Feature FT:source AB365450_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL102). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccatcaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctmtatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagtyatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggatcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagycttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctamtgattwctwcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattkcaccccccatcatamcgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatgaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctytggagtgtggatacgcactcctccascttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcmgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccactyaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggcattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AF223965_FT00000_P-F Feature FT:source AF223965_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtactctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AY090455_FT00000_P-F Feature FT:source AY090455_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctcttacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcactttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagagtgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgccgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattaccgctaaacaggcttttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggat
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atttcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggacttagttgttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccaggttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcctctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatatacctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
ccgggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AY090459_FT00000_P-F Feature FT:source AY090459_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggctatactttaaatttcatgg
gatatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagactgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttacacaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcctttgtcttttcgccaacttacaaggcctttc
tatgtcaccaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagatcctgcagatagggacytagtggttaa
ctatgttaatactaatatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctaacaaaaaatgaattaagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgacacgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgctggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AY179735_FT00000_P-F Feature FT:source AY179735_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagagggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctcttttcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ823088_FT00000_P-F Feature FT:source DQ823088_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaawctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggwtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctstaccgccctctactgcgtctgcygttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggwccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaraggactmttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823090_FT00000_P-F Feature FT:source DQ823090_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaacttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactgggtaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899143_FT00000_P-F Feature FT:source DQ899143_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao189). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgagcatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
ggtatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgccaaacaggcttttgtcttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgctttcaatcctaactggtccactccttcttttcctgatattcatttgca
tcagaacctgatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattacgaagattgaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctacggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttacatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgctaacaaccttgtcagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899144_FT00000_P-F Feature FT:source DQ899144_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira75). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaaaggctctgtattttcctgctggtggctccagttcaggaa
cacaaaaccctgctccgactattgcctctctcacatcatcaatctactcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaagagatggggttacaccctacattttatgg
gttatgtcattggtagttggggatcattacctcaagatcatattgttcacaaaatcaaagaatgttttcgaaaacttcct
gtaaatcgtccaattgattggaaagtctgtcaacgcattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgctctcatgcctctgtatgcttgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgccaggcaacggccgggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacacaagaggactcttggactttcaggag
ggtcaatgacctggattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaagtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgatttctttccatcggttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgctgccagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagacctaatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattaaggaggttaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggagaaaggaatcaagccttattatcgtgagcatgcagtt
aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcatcattttgtgggtcaccatattcctgggaacaagaggtacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggatacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacaaggtatgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctgtaagagacactcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899150_FT00000_P-F Feature FT:source DQ899150_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Colombia8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacaggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatcggtgggtatccatttaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacattaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggtcaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccaacaccatggaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatctagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaattgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctaatattcatttaca
tcaagatctgatatctaaatgtgaacaattggtaggcccgttcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttactaaatattttcctatggagaaagggattaaaccctattatcttgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacaggtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttctttccagaccatcaggtggatccgatattcagagcaaattc
cagcagttccgagtgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgatggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggaccgggagaaagccaaccccagtctctccacctctaagagacacacatcccca
ggccgtgcagtggaa
>gnl|hbvnuc|EF576812_FT00000_P-F Feature FT:source EF576812_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgcgccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacwcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|EU366132_FT00000_P-F Feature FT:source EU366132_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA95). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtatcttyctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaagacccctgctcgtgttacaggcggtgtttttctcgttgacaaaaatcctcacaattcc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctctaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccat
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacatgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctagggaattgctctcttttttgcctaatgatttctacccgtcggctcgggacctactcgacaccg
ctacagccctctacagggatgctttagagtcaccggaacattgctccccccatcataccgttatcaggcaagctgttttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagtgaa
ctatgttaacactaccgtgggcctaaagcttagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttgttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtaccttctttcaatcctcattggttaactcctcattttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtccagattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggac
>gnl|hbvnuc|FJ657529_FT00000_P-F Feature FT:source FJ657529_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA109). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709458_FT00000_P-F Feature FT:source FJ709458_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccttgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagagggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagtacgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709462_FT00000_P-F Feature FT:source FJ709462_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatccctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tsaagatttgatacacaaatgtgaacaatttgtaggccctctcacgaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709463_FT00000_P-F Feature FT:source FJ709463_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttakaccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709464_FT00000_P-F Feature FT:source FJ709464_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HE981181_FT00000_P-F Feature FT:source HE981181_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggagtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|HM585188_FT00000_P-F Feature FT:source HM585188_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgagatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585191_FT00000_P-F Feature FT:source HM585191_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccttgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagtacgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585192_FT00000_P-F Feature FT:source HM585192_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctttgtatgcctgtataactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcactgacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585193_FT00000_P-F Feature FT:source HM585193_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttacaccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcatatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585194_FT00000_P-F Feature FT:source HM585194_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgacctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgcggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagagcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttgggatggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585197_FT00000_P-F Feature FT:source HM585197_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585198_FT00000_P-F Feature FT:source HM585198_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccttgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagtacgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585199_FT00000_P-F Feature FT:source HM585199_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585200_FT00000_P-F Feature FT:source HM585200_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactctgttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggattgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgacctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagagcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM590471_FT00000_P-F Feature FT:source HM590471_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtacgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaactactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggcccgctcacaaaaaatgaattgagaagattaaaattggttatgc
catctagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM590473_FT00000_P-F Feature FT:source HM590473_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgagatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM622135_FT00000_P-F Feature FT:source HM622135_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggacacctaggacccctgctcgtgttacaggcggtgtgttccttgttgacaaaaatccgcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgccaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggcttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgcggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaattactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN688699_FT00000_P-F Feature FT:source JN688699_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV133). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtangcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattanacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctngaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN688703_FT00000_P-F Feature FT:source JN688703_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV137). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcraaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN792917_FT00000_P-F Feature FT:source JN792917_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-05260). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagggtaagggatctgtatcttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagcttcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggga
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgcggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttgcaagatcctgctgctagggaccaagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tgaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN792919_FT00000_P-F Feature FT:source JN792919_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-13282). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgtcctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtaccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgattttcgcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatattaacatgggcctaaaaattagacgattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggacacataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttaatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtggttcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcaatggaa
>gnl|hbvnuc|JN792920_FT00000_P-F Feature FT:source JN792920_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8327-05424). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggtacagacaactctgttgtcctctcccggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcattgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctggtgctagggacctagtggttaa
ctatgtcaatamtaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcytscttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN792921_FT00000_P-F Feature FT:source JN792921_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03738). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcmactcagttccaccarrctctgttaratccsagggtaagggctctgtayttycctgctggtggctccagttcagrga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggamyacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgytggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
amttccaggatccacgaccaccagcacgggaccmtgcaaaacctgcacaactcttgcwcaaggaacctctatgtttccct
cytgytgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtmgggctttcccccac
tgtytggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttaywccctamatttyatgg
gttatgtyattggyagttggggatcattaccmcaagatcacattgtacamaaaatcaargawtgctttcgwaaactgcct
gtaaatcgtccwattgattggaaagtwtgtcaacgcatwgtgggtcttttgggctttgcygccccyttyacycaatgygg
ttatcctgctctcatgcctctgtatgcctgtatwactgctaaacaggcttttgtcttytcgccaacttacaaggcctttc
trtgtmaacaatacatgaacctttacccsgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctwgcagcttgtttcgctcgcagcmggtctggagcgamwctcatcggcacrgacaaytctgttgtcctctctmggaagt
acacctccttyccatggctgctmggwtgtgctgcmaactggatcctrcgcgggacgtcctttgtttacgtcccrtcggcg
ctgaatccmgcggacgayccctcycggggtcgcttggggctgtaycgcccycttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggmctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggarttactctcktttttgcctkctgatttcttcccrtcrgttcgggacctactcgacaccg
cttcagcyctytaccgggatgctttagartcaccwgaacattgcacwccyaaccatacygctctcaggcaagctatwttg
tgytggggtgagttaatgactttggcttcctgggtgggcaataatttggargaycctgswgctagggayytagtrgttaa
ctatgtyaayactaacatgggcctmaaaattagacaaytrytgtggtttcacatttcctgccttacttttggaagagaar
yagttctwgagtatttggtgtcytttggagtgtggattcgcactcctcctgcttayagaccaccaaatgcccctatcyta
tccacacttccggaaactactattattagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccggcttcccgatgttagtattccttggactcatarggtgggraac
tttackggrctytaytcytctactgtkcctrcttttaatcctractggtymactccttcttttcctgayattcatttrca
tcaagayytgatwymyaaatgtgaacaatttgtaggcccwctyacwaaaaatgaattrmgaagattaaaattggtyatgc
cakcyagattttwtcctaaggttaccaaatattttccyatggawaarggmatyaaaccctattatcctgakmacgyrgtt
aatcattaytttaaraccagacaytatttgcatactttatggaargcrggaattytatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcytgggaacaagagctacagcatgggagcacctctmtcaacgacwcgaagrggc
atgggacagaatctctctgtrcccaatcctctgggattctttccagaccatcagctggatcckctrttcagrgcaaattc
cagcagtcccgactgggacttcaacamaaacaaggacarttggccaatggcaaacaaggtaggagtgggagsmtacggtc
cwgggttcacacccccacacggtggcctgytggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcccgcttccaccaatcggcggtccgggagaaarccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|JN811655_FT00000_P-F Feature FT:source JN811655_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 3Mg). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcgtgagtccctttataccgctgt
taccaattttctgctatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttrtggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgactgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|JN811656_FT00000_P-F Feature FT:source JN811656_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 4Mg). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatcaatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttatgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatagaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|JX079936_FT00000_P-F Feature FT:source JX079936_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccgcaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacgcgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactcagttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccaccttcccactgttagtattccttggactcataaggagggaaas
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacaaggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KC494395_FT00000_P-F Feature FT:source KC494395_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR11-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacaccaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494396_FT00000_P-F Feature FT:source KC494396_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR10-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtatgggctctgtactttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatctttccgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacatgcggtgtgtttcttgttgacaaaaatcctcacaatgcc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacagtttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacatacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatactgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttccggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggaaagtaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttctttccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactccccaccataccgctctcaggcaagctatttta
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggacgaccctggagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaagttagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctcgagtatttggtgtcctttggagtgtggattcgcactcctccggcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacagggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494399_FT00000_P-F Feature FT:source KC494399_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR7-CENTRAL). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggaa
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttcttgttgataaaaatcctcataatgcc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gatatgtcattggtagttggggatccttaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccmctggagtttgccaacagccttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttaccttctgatttctacccatcggttcgggacctaatcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgctctccccaccatacggctctcaggcaagctgttggg
tgttggggtgaggtatcgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcctaaaacttagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttgtagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccagtaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgtttttaatcctaattggtccactccttcttttcctgatattcatttgca
tcaagatctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacaccaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctgggatggagccctcaagcacaaggtgtgttaacaaccttgccagcagaa
ccgcctcctgcttccaccaatcggaggtccgggagaaagccaaccccggtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494403_FT00000_P-F Feature FT:source KC494403_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR3-NORTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgtcaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtctactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494405_FT00000_P-F Feature FT:source KC494405_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR1-NORTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgtcaaccagcaccatgcacctttttcacctctgcctaatc
attttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcacacctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccacgccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaagtacgaagattaaaattggttatgc
cagctagattgtatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KF199901_FT00000_P-F Feature FT:source KF199901_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate RVLA). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctgggtgctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaaccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcagccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctagaaacttkyymacmkyykymyawwmryskwytsttsatstyyyaskrw
kgtmracymcmwggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ586806_FT00000_P-F Feature FT:source KJ586806_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggggagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaggcgggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgaccaatcctctg
ggattctttccagaccatcagctggatcctctattcagggcaaattccagcagtcccgactgggacttcaacaaaaacaa
ggacaattggccaatggcaaacaaggtaggagtgggaggatacggtcctgggttcacacccccacacggtggcctgttgg
ggtggagtccacaggcacagggtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcggcggtccggg
agaaaaccaaccccagtctctccacctctaagagacactcatccacaggccatgcagtggaa
>gnl|hbvnuc|KJ638660_FT00000_P-F Feature FT:source KJ638660_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT030). Complete genome. [Hepadnaviridae] (length=3215 residues).
caccacccagttccaccaggctcttcaagatcccagagtcagggccctgttgagtcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcwcgaagactgggggccctgttatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaawctgtgcmgcatcttgagtccctttataccgctgt
taccaattttctgttatctttgggtatccatttaaatacttctaaaacaaaaaggtggggttacamcctaaactttatgg
gatatgtcattggcagttggggaacattaccacaagatcatattatacataagatcaaagaatgttttcgaaaacttcct
gtaaaccgtccgattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgctgccccttttacccaatgtgg
gtaccctgctctcatgcctctgtacgcttgtatyactgctaaacaggcgtttgttttttcgccaacttacaaggcctttc
tctgtaaacagtacttgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtgccccctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagcaggtctggggcgaacctcatcggcacggacaactctgtcgtcctctccaggaaat
acacctcctttccatggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctttrccgccctcttctccgtctcccgttccagccgacgac
gggtcgcacctctcttttcgcggactccccgtytgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacaaccgtgaacgccccctggagtttgccaacagccttacataagcggactcttggactgtcaggac
ggtcaatgacctggatcgaagattacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagataaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatygacccttataa
agaatttggmgcttctttagaattgctctcttttttgcctyctgatttctttccgtcgrytcgggacctcatcgacaccg
cttcagccctctaccgggatgcattagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattgtg
tgttggggtgaggtaatgactttggctgcctgggtgggccataatttggaggaccctgcagctagggatttagtagtgaa
ttatgtcaatactaacatgggcctaaaaattagacaactattgtggtttcacatttcctgccttacttttggaagagaag
tagttcttgagyatttggtgtccttcggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccctatccta
tccacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagtagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctattctgctactgtacctactttcaatcctaactggttgactccgtcttttcctgatattcacttgca
tcaagaccttatatctaagtgtgaacaatttgtgggtccactcactaaaaatgaattacggagattgaaattggttatgc
ctgctagattttttcctaaggttaccaaatattttccactggaaaaaggtattaaaccttactatcctgagcatgcagtt
aatcattactttaaaacccgacactatttgcatactttatggaaggcgggaattttatataagagagaatccacacatag
cgcctcattttgtgggtcaccatactcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacgcccccgcacggtggcctgctggggtggagccctcaagcacaaggtgttttaaccaccttgccagcggat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacacccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ676694_FT00000_P-F Feature FT:source KJ676694_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagtttcaccaggccctgttagacccaagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtattacaggcggtgtctttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctcggggaactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcccct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttacaatctacattttatgg
gttatgtcattggcagttggggatcattaccccaagagcatattgtacaaaaaatcaaagaatgttttcggaaaattcct
gtacgycgtccaattgattggaaagtttgtcaacgtattgtgggtttattgggctttgctgcccctttcacacaatgtgg
ttatcctgctctcatgcccttatatgcctgtattaccgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgcgactcatcggcacggacaactctgttgtcctttctcggaagt
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctccgtctgccgttcctkccracgac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgmatggagaccaccgtgaacgcccacyggagtytgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgnncaccagttccatgcaactttttcacctctgcctaatc
nncttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggcgcttctctggaattgctctcttttttgccttctgatttctacccttcggttcgggacctaatcgacaccg
cttcagccctctacagggatgcgttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
tgttggacagaggtaatgactctggcttcctgggtgggcaataatttggaagaccctgcagctagggatttagtagttaa
ctatgttaacactcacatgggcctaaagatyagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctacatatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacgggactctattcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagacctgatatctaaatgtgaacaatttgtgggcccacttactaaaaatgaattaagragrttgaaattggttatgc
cagctagattctttcctaaacataccaaatattttcctctggaaaaaggaattaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacttag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagagcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtggggggctacggtc
cagggttcacacccccacacggtggcttgctgggatggagccctcaggcacaaggtgttctaacaaccttgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggccrtgcagaacaa
>gnl|hbvnuc|KJ843169_FT00000_P-F Feature FT:source KJ843169_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtcaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactgctgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843170_FT00000_P-F Feature FT:source KJ843170_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag08). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgttgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843178_FT00000_P-F Feature FT:source KJ843178_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacgcgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacaaggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843180_FT00000_P-F Feature FT:source KJ843180_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctcaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccgtcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843181_FT00000_P-F Feature FT:source KJ843181_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctcaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggagcctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagctctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttgggttggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843185_FT00000_P-F Feature FT:source KJ843185_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgccgcgccgtttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttaggggaggagatcagggca
aaggtctttgtactaggaggctgtaggcataaaaaggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagggaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctcactgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcaaagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843190_FT00000_P-F Feature FT:source KJ843190_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcatattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatctggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843199_FT00000_P-F Feature FT:source KJ843199_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag38). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattaracaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattgaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843202_FT00000_P-F Feature FT:source KJ843202_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag42). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagagctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcatattgtacaaaaaatcagagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctgggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaacactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattaattatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843209_FT00000_P-F Feature FT:source KJ843209_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag49). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggaacgaatatcatcgggacggacaactctgtcgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacagggctctactcttctactgtacctgctttcaatcctcactgggtaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacgagaaggggc
atgggacagaatctctctgtgcccaatccactgggattcttgccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843213_FT00000_P-F Feature FT:source KJ843213_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag53). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacattaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacgatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843222_FT00000_P-F Feature FT:source KJ843222_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843223_FT00000_P-F Feature FT:source KJ843223_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr06). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaaaggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccaattgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcgttaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttataaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcctgggggtctaccgacctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataacaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttamagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatccgcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccgaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KM233681_FT00000_P-F Feature FT:source KM233681_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctgtgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtacgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcgaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcaaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaactactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggcccgctcacaaaaaatgaattgagaagattaaaattggttatgc
catctagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KM998715_FT00000_P-F Feature FT:source KM998715_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718104_FT00000_P-F Feature FT:source KP718104_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CL0004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactggggcccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggctataccctaaatttcatgg
gatacgttattggaagttggggatcattgccacaagaccacattgtacaaaaaatcaaagaatgctttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttacacaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcctttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactctcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagaatcacctgaacattgcacacctaaccataccgctctcaggcaagctatcttg
tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgcagctagggacctagtggttaa
ctatgttaatactaatatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactgtttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaattcgtaggccctctaacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgacacgaaggggc
atggggcagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaagcaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggagtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718110_FT00000_P-F Feature FT:source KP718110_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8728_HIV). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaatcagttccaccaggctctgttagatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaaccttcttgamgactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttactaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaactaaaagatggggttatactctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgcccccttcactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcgtttgtcttttcgccaacttacaaggcctttc
tttgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaacctcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aagatttatgtaataggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgcctactgatttcttcccgtcagttcgggacctactcgacaccg
cttcagctctcttccgggatgctttagaatcaccagaacattgctcacatcaccataccgccctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgcagctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacatttcctgcattatttttggaagagata
tagttcttgartatttggtgtcttttggggtgtggattcgcactcctactgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaattctgactggttaactccttcttttcctgacattcatttaca
tgaagatttgatacagaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtggggaagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718112_FT00000_P-F Feature FT:source KP718112_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-4910). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcgtttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgtacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcacgtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995097_FT00000_P-F Feature FT:source KP995097_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 5-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctcttacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatgcc
acagagtctagacttgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacatttcatgg
gttatgtcattggtagttggggatcattaccccaagatcacattagactaaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtctgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcgtttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcgccagcaccatgcaactttttgacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggcgcttctgtggagttactctcgtttttacctgctgatttcttcccttcggctcgggacctattcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactccccaccatactgctctcaggcaagctattttg
tgttggggtgagttaacgactttggcttcctgggtgggcaataatttggatgacgctgcagctagggatttagtagttaa
ctatgttaacactcacatgggcctaaaaattagacaattgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttgttcagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tcaatgcttccggaagttgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaagt
tttacggggctttactcttctactgtgcctgcctttaatcctgactggtccattccttcttttcctaatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatagacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacagggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccgaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995109_FT00000_P-F Feature FT:source KP995109_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 209-Cirrhosis). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttcaactcagttccaccaggctctgttggatccgagggtaagggctctgtcttttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatcgtattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacacaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacggacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctgtcatttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctggagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattgtg
tgctggggtgaggtaatgactttggcttcctgggtgggtcataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgtttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatctgatagctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaactagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttccgtgcccaatcccctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggggttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcaatggaa
>gnl|hbvnuc|KP995110_FT00000_P-F Feature FT:source KP995110_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 231-HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtgagggctctgtacttccctgctggtggctccagttcaggga
cacaaaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaagacctgcacagctcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattaccgctaaacaggcttttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttacggactgggaggagttgggtgaggagactaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatatacctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP995113_FT00000_P-F Feature FT:source KP995113_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2351-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaaaactcctaggacccctgctcgtgttacagggggtgtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccatttataccgctgt
ttctaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcgtaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattaccgctaaacaggcttttgtcttttcgccaacatacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgaatctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggatgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatcagccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaattcggagcttctgtggagttactctcgtttttgcctcctgatttcttcccatcggttcgggacctaatcgacaccg
cttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaaccatactgctatcaggcaagttcttttg
tgctggaatgagttaatgacttttgcttcctgggtgggcgagaatttggatgaccctgcagctaggaattcagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgcctcacttttggaacacaaa
cagttgttgagtatttggtgtcttttggagtgtggattcgcactcctcttccttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaaccctctgggattctttccagaccatcagctggatccgctattcagaacaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP995116_FT00000_P-F Feature FT:source KP995116_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2503-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctggtatctgtgggtatccatttaaatacctcgaaaaccaaacgatggggttataccctaaatttcatgg
gttatgtcattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaagcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctataccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaagagtgggaggctacggtc
ctgggttcacaccaccgcacggtggccttttggggtggagtccacaggctcagggtgtacttacaactttgccagcagat
ccgcctcctgcttccaccaatcggcggtcagggagaaagcccaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995120_FT00000_P-F Feature FT:source KP995120_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2579-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatgcctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgcccacagtcttacataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgctactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataggagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP995124_FT00000_P-F Feature FT:source KP995124_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X11-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccatcaggctctgttagatccgagggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtacacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctccaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttggtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaagctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttgacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KT896494_FT00000_P-F Feature FT:source KT896494_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate MAN183). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaacttctgttggatcccagggtaagggctctgtgcttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgacgactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacatacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatatatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtctcactgttcaagcctccaagctgtgccttgggtggctttgrggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggctcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactccccaccatactgctctcaggcaagctattttg
tgttgggttgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatccta
tccacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctaaatctccatcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
catctagattttatcctaaggttacaaaatattttcccttggataaaggcatcaaaccctattatcctgagcaygcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctytctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KX264497_FT00000_P-F Feature FT:source KX264497_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F2-ame). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KX264498_FT00000_P-F Feature FT:source KX264498_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F3-ame). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY382416_FT00000_P-F Feature FT:source KY382416_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_double_mut). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgccyctctcacatcatcaatcttctygaagactgggggccctgctaygaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggaycattaccacaagatcatattgtacaaaaaatcaragattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagyggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccarattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatataarararaatccacacgtas
cgcctcattttgkgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccaraccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaamcaaggacacttggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcggat
ccgcctcctgcttccaccaatcggcggtccgggagraaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY382417_FT00000_P-F Feature FT:source KY382417_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_quadruple_mut). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgccyctctcacatcatcaatcttctygaagactgggggccctgctaygaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggaycattaccacaagatcatattgtacaaaaaatcaragattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagyggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgaraarattaaaattagttatgc
catccarattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatataarararaatccacacgtas
cgcctcattttgkgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccaraccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaamcaaggacacttggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcggat
ccgcctcctgcttccaccaatcggcggtccgggagraaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY458061_FT00000_P-F Feature FT:source KY458061_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcayaaggtgggaaat
tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476325_FT00000_P-F Feature FT:source KY476325_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagtttcaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaaccttctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatctggagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaagagatggggttataccttaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatatcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
gatcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcaactcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccggaacattgcacccatcaccataccgctctcaggcaagctatagtg
tgctggttggaggtaacgactttggcttcctgggtgggcaataatttggacgatcctgctgctagggacctcgtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaaatgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
caacagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatatggtc
ccgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggaggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcaatggaa
>gnl|hbvnuc|KY476329_FT00000_P-F Feature FT:source KY476329_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV33). Complete genome. [Hepadnaviridae] (length=3215 residues).
cacccctcagttccaccaggctctgttagatccgagggtaagggctctgtgttttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactggggcccctgctacgaacatggac
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttaacaaaaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggcacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtatggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaactaaacgatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacacaaaatcaaggattgttttcggaaacttcct
gtaaatcgccctatagattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctgggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtgtcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagattacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtcggttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaattcggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcaattcgggacctactcgacaccg
cttcagccctctaccgggatgctttagagtcacctgaacattgctcacctaaccataccgctctccggcaagctatattg
tgctggaatgaggtaacggagtttggtaactgggtgggcaataatttggaagatcctgctgccagggacttagtggttga
ctatgtcaatactaacatgggcctaaagattagacaattactgtggtttcacatttcctgccttacttttggaagagaag
tagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaagctactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgaatggttaactccttcttttcctgacattcatttaca
tgaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagtagat
ccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccacacagtggaa
>gnl|hbvnuc|KY476330_FT00000_P-F Feature FT:source KY476330_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV37). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctcgcaattttctaggggaaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcccct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataacctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacacaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tacgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttatataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatatggagcttccgcggaattactctcttttttgcctactgatttctacccgtcagttcgggacctactcgacaccg
ctcaagcccttttccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctcaggcatgttatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacacttcctgccttacttttggaagagaag
tagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccaggttcccgatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacataaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctttggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccacctcctgcttccaccaatcggcggtcggggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476332_FT00000_P-F Feature FT:source KY476332_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV47). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccatcaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatctaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gatatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagaatgttttcgtaaacttcct
gtaaatcgccccattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttcacatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactttcaggaa
ggtcaatgacctggatcgaaggatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctaccttcaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|MG098566_FT00000_P-F Feature FT:source MG098566_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_113). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctcgctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactygtkgtggacttctctcarttttctaggggaactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatctggagtcgctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccccggagcttgccaacagtcttacataaacggactattggactttcgggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttacagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttctacccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccagaacattgcacccaccatcataccgctctcaggcaagctattttg
tgttggaatgaattaatgacttttgcttcctgggtgggcaataatttggatgaccctgcagccagggatttagtagttaa
ctatgttaacattaacatgggcttaaagattagacaactattgtggtttcacgtttcctgccttacttttggaagagaag
tacttcttgagtatttggtgtcctttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcacacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tgaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattattrgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacaraatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098569_FT00000_P-F Feature FT:source MG098569_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcayatcatcaatcttctsgaagactgggggccctgctatgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatrcc
acagagtctagactcgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctgsctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacattttatgg
gttatgtaattgggagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccmattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatrcctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctctyctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaa
agtcaatgacctggatcgaagaatacatcactgactgtgtatttaaagactgggaggagttgggggaggagtccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctcatgatttctacccgtccattcgggacctactcgacaccg
ctgcagctctcttcagggatgctttagagtcaccggaacattgcaccccccaccatacagctatcaggcaagctattttg
tgttggggtgaattaatggttttcgcttcctgggtgggcaacaatttgcaggaccctgcatccagggatttagtagttga
ctatgttaacattaacatgggcttaaagattacacaattattgtggtttcacatttcctgcctaacttttgaaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggcttcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattttttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggytacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098574_FT00000_P-F Feature FT:source MG098574_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_122). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcscagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcatggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggntttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacattttatgg
gttatgtaattggcagttggggatcattaccccaagatcatattgtacacaaaatcaaagaatgttttaraaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aagrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgattttggcttcctgggggggcaatattttggagaaccctgcagccggggatttattagttaa
ctctgttaacactcacgtgggcttaaagatgaaacaattattgtggtttcacatttcctgcctaatttttgaaagaaaaa
cagttcttgagtatttggagtactttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaacatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataaaagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaactgctgtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098575_FT00000_P-F Feature FT:source MG098575_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_123). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccaccacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcancccgtttctcatggctcaatttactagtgcaatttgttcagtggtgcgaagggctttcccccat
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctytataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttaraaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcttgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctagaaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagagtgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaanctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttctacccgtcagttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccaaaacattgctccccccatcataccgctatcaggcaagctgttttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggatgaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagacaaa
cagttattgagtatttggtgtcctttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacatcgaggcaggtccactagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccgcgtctcaaaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatgggaggcgggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098583_FT00000_P-F Feature FT:source MG098583_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_146). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcaaagccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggrtgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccatcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaawtaccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgaagccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggatcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtaggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcgggacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcatctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggtgcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggattctttagagtcaccggaacattgctccccccatcataccgctctcaggcaagctatttcg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcgtaaagatgagacaatatttgtggtttcacgtttcctgccttatgtttggaagagata
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatccta
tccacacttccggaaacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggacgcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcgacggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MK058437_FT00000_P-F Feature FT:source MK058437_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggaaggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcagccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctagaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaacgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|X69798_FT00000_P-F Feature FT:source X69798_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcgaaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttacccggttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|X75658_FT00000_C-F Feature FT:source X75658_FT00000_C-F of [Viruses] Hepatitis B Virus genotype F (isolate Fou). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcacttccaccaggctctgttggatccgagggtaagggcactgtattttcctgctggtggctccagttcaggca
cgcagaaccctgctccgactattgcctctctcacatcatcaatctcctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggagccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttcgaaaagttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtataactgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgcttcgctcgcagccggtctggagcaatcctcatcggcacagacaattctgtcgtcctctcccggaagt
atacatcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgaaccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtttatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgttctcttttttgccttctgacttctttccgtcaatccgagaccttctcgacaccg
cctcagctctgtatcgggatgcgttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaatatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatatttccctctggagaaagacattaaaccttattatccagagcatgcagtt
aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcaactggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcctccaccaatcggctgtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AB036905_FT00000_P-F Feature FT:source AB036905_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8248-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttracaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036909_FT00000_P-F Feature FT:source AB036909_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8339-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttracaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036910_FT00000_P-F Feature FT:source AB036910_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8251). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaaccttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagaccatattatacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggtacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtctcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
ccaggatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacaccccctcacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036912_FT00000_P-F Feature FT:source AB036912_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8323). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036919_FT00000_P-F Feature FT:source AB036919_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8381). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcmaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB064316_FT00000_P-F Feature FT:source AB064316_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagttccaccagactctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tgaagatttgatacacaaatgtgaacaatttgtagggcctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacagtgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB086397_FT00000_P-F Feature FT:source AB086397_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate JPF1130). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggmtctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacgtcaggactcctaggacccctgctcgtgttacaggcggcgtttttcttgttgataaaaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctaggggaaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaagatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccctgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgcctctggatttcttcccgtcagctcgggatctactcgacaccg
cttcagccctctaccgggaggctttagaatcaccagaacattgcacagctcaccataccgctctcaggcaagctatattg
tgctggggtgagttaacgactttggctacctgggtgggcaataatttggacgatcctgctgctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaaccagacaattgctgtggtttcacatttcctgccttagttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgccgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaacatgaattgagaagattaaaattggttatgc
cctccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatccggataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ccgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB116551_FT00000_P-F Feature FT:source AB116551_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatattattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccatggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctgtcgtttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaactagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcccctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB214516_FT00000_P-F Feature FT:source AB214516_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV-BL597). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtctcctcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttaattatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttataatttacatttcatgg
gttatgtcattggcagttggggagcattgccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctctgtataattgtatcagtgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcattggccttggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggtctcgcctgctgttccttctcatgtgccgcatcgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggcgcttctgcggaattgctctcttttttgccttctgatttctttccgtcggttcgggatctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcactcccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaaaattagacaactattggggtttcacatttcttgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagaatctttcctaaacttactaaatattttccgctggagaaaggcattaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcaaagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggagcatacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcctccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AF223964_FT00000_P-F Feature FT:source AF223964_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcatgctggtggctccagttcaggca
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY090458_FT00000_C-F Feature FT:source AY090458_FT00000_C-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggctatactctaaatttcatgg
gatatgttattggaagttggggatcattaccacaagatcacattgtacaaaaaatcaaagactgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttacacaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcctttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcagaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtaccgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcctgccaacagtcttacataagcggactcttggactctcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatcttg
tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgcagctagggacctagtggttaa
ctatgttaatactaatatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgaagaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcctctactgttcctacttttaatcctgactggttaactccttcttttcctaatattcatttaca
tcaagatttgataaacaaatgtgaacaatttgtaggccctctaacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagactagacactatttgcatactttatggaaggcaggcattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgacacgaaggggc
atgggacagaatctctctgtacccaatcctctgggattcttgccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaagcaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctggtttcacacccccacacggtggcctgctggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagggacactcatcccca
ggccatgcagtggaa
>gnl|hbvnuc|AY090461_FT00000_P-F Feature FT:source AY090461_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtactttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgctgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggctatactctaaatttcatgg
gatatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagcctgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccatttacacaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaagcaggcctttgttttttcgccaacttacaaggcctttc
tatgtcaacaatacatgcacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcggcttgtttcgctcgcagcaggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgcagctagggacctagtggttaa
ctatgttaatactaatatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctaacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaatcaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgacacgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgctggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY311369_FT00000_P-F Feature FT:source AY311369_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD4139). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatgggggtactccctacattttatgg
gctatgtcattggtagttggggatcattgccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcttagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacctacaaagcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcacgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgactcttaatggcacggacaattctgttgtcctatctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctactgttcaagcctacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatatacctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823087_FT00000_P-F Feature FT:source DQ823087_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcagccaagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaacacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttgcataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagtgccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtgcctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgcttacaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtgtctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823091_FT00000_P-F Feature FT:source DQ823091_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ823094_FT00000_P-F Feature FT:source DQ823094_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ823095_FT00000_P-F Feature FT:source DQ823095_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA45). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ899142_FT00000_P-F Feature FT:source DQ899142_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Warao152). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccatggtaagggctctgtatttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatctcctcgaagactgggggccctgctatgagcatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
ggtatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgccaaacaggcttttgtcttttcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactggaaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgccgatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgggcctgctttcaatcctaactggtccactccttcttttcctgatattcattggca
tcagaacctgatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattacgaagattgaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctacggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttacatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgctaacaaccttgtcagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899146_FT00000_P-F Feature FT:source DQ899146_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira80). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaaaggctctgtattttcctgctggtggctccagttcaggaa
cacaaaaccctgctccgactattgcctctctcacatcatcaatctactcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgccgcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaagagatggggttacaccctacattttatgg
gttatgtcattggtagttggggatcattacctcaagatcatattgttcacaaaatcaaagaatgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtctgtcaacgcattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgctctcatgcctctgtatgcttgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgccaggcaacggccgggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtgctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactttcaggag
ggtcaatgacctggattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgatttctttccatcggttcgggacctattcgacaccg
cttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgctgccagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagacctaatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattaaggaggttaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcatcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggatacggtc
cagggttcacacccccacacggtggcttgctagggtggagccctcaggcacaaggtatgttgtcaaccgtgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacactcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899147_FT00000_P-F Feature FT:source DQ899147_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtatcttcctgctggtggctccagttcaagga
cacaaaaccctgctccgactattgcctctctcacatcatcaatctactcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgcaatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaacgaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaagagatggggttacaacctacattttatgg
gttatgtcattggtagttggggatcattacctcaagatcatattgttcacaaaatcaaagaatgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtctgtcaacgcattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgctctcatgcctctgtatgcttgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgccaggcaacggccgggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccttggagtttgccaacagtcttacacaagaggactcttggactttcaggag
ggtcaatgacctggattgcagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgatttctttccatcggttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgctgccagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagacctaatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattaaggaggttaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcatcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggatacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacaaggtatgttaacaaccttgccagcagat
ccgcctcgtgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctgtaagagacactcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|EF576808_FT00000_P-F Feature FT:source EF576808_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate SAL7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacccagttccaccaggccttgttggatccgagggtaaggggtctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcatatcatcaatatccttgacgactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagagggactacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcgtcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtataactgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctagaaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccggccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctactgatttcttcccgtcagctcgggacctattcgacaccg
cttcagctctctacagggatgctttagagtcaccgcaacattgcaccccccatcataccgctctcaggcaagctattttg
tgttggggtgaattaacgactctggcttcctgggtgggcaataatttggaggaccctgcatccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtttttggtgtcctttggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccggcttcccaatgttagtattccttggactcatagggtgggaaat
tttacggggctctactcttctactgtacctactttcaatcctcactggttaactccttcttttcccgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacgagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttatggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtatcctaacaaccttgccagcgaat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|EU366118_FT00000_P-F Feature FT:source EU366118_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA67). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ589066_FT00000_P-F Feature FT:source FJ589066_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_054). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagagggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcaccttgaggccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttttggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaaaaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaggactgggaggagctgggtgaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcannnnnnnnnnnnnnctttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctcacttttttgccttctgatttcttcccgtctattcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgctccccccatcataccgctctcaggcaagctattttg
tgctggggtgagttaatggttttcgcttcctgggtgggcaataatttggaagatcctgcagctagggatttagtagttaa
ttatgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagata
cagttattcagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagaccacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgggtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctactttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccactcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgtagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggcttcggcc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ657522_FT00000_P-F Feature FT:source FJ657522_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacattaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctytactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacgatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cacccaaattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|FJ657528_FT00000_P-F Feature FT:source FJ657528_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA108). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaccatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttgactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|FJ709460_FT00000_P-F Feature FT:source FJ709460_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactgggtaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709494_FT00000_P-F Feature FT:source FJ709494_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI41). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HE981182_FT00000_P-F Feature FT:source HE981182_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HE981183_FT00000_P-F Feature FT:source HE981183_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3203 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaacagttcttgagt
atttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcttatccacacttccg
gaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaattttacgggactc
tattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttacatcaagatttgat
acacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgccatccagatttt
ttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggttaatcattatttt
aagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtagcgcctcattttg
tgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggcatgggacagaat
ctctctgtacccaatcctctgggattctttccagaccatcagttggatcctctattcagggcaaattccagcagtcccga
ctgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtcctgggttcacac
ccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagatccgcctcctgct
tccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccacaggccatgcagtg
gaa
>gnl|hbvnuc|HM585186_FT00000_P-F Feature FT:source HM585186_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtacgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaactactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggcccgctcacaaaaaatgaattgagaagattaaaattggttatgc
catctagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585187_FT00000_P-F Feature FT:source HM585187_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtgtgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585189_FT00000_P-F Feature FT:source HM585189_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585190_FT00000_P-F Feature FT:source HM585190_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcgggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaacaacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585195_FT00000_P-F Feature FT:source HM585195_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH17). Complete genome. [Hepadnaviridae] (length=3215 residues).
cgccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccttgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagtacgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM585196_FT00000_P-F Feature FT:source HM585196_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaaaatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM590472_FT00000_P-F Feature FT:source HM590472_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagtttcaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtacgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaactactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggcccgctcacaaaaaatgaattgagaagattaaaattggttatgc
catctagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HM627320_FT00000_P-F Feature FT:source HM627320_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HCUCH21). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgtyagatccgagggtaagggmyctgtatttkcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgacctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcytgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctyaggcaarytatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacgatcctgctgctagggacctagtggttaa
ctatgtcaatactmacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaar
yagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccacmaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttwtcctaaggytaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagagcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HQ378247_FT00000_P-F Feature FT:source HQ378247_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate IRL-2009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN688701_FT00000_P-F Feature FT:source JN688701_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV135). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtktttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgytgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtcccattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcraaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactactggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcgattcgggacctactcgacaccg
cttcagccctctacagggawgctttagagtcaccggaacattgcacccacmatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgaatttggcttcctgggtgggcaataatttggaygaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagata
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatcnaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttaaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|JN688709_FT00000_P-F Feature FT:source JN688709_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV143). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccactcaacccagttggatccgagggtaagggctctgtatyttcctgctggtggctccagttcagaga
cacagaaccttgctcagactattgcctctctcanatcatcaatcttctcgaagactgggggccntgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacagggggtgtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtcaatcgtccaattgattggaaggtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtattcctgtatcactgcnaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgacnac
gggtcgcacctctctttacgcggactccccgtctgttccttctcntctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggagganatcaggtta
aaggtctttgtactaggaggctgtasgcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctyttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgmtctcttttttgccttctgatttcttcccgtcrgttcgggacctactcgacaccg
cttcagccctcttcagggatgctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattgtg
tgttggggtgaagtawcgactttkgcttcctgggtgggccataatttrgaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgcmttayttttggaagagata
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcmagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactgggaaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattctatataagagagaatccacacgtag
cgcctcattctgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcaaat
ccgcctcctgcctccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|JN688720_FT00000_P-F Feature FT:source JN688720_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV224). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaca
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttctcgttgataaaaatccgcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttaggaaacttcct
gtaaatcgtccmattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccgacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctcccgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactttcaggac
ggttcatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctgttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccgtctgatttcttcccgtcggctcgggacctactcgacaccg
ctkcagccctctacagggatgctttagagtcaccggaacattgcaccccccatcataccgctatcaggcaagctgttttg
tgttggaatgaattaatgactttcgcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacattaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagacaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|JN792918_FT00000_P-F Feature FT:source JN792918_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8070-03547). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggatctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtccgcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttctcttcacctctgc
acgtctcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggga
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgcggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacatcaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggacgatcctgctgctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tgaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JX079937_FT00000_P-F Feature FT:source JX079937_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FF5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctcttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttccggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccstagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctaatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattaattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494397_FT00000_P-F Feature FT:source KC494397_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR9-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacacttactcaggactcctaagacccctgctcgtgtcacaggcggtgtgttccttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtcggcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatggttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494398_FT00000_P-F Feature FT:source KC494398_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR8-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggagtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
acttttgtttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494400_FT00000_P-F Feature FT:source KC494400_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR6-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acaaagtctagactcgtggtggacttctctcaattttctagggcgaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatgcctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttt
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
atatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
ttctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KC494402_FT00000_P-F Feature FT:source KC494402_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR4-NORTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcgatgcagtggaa
>gnl|hbvnuc|KC494404_FT00000_P-F Feature FT:source KC494404_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR2-NORTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgcccgattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttt
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
attttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaaaatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ586805_FT00000_P-F Feature FT:source KJ586805_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagccccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgactttttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctttcaggcaagctatattg
tgctggggggagttaatgactttggcttcctgggggggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctggggtttcacatttcctcccttacttttggaagagaaa
cagttcttgagtatttggtgttttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcgggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgaccaatcctctg
ggattctttccagaccatcagctggatcctctattcagggcaaattccagcagtcccgactgggacttcaacaaaaacaa
ggacaattggccaatggcaaacaaggtaggagtgggaggatacggtcctgggttcacacccccacacggtggcctgttgg
ggtggagtccacaggcacagggtgtgcttacaacattgccagcagatccgcctcctgcttccaccaatcggcggtccggg
agaaaaccaaccccagtctctccacctctaagagacactcatccacaggccatgcagtggaa
>gnl|hbvnuc|KJ586807_FT00000_P-F Feature FT:source KJ586807_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccctcaattccaccagggtctgttaattcccagggtaaagggtctcctgctggttgctggtgggtccagttccaaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctaaactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttatgcctctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccaccagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccaatttctccacctctaaaagacactcatccaca
gggcatggcgtggaa
>gnl|hbvnuc|KJ586808_FT00000_P-F Feature FT:source KJ586808_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacaaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acaaagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttaaaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaaaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ638656_FT00000_P-F Feature FT:source KJ638656_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacaccacatcaggacacctaggactcctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaaaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccagaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgggcagcatcttgagtcactttataccgctgt
taccaattttctgttatctgtggggatccatttaaatacctctaaaactaaaagatggggttataacctacatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgcccccttcactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcgtttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgcacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaccttatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtttcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctccggac
ggtcaatgacctggatcgaagaatacttcaaagactgtgtatttaatgactgggaggagctgggggaggagatttggtta
aagatttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctatcgggatgctttagaatcaccagaacattgcacacctcaccataccgctatcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgcagctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagacaaa
cagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaacgactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgaggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaggatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctctggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtcggggagaaaaccaaccccagtctctctacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ638659_FT00000_P-F Feature FT:source KJ638659_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT025). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgayaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactcactacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacaaaaaatcaaagattgttttcggaaacttcct
gtaaatcgaccamttgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaccattatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggatctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggactgaggtaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttacaaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgctttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatrcagtggaa
>gnl|hbvnuc|KJ638662_FT00000_P-F Feature FT:source KJ638662_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT040). Complete genome. [Hepadnaviridae] (length=3215 residues).
cacaacccagttccaccaggctctgttggatccaarggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgttatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctcgcaattttctaggggaaatacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacatgtattcccatcccatcgtcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctttgggtatccatttaaatacttctaaaacaaaaaggtggggttacaacctacactttatgg
gtcatgtyattgggagttggggaacattaccacaagatcatattatacataagatcaaagaatgttttcgaaaacttcct
gtaaaccgtccaattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgctgccccttttacccaatgtgg
ttaccctgctctcatgcctctgtacgcttgcattactgctaaacaggcgtttgtgttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaacctcatcggcacggacaactctgtcgtcctctccaggaaat
acacctcctttccatggctgctcggttgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctttgccgccctcttctccgtctcccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagcggactcttggactgtcaggac
ggtcaatgacctggatcgaagattacatcaaagactgtgtatttaaggactgggaggagtcgggggaggagataaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtagaattgctctcttttttgccttctgatttctttccgtcggttcgggacctcctcgacaccg
cttcagccctctaccgggatgctttagagtcaccggaacattgcaccccccatcataccgctctyagrcaarttattttg
tgttggggtgagttaacgaatttgggttcctgggtgggcaataatttggaggacmctgcagctagggattyagtagtgaa
ttatgtcaatactaacatgggcctaaaaactagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcgtataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctattctgctactgtacctactttcaatcctaactggttgactccgtcttttcctgatattcacttgca
tcaagaccttatatctaaatgtgaacaatttgtgggtccactcactaamaatgaattacgaagattgaaattggttatgc
ctgctagattttttcctaaggttaccaaatattttcctatggaaaaaggtattaaaccttactatcctgagcattcagtt
aatcattactttaaaacccgacactatttgcatactttatggaaggcgggaattttatataagagagaatccacacatag
cgcctcattttgtgggtcaccatactcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctttctgtgcccaatcctctgggattctttccagaycatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacagttggccaatggcaaacaaggtatggaccggggaaggctacg
gtccagggttcacgccccacggtggcctgctggggtggagccctcaagcacaaggtgttttaaccaccttgccagcggat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaacaccartctctccacccctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ638664_FT00000_P-F Feature FT:source KJ638664_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT049). Complete genome. [Hepadnaviridae] (length=3212 residues).
gtggaacactttccaccaggctctgttagatccgaaggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtctttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccattccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctat
taccaattttctgttatctctgggcatccatttaaatacctctaaaactaaacgatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggttttgccgcccccttcactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgctaaacaggcgtttgtcttttcgccaacttacaaggcctttc
tatatcgacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaacctcatcggcacagacaactccgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtctcgcccccttctccgtctgccgttccacccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcggagcttgccaacagtcttacataagcggactcttggactctcgggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagagtaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgaggaattactctcttttttgcctcttgatttcttcccgtcagctcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
tgctggaatgaggtaacgactttggcttcctgggtgggcaataatttggaagatcctgcagctagggaccaagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaactactgtggtttcacatttcctgccttacttttggaagaacta
cagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgcttatagaccagcaaatgcccctatctta
tccacacttccggaaacaagggttattagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggacacataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatgctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatgtgtaggccctctcacaaaaaatgaaatgagaagattaaaattggttatgc
cagccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatccagataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtccccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggac
ctgggttcacaccccctcacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtcgggaagmcaacccctagtctctccacctctgagagacactcatccacaggc
cataaagtggaa
>gnl|hbvnuc|KJ843163_FT00000_P-F Feature FT:source KJ843163_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcatcatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcgatccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843164_FT00000_P-F Feature FT:source KJ843164_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctcaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactcctgcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843174_FT00000_P-F Feature FT:source KJ843174_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccacgctctgttagatcccagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcatattgtacaaaaaatcagagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttggggggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843175_FT00000_P-F Feature FT:source KJ843175_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttataatttacatttcatgg
gttatgtcattggcagttggggagcattgccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtataattgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaacggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagggaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctcactgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcaaagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843176_FT00000_P-F Feature FT:source KJ843176_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagacctccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843189_FT00000_P-F Feature FT:source KJ843189_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttataatttacatttcatgg
gttatgtcattggcagttggggagcattgccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtataattgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagggaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843191_FT00000_P-F Feature FT:source KJ843191_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag30). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatccttaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgtatwgtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggcttttcaggaa
ggtcccagacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggsgakgagattaggtta
aaggtctttgtattaggaggctgtaggcmtaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttaragtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttttagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaracgaag
atctcaatcgccgcgtcgccgcaratctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaattggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaarattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagcccccaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843195_FT00000_P-F Feature FT:source KJ843195_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaacttatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagtttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctctggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggagtgaggtaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattgaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843198_FT00000_P-F Feature FT:source KJ843198_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag37). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcacccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843200_FT00000_P-F Feature FT:source KJ843200_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag39). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattgaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843201_FT00000_P-F Feature FT:source KJ843201_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag41). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
gggtaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843204_FT00000_P-F Feature FT:source KJ843204_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tacgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843205_FT00000_P-F Feature FT:source KJ843205_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag45). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataacctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactcggttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843206_FT00000_P-F Feature FT:source KJ843206_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag46). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843207_FT00000_P-F Feature FT:source KJ843207_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag47). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctcaaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtccacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacgatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843208_FT00000_P-F Feature FT:source KJ843208_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag48). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843211_FT00000_P-F Feature FT:source KJ843211_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag51). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843212_FT00000_P-F Feature FT:source KJ843212_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag52). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttctcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttacyaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843219_FT00000_P-F Feature FT:source KJ843219_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843220_FT00000_P-F Feature FT:source KJ843220_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtwmtaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
tgcaatgcagtggaa
>gnl|hbvnuc|KJ843221_FT00000_P-F Feature FT:source KJ843221_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843224_FT00000_P-F Feature FT:source KJ843224_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttgactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843226_FT00000_P-F Feature FT:source KJ843226_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaarcctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtcaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgaatatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
ttcacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattcagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaagttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP718103_FT00000_P-F Feature FT:source KP718103_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1214). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcgtcaatcttctcgaagactgggggccctgccatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcagcccctttcacccaatgtgg
ctatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggagcctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacgttatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttccggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgaatatttggtgtcctttggggtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttgtggaaggcgggaatcttatataagagagaatccacacgtag
cgcatcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctccacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctgttcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctactggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718107_FT00000_P-F Feature FT:source KP718107_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBNAT097). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccatcaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttacyaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttcaaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacatctaaaaccaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcagcccccttcacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcgtttgttttttcgccgacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaccttatcggcacggacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactctccggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtcttaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttaacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgcagctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagrcaattactgtggtttcacatttcctgccttacttttggaagmaaca
cagttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcctctactgttcctacttttaattctgactgggtaactccttcttttcctgacattcatttaca
tgaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaatcaggaattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatgggagcacctctatccacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcgaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtcgggaagaaaaccaaccccagtctctccacctctaagagacacccatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718111_FT00000_P-F Feature FT:source KP718111_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8827_HIV). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtggggctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctccactgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagcaggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcccaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaaggcattatttgcatactttatggaaggcgggaatcttatataagagagattccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatcctttattcagagcaaatac
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctacttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995098_FT00000_P-F Feature FT:source KP995098_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 8-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttagggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaaaaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccgcacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995101_FT00000_P-F Feature FT:source KP995101_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 63-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagtccaggaa
cacaaaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttattcactacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgttcacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcagcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgcacgttatcggcacagacaactctgtggtcctctctaggaagt
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcatctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataaaaggactcttggacttttaggaa
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagacaaggtta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccatctgttcgggacctactcgacaccg
ctgcagccctttaccgggatgctcttgagtcaccggaacattgctccccccatcacaccgctatcaggcaaattattttg
tgctggggtgagttaatgtctttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacaataatatgggcctgaaaattagacaaatgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactccacctccctatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagaggacgaggcagggcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtggcagaagatctcaatctccgtcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgcttttaatcctaactgggtaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaaaattcaaattgatcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaagcaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccaatctctccacctctaagagacacccatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995105_FT00000_P-F Feature FT:source KP995105_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 134-Cirrhosis). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggcactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggcacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatctaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaacattatcggcacagacaactctgttgtcctctccaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcctggagaccaccgtgaacaccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacccggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttggactaggaggctggaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgctcgggacctactcgacaccg
cttcagccctttaccggcaagctctagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
tgctggggtgaattaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaca
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagacctccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactgggtgactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccccattatcctgagcatgtagtt
aatcattattttaaaacgagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacgagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttaccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccaacagat
ccgcctcctgcttccaccaatcggcggtccgagagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatacagtggaa
>gnl|hbvnuc|KP995106_FT00000_P-F Feature FT:source KP995106_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 143-Cirrhosis). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgcgggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacggacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaccaggtta
atgacctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctggagtccccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctaaaaattagacaaatgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacaggcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaactggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtggatcaccatattcctgggaacaagagatacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacgggc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995111_FT00000_P-F Feature FT:source KP995111_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 234-Cirrhosis). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgaaggtaacggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgacgactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactcccaaggtatgttgcccgtttgtcctct
acttccaggatccatgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctttggggatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgctattggtagttggggatcgttaccccaagatcatattagacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtcccattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaaaaggcgtttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctagaaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggaattgctctcttttttgcctattgatttcttcccgtctgttcgggacctactcgacaccg
ctacagccctataccgggatgctctagagtcaccggaacattgcaccccccatcataccgctctcaggcaaactgttttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctccttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttaatattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtaccggttttcaatcctaactgggtaactccttgttttcctaatattcatttaca
ccaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttactaaatactttcctatggagaaagggattaaaccctattatcctgagcaggcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggagtcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaaaagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcaaagcaaattc
cagcaatcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctgggatggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995114_FT00000_P-F Feature FT:source KP995114_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2369-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaagcaagttccaccagcatctgttggaacccggggtaagggctctgtgtctccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaagacccctgctcgtgttacaggcggtgtctttcttgttgacaaaaatccgcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggacgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gcttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccat
tgtttggcttttagctatatggatgatctggtattgggggccaaatctgttcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtgtccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcgtaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattaccgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacggacaattctgttgtcctctctcggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcctggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgatttcttcccatcggttcgggatctactcgacaccg
cttcagctcttcaccgggatgctttagagtcacctgagcattgctctccccaccatactgctatcaggcaagctgtttcg
tgttggggtgaattaataactttggcttcctgggtgggcaataatttggatgaccctgcagctagggatttagtagttaa
ctatgttaacactcacatgggcctaaaaattagacaactgttgtggtttcacatttcctgcctcacttttggaagacaag
tagttcttgagtatttggtgtcttttggagtgtggattcgcactcctgctccttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactgggccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattacgacgattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaaaagctacagcatgggagcacctctctcaacgacacgaagaggc
aggggacaaaatctctctgtgcccaatcctctgggattctttccggaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacgaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|KP995117_FT00000_P-F Feature FT:source KP995117_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2504-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttaaatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaaccttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacacctcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcactttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgcacagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtggggatccatttaaatactgctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggccctttcaccccaatgtgg
ttatcctgctctcatgcctttgtacacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccgggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacgttatcggcacggacaactctgttgtcctctccaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgcggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagttggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995118_FT00000_P-F Feature FT:source KP995118_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2517-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcacggtatattgcccgtttgtcctct
aattccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaaaattccta
tggggttgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagagctttcccccac
tgtctggcttttagttatattgatgatctggtattgggggccaaatctgtgcagcatcttgagtcactttataccgctgt
taccaattttctggtatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggtacgttacctcaggatcatattgtacacaaaatcaaagagtgttttcggaaacttcct
gtaaatcgtcccattgattggaaagtttgtcagcgcattgtgggtcttttggcctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatatgccaacagtcttatataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttacggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgagatgcgctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagatcctgcagctagggatttagtagttaa
ttatgtcaacacaaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgcttttaatcctaactggttaactccttcttttcctgatattcatttaca
ccaagatctgatatctaaatgtgaacaatttgtaggcccgctcacaaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggaaaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgactcgaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgttattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacagggtgttttgacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggaccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995123_FT00000_P-F Feature FT:source KP995123_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X10-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacattaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggtcaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacggacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcccatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctaatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttactaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccactattcagagcaaattc
cagcagtccagactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggaccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KX264496_FT00000_P-F Feature FT:source KX264496_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1-ame). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KX264499_FT00000_P-F Feature FT:source KX264499_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4-ame). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KY458062_FT00000_P-F Feature FT:source KY458062_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
attggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttgggrtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476322_FT00000_P-F Feature FT:source KY476322_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagaatgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactattggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476324_FT00000_P-F Feature FT:source KY476324_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgacgactggggcccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgytgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaactaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgcaaacttcct
gtaaatcgccctatagattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtactgccaactggatcctacgmgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttctacccgtcagttcgggacttactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacttagtggttaa
ctatgtcaatactcacatgggcctaaagattagacaattactgtggtttcacatttcctgccttacttttggaagagaag
tagttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgaatggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaatyaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcaactggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacgttgccagcagat
ccgcctcctgctcccaccaatcggcggkccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476326_FT00000_P-F Feature FT:source KY476326_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV25). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcatcccagttccaccaggccctgttggatccgagggtaagggctctgtatyttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatctcctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacrggcggtgtgtttctggttgacaaaaatccgcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaagaaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgagcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttctgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtacacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaactccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgcttcgctcgcagccggtctggagcgaacctcatcggcacggacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctctcttgcgtctgccgttccggccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgytccccccatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaagaccctgcagccagggatttagtagttaa
ctatgttaacactcacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagaccaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatccta
tccacacttccggaaactgctgttgttagaggacgaggcrggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgcttttaatcctaactggttaactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattgagaaggttgaaattgrttatgc
cagccagattctttcctaaacttaccaaatattttcctttggagaaaggcatcaaaccttattatcctgagcatgcagtt
aatcattactttaaaaccaggcattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatcctctgggattccttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaacaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagcccacaagcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|MG098564_FT00000_P-F Feature FT:source MG098564_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_050). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatctcgggctttaggaaaataccta
tgggagtgtgcctcagcccgtttctcctggctcattttactagtgcaatttgttcagtggtgcgtagggttttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcnacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccttatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098578_FT00000_P-F Feature FT:source MG098578_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_126). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcatccgagttccaccaggccctgttggatccgagggtaagggctctgtatcttcctgctggtggctccacttcaaaga
cacagaaccctgctccgactattgcctctcycacatcatcaatcttctcgaacactggtggccctgctatgaacatggac
aacatcacatcaggactcctaggaccgctgctcgtgttacaggcggtgtgtatcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggtctacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccatttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctccaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggtcttctgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtattactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaactccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcagaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaacctcatcggcacagataactctgttgtcctctctaggaagt
acacctcattcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgactac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactmttggactttcaggam
rgtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccctgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctwctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgccgccagggatttagtagttaa
ctatgttaacactcatatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagaccaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctgcaccttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttgca
tcaagatctgatatctaaatgtgaacaatttgtaggcccacttactaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcatcaaaccttattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatgggaggcgggaattttatataagagagaatccacacrtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcaccactctcaacggcaagaaggggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagcccacaggcacaaggtgttctaacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MH051987_FT00000_P-F Feature FT:source MH051987_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B127W). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaggactggggaccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgttaggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacgttatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcatactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctggcggacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccgtattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcccagggtgttttaacaactttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaacccctgtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|X75663_FT00000_P-F Feature FT:source X75663_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9203). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcacttccaccaagctctgttggatcccagggtaagggcactgtattttcctgctggtggctccagttcaggaa
cacagaaccctgctccgactattgcctctctcacatcatcaatctcctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgcgcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacagctcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcgaaaagttcct
gtaaatcgcccaattgattggaaagtttgtcaaagtattgtgggtcttttgggctttgcggccccttttacccaatgtgg
ttatcctgctctcatgcctttgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgcttcgctcgcagccggtctggagcaatcctcatcggcacagacaattctgtcgtcctctctcggaagt
atacatcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgaaccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgttctcttttttggcttctgacttctttccgtctgttcgggacctcctcgacaccg
cctcagccctgtaccgggatgccttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcttaaagattagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatatgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaagcataccaaatatttcctattggagaaagggattaaaccctattatccagatcaggcagtt
aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattctatataagagagaaaccacacgtag
cgcctcattttgtgggtcacaatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctttctgtgcccaatccactgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggctgtccgggaggaagccaacccaagtctctccacctctaagagacacacatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB036915_FT00000_P-F Feature FT:source AB036915_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8351). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatcgagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
caacagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036917_FT00000_P-F Feature FT:source AB036917_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8375-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctataccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggagcattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaacctcgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB036920_FT00000_P-F Feature FT:source AB036920_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate VNZ8624). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttttgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttatatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttggggctctaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggcgcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttataggccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagccagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagggcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggcc
cagggtttacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcctccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB116654_FT00000_P-F Feature FT:source AB116654_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctgggggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgttttccttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgggtgtcctggccaaaattcgctgtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttacactgctgt
tactaattttctgttatctgtgggtatccagttaaatacctctaaaacaaaaagatggggttataccttgaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaagatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctatccatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgtggtcctctctaggaagt
acacctccttcccatggctgctcggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgccctcttctccgtctgccgttccagccgacgac
gggtcgtacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgcctactgatttcttcccgtcagttcgggaccttctcgacaccg
cttcagccctttaccgggatgctttagaatcaccagaacactgcacagctcaccataccgctatcaggcaaattgtattg
tgctggggtgagttgatgactttggcttcctgggtgggcaataatttggacgatcctgctgctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagacaaa
cagttctggagtatttggtgtcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
tccacacttccggagactactgttgttagaggacgacgcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttactaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaagaggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggaggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AB365453_FT00000_P-F Feature FT:source AB365453_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BOL584). Complete genome. [Hepadnaviridae] (length=3227 residues).
ctcatcccagttccatcaggccttgttggatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgacgactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggacaatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttaggaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgcttcgctcgcagccggtctggagcgaatatcatcggaacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccggccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataataggactattggactttcaggac
ggtcaatgacccggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggag
gagattaggttaatgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcac
ctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacat
tgacccttataaagaatttggagcgtctgtggaattgctctcttttttgccttctgatttcttcccgtcggttagggacc
taatcgacaccgctacagctctctacagggatgacttagagtcaccggaacattgcaccgcccatcataccgctctcagg
caagctattgtgtgttggggtgaagtaatgactttggcttcctgggtgggcaataatttggacgaccctggagccaggga
tttagtagttaactatgttaacactcacatgggcctaaagattagacaattattgtggtttcacatttcctgtcttatgt
ttggaagacaaacagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttatagaccacaaaat
gcccctatcctatccacacttcctgaaactactgttgttagaccacgaggcaggacccctagaagaagaactccctcgcc
tcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcat
aaggtgggaaactttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctga
tattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttga
aattgattatgccagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcct
gagcatgcagttaatcattattttaagaccagacattatttgcatacgttatggaaggcgggaattttatataagagaga
atccacacgtagcgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacg
acaagaaggggcatgggacagaatctctctgtgcccaatccactgggattctttccagaacatcagctggatcctctttt
cagagcaaattccagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgg
gaggttacggtccagggttcacacccccacacgggggcctgttggggtggagccctcaggcacaaggtgttctaacaacc
ttgccagcagatccgcctcctgcttccaccaatcggcggtccgggaggaagcccaccccagtctctccacctctaagaga
cacacatccacaggcaatgcaatggaa
>gnl|hbvnuc|AF223962_FT00000_P-F Feature FT:source AF223962_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaagacctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgagcaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
catccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacaccaccacacggtggcctgttgggatggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|AF223963_FT00000_P-F Feature FT:source AF223963_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate sa11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctcc
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggacaycagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagctctgtaccgggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacttagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|AY311370_FT00000_P-F Feature FT:source AY311370_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BD14999). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggggtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggcacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtacacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctccaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttggtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacgtttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcgtcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttgacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ776247_FT00000_P-F Feature FT:source DQ776247_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA54). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823086_FT00000_P-F Feature FT:source DQ823086_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate FOR2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacacaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttaggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaattattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacagggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgaatcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacgagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagamcatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacctcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823089_FT00000_P-F Feature FT:source DQ823089_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggtcctgttggatccgagggtaaaggctctgtattatcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttacaacttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactmttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactgggtaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacgatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ823092_FT00000_P-F Feature FT:source DQ823092_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagmggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ823093_FT00000_P-F Feature FT:source DQ823093_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CH15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ899145_FT00000_P-F Feature FT:source DQ899145_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Japreira76). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtattttcctgctggtggctccagttcaggaa
cacaaaaccctgctccgactattgcctctctcacatcatcaatctactcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaagagatggggttacaccctacattttatgg
gttatgtcattggtagttggggatcattacctcaagatcatattgttcacaaaatcaaagaattgtttcggaaacttcct
gtaaatcgtccaattgattggaaagtctggcaacgcattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgctctcatgcctctgtatgcgtgtattactgctaaacaggcttttgttttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgccaggcaacggccgggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccccttgagtttgccaacagtcttacacaagaggactcttggactttcaggag
ggtcaatgacctggattgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgatttctttccatcggttcgggacctactggacaccg
cttcagccctttaccgggatgctttagagtcacctgaacattgcactcccaatcacactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaggaccctgctgccagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagacctaatttctaaatgtgaacaatttgtaggcccactcactaaaaatgaattaaggaggttaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcatcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggatacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacaaggtatgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacactcatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|DQ899148_FT00000_P-F Feature FT:source DQ899148_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Yanomami114). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgtcagatccgagggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcctggggctgtaccgcccccttcttcgtccgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaacattttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccttctgttcgggacctactcgacaccg
cttcagccttgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctatcttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ctatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctagatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattgatcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcaggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacacccaca
ggccatgcagtggaa
>gnl|hbvnuc|DQ899149_FT00000_P-F Feature FT:source DQ899149_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Piaroa3019). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctttgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaactcaaagattgttttcggaaacttcct
gtaaatcgtccgattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacgttatcggcacagataactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcctcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacagctgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatggccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaaccacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccggtattcagagcaaattc
cagcagtcccgattgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctggtggggtggagccctcaggcacaaggtgttctaactaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|EU366116_FT00000_P-F Feature FT:source EU366116_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA61). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacattaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|EU366133_FT00000_P-F Feature FT:source EU366133_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA96). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctggaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaacgatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgactggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgtcgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ589067_FT00000_P-F Feature FT:source FJ589067_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate UdeA_083). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagaatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcarcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatrcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagaccaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctcttgagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactcatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtctgacttttggaagagaca
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctccttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttatcctcntctcatgggcmmt
tgtacgggcctgtactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatatgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaagcttaccaaatatttcctattggagaaagggattaaaccctattatccagagcaggcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ657519_FT00000_P-F Feature FT:source FJ657519_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA110). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtawgggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|FJ657525_FT00000_P-F Feature FT:source FJ657525_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BA107). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acggagtctagactcgtggtggacttctctcagttttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacttctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggttacaacctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgcgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggacttgcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttgcggactgggaggagctgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcctctgtggaattactctcttttttgccttctgatttctacccgtcagttcgggacctactcgacaccg
cttcagccctctatcgggatgctttggaatcaccagaacattgctcacctcaccataccgctctcaggcaagttagtttg
tgctggagtgagttaatgactttcgctatctgggtgggcaataatttggaagatcctgctgctagggatctagtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacrtttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
tccacacttccggaaactactgttgttagaggacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgattggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctagggttaccaaatattttcctttggaaaagggaattaaaccctattatcctgacaacgtagtt
aatcattattttaagaccagacactatttgcatacattatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcgatccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709457_FT00000_P-F Feature FT:source FJ709457_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatgcctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccaggcactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709459_FT00000_P-F Feature FT:source FJ709459_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccttgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagtacgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatctacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|FJ709465_FT00000_P-F Feature FT:source FJ709465_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate CHI9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaaggactctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN688691_FT00000_P-F Feature FT:source JN688691_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV122). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccaacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|JN792922_FT00000_P-F Feature FT:source JN792922_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 9401-03301). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccytcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggtcatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctrttcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggagcatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgctcacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccgtgcagtggaa
>gnl|hbvnuc|JQ272888_FT00000_P-F Feature FT:source JQ272888_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV_MDQ29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcagccaagttccaccaggccttgttggatccgagggtaagggctctgtatcttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgacgactggggaccttgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccaccaccaccagcacgggaccatgcaaracctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcaccttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtaatcggaagttggggatcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgccaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtattcctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatatcatcgggacggacaattctgtggtcctctctcggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccctcttctgcgtctgccgttccagccaaccac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttctttccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcacctgaacattgcaccccccatcataccgctatcaggcaagctatattg
tgttggggcgaattaatggttttcgcttcctgggtgggcaataatttgcaagacgctgcagccagggatttagtagtcga
ctatgttaacactcacatgggcttaaagattagacatttattgtggtttcacctttcctgccttatgtttggaagagata
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattaagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggaaaaaggcatcaaacctcattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgcgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtattctaacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcagtaaagtggaa
>gnl|hbvnuc|KC494394_FT00000_P-F Feature FT:source KC494394_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR12-NORTH). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaagctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgagcgggacgtcctttgtttacgtcccatcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttccaccgcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctcccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactcccttttttcctgatattcatttgca
tcaagacctgatttctaattgtgaacaatttgtaggcccacttactaaaaatgaattacaaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagacaacacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KC494401_FT00000_P-F Feature FT:source KC494401_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate BR5-SOUTHEAST). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatgtggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatgcctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaggaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtcttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttctcgccaacctacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggat
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtcttcttattaagaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgaccaggcaggtcccctagaaaaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattgcgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcgatgcagtggaa
>gnl|hbvnuc|KJ843167_FT00000_P-F Feature FT:source KJ843167_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccatgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
ggctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtctttgggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattgaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843171_FT00000_P-F Feature FT:source KJ843171_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtattactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttgggactgtatcgcccccttctccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843177_FT00000_P-F Feature FT:source KJ843177_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacgaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacgcgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catcaagattttttcctaaggtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatatgagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacaaggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843179_FT00000_P-F Feature FT:source KJ843179_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttacgcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttactcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843193_FT00000_P-F Feature FT:source KJ843193_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag32). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacggacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaggactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatctggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggcggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843194_FT00000_P-F Feature FT:source KJ843194_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag33). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccagactctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctcaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcagaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacaaaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaagacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843196_FT00000_P-F Feature FT:source KJ843196_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag35). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattgaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843197_FT00000_P-F Feature FT:source KJ843197_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag36). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaactcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacaccccctcacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843203_FT00000_P-F Feature FT:source KJ843203_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag43). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagagtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctctaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattgccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagaggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcctcctgggtgggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ843210_FT00000_P-F Feature FT:source KJ843210_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Ag50). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacttgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagacgaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ843225_FT00000_P-F Feature FT:source KJ843225_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate Cr08). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaatccagttccaccaggccctgttggatcagagggtaaggactctgtgtcttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtatttcttgttgataaaaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctcaaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtccacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatgcctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatacagcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgagactcatcggcacggacaactctgttgtcctctctgggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcctctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggtgtttgccaacagtcttatataacaggactattggactttccggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaaaattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaattactgttgttagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggagat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagatctgatatctaaatgtgaacaatttgtaggcccactcaccaaaaatgaactgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcatcaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagccccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacagggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacgcatccaca
ggcaatgcaatggaa
>gnl|hbvnuc|KP718106_FT00000_P-F Feature FT:source KP718106_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate PA-01-1650). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgctagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccrtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctttgggtatccatttaaatacttctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacaaaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggccccttttacccaatgtgg
ttatcctgctctcatgcctttatatrcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctmggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
awgrtctttgtactaggaggctgtaggyataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctycaagctgtgccttgggtggctttgggacatggacattgaccmttataa
agaatttggagcttctgyggaattgctctcttttttgccttctgatttcttcccgtctgytcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccctaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtmataatttggaaraccctgcwgctagggatttartarttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgartatttggtgtcctttggagtgtggattcscactccacctgcttatasaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccratgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagagctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgagttgagaagattaaaattggtcatgc
cagctagattttatcctaaagttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactctatggaaggygggaatcttatataagaragagtccacacgtak
cgcctcattttgtgggtcaccatattcctgggaacaaaagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcctgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggasagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctgggatggagccctcaggcacagggtgttttaacaaccttgccagtagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccrca
ggccrtgcagtggaa
>gnl|hbvnuc|KP718109_FT00000_P-F Feature FT:source KP718109_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 7555_HIV). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttggatccgagggtaagggctctgtattctcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcgtttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgtacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctaaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttattgtccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaggatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP718113_FT00000_P-F Feature FT:source KP718113_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate GP10-3634). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactggggcccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgctgttgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaaaagatggggctataccctaaatttcatgg
gatatgttattggcagttggggatcattgccacaagaccacattgtacaaaaaatcaaagaatgctttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttacacaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcctttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagtttgccaacagtcttacataagcggactcttggactctcaggac
ggtcaatgacctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctttaccgggatgctttagaatcacctgaacattgcacacctaaccataccgctctcaggcaagctatcttg
tgctggggtgagttaatgactttggcttcctgggtggggaataatttggaagatcctgcagctagggacctagtggttaa
ctatgttaatactaatatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtctcctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgatattcatttaca
tcaagatttgatacacaaatgtgaacaattcgtaggccctctaacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatataagagagaatccacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgacacgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaagcaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggagtgcttacaacattgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995104_FT00000_P-F Feature FT:source KP995104_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 81-Cirrhosis). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacctccctgctggtggctccagttcaggga
cacaaaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggtctgttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgactctcatcggcacggacaattctgttgtcctctctcggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccttttttccgtctaccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccccctggaatttgccaacagccttacataagaggactcttggactttcaggat
ggtcaatgacccggatcgatgaatacatcaaagactgtgtatttaaggactgggaggagttgggtcaggagagtaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttcttcccatcggttcgggatctactcgacaccg
cttcagctctttaccgggatgctctagagtcacctgagcattgcactcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggcaataatttggaggaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcttgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactgttcctgcttttaatcctaactggtctactccttcttttcctgatattcatttgca
tcaagacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP995107_FT00000_P-F Feature FT:source KP995107_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 201-HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtacttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacaccacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacaactcttgcacaaggaacctctatgtttccct
cctgttgctgttccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gttatgtaattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcggaaactgcct
gtaaatcgtccaattgattggaaagtgtgtcaacgcatagtgggtcttttgggctttgctgcccccttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattactgctaaacaggcctttgtcttttcgcaaacatacaagacctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgactctcatcggcacggacaattctgttgtcctctctcggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccccctggagtttgccaacagccttatataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagactacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtctcactgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagctctttaccgggatgctttagagtcacctgaacattgctctcccaaccatactgctctcaggcaagctattttg
tgttggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ctatgttaacactaacatgggcctaaaaattagacaactgttgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtctcctttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctacttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagctagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggagcctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KP995115_FT00000_P-F Feature FT:source KP995115_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2370-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttggatcccagggtaagggctctgtatttccctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacattacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccctgcaaaacctgcacgactcttgcacaaggaacctctatgtttccct
cctgttgctgtaccaaaccctcggacggaaactgcacttgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggtagttggggatcattaccccaagatcacattgtacacaaaatcaaagaatgctttcgtaaactgcct
gtaaatcgtccaattgattggaaagtttgtcaacgcatagtgggacttttgggctttgctgcccctttcacccaatgcgg
ttatcctgctctcatgcctctgtatgcctgtattaccgctaaacaggcttttgtcttttcgccaacatacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgaatctcatcggcacggacaattctgttgtcctctctaggaagt
acacctcctttccatggctgctcggatgtgctgcaaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgattggggctgtaccgccctcttctccgtctgccgttccagccgacgac
gggtcccacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagccttacataagaggactcttggactttcaggag
ggtcaatgccctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttgctctcgtttttgccttctgatttcttcccatcggttcgggacctactcgacaccg
cttcagccctttaccgggatgccttggagtcacctgagcattgctctccccaccatactgctctcaggcaagctattttg
tgttgggatgagttaatgattttcgcttcctgggtgggcaataatttggacgaccctgcatctagggatttagtagttaa
ctatgttaacattaacatgggcctcaaaattagacgactgttgtggtttcacatttcctgcatcatgtttggaagagacc
tagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccaaattatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgcagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttcttttcctgatattcatttgca
tcaaaacctgatttctaaatgtgaacaatttgtaggcccacttactaaaaatgaattacgaagattaaaattggttatgc
cagccagattttatcctaaggttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctcactcaacgagacgaagaggc
atgggacagaatctctctgtgcccaatcctctgggattctttccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaagcacaaggtgtgttaacaaccttgccagcaaat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggcgatgcagtggaa
>gnl|hbvnuc|KP995119_FT00000_P-F Feature FT:source KP995119_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate 2524-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttcaaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgactggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctggtgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtatcgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctactgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccagaacattgcaccccccatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacaataatatgggcctgaaaattagacaactgttatggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgcgttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaactggtcatgc
cagctagattttatcctaaggttaccaaatactttcctttggagaaagggattaaaccctattatccggagcatgcagtt
aatcattactttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995125_FT00000_P-F Feature FT:source KP995125_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X13-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaagacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacttctaaaacaaaaagatggggttactccctacatttcatgg
gttatgttattggtagttggggaacattaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggtcaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacggacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctttaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctaatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtagggccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttactaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccactattcagagcaaattc
cagcagtccagactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggaccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KP995126_FT00000_P-F Feature FT:source KP995126_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate X14-Chronic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccatcaggctctgttagatccgagggtaagggctctgtatcttcctgctggtggctccagttcaggga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcagaacctgcacaactcttgctcaaggcacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaacctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaactgcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtacacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacattatcggcacagacaactctgttgtcctctccaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggtcgcctggggctgtaccgcccccttcttcgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggaatctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggaatgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cctcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttggtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcagagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcacagggtgttttgacaaccttgccagcagat
ccacctcctgcttccaccaatcggcggtccgggagaaagccaaccccagtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY382411_FT00000_P-F Feature FT:source KY382411_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F4_wt). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacttctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataaaaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctctacagggatgctttagagtcaccggaacattgcacccccaatcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccgctgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaccaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|KY382415_FT00000_P-F Feature FT:source KY382415_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate F1b_wt). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgccyctctcacatcatcaatcttctygaagactgggggccctgctaygaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcascccgtttctcctggctcaktttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctcgaaaacaaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggaycattaccacaagatcatattgtacaaaaaatcaragattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataacttggaagatcctgctgccagggacctagyggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctccygcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgaraarattaaaattagttatgc
catccarattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatataarararaatccacacgtas
cgcctcattttgkgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccaraccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaamcaaggacacttggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgccagcggat
ccgcctcctgcttccaccaatcggcggtccgggagraaaccaaccccagtctctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476323_FT00000_P-F Feature FT:source KY476323_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagtttcaccaggctctgttagctccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaagagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacgtacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaacctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacctcgtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggtcctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagggacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476327_FT00000_P-F Feature FT:source KY476327_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagagctctgtattttcctgctggtggctccagttcagaga
cacagcaccctgctccgattattgcctctctcacatcatcaatcttcttgaagactggggcccctgctacgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaactaaaagatggggttataccctaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctatagattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaagctcatcggcacagacaactctgttgtcctctccaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggga
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctcttgatttcttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctcaccataccgctctcaggcaagctatattg
tgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctagggacttagtggttaa
ctatgtcaatactaacatgggcctaaagattagacaattactgtggtttcacatttcctgccttacgtttggaagagaaa
cagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgattggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggctaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagccacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
cagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatacggtc
ctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacatggccagcaaat
ccgcctactgcttccaccaatcggcagtccgggagacaaccaaccccagtctctccacctctaagagacactcatccaca
ggccgtgcagtggaa
>gnl|hbvnuc|KY476328_FT00000_P-F Feature FT:source KY476328_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccactcagtttcaccaggctctgttagatccaagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactgggggccctgctacgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcaacatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatacctctaaaacgaagagatggggttataccttaaatttcatgg
gttatgttattggcagttggggatcattaccacaagatcacattgtacagaaaatcaaagattgttttcgtaaacttcct
gtaaatcgccctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctttactcaatgtgg
ttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaacttataaggcctttc
tatgtcaacaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcccgtcggcg
ctgaatccagcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgttccagccgacgac
gggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccctcgaagcttgccaacagtcttacataagcggactcttggactttcaggaa
gatcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgcctgrtgatttcttyccgtcaattcgggacctactcgacaccg
ctgcagccctctaccgggatgctttagaatcatcggaacattgcacccatcaccataccgctctcaggcaagctatattg
tgctggggtgaggtaatgaatttggcttcctgggtgggcaataatttgcaagatcctgctgcaagggacctcgtggttaa
ctatgtcaatactcacatgggcctaaaaattagacaattactgtggtttcacgtttcctgccttacttttggaagagaag
tagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttrttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaamatgaattgagaagattaaaattggttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcgaaggggc
atgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggcaaattc
caacagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggatatggtc
ccgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaacattgccagcagat
ccgcctcctgctcccaccaatcggaggtccgggagaaaaccaaccccagtctctccacctctaagagacacgcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY476331_FT00000_P-F Feature FT:source KY476331_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate HBV43). Complete genome. [Hepadnaviridae] (length=3227 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttcttgaagactggggcccctgctacgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acggagtctcgactcgtggtggacttctctcaattttctagggggaacacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacct
ctatgtttccctcttgctgctgttccaaaccctcggacggaaactgcacttgtattcccatcccatcatcctgggcttta
ggaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagg
gctttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccct
ttataccgctgttaccaattttctgttatctgtgggcatccatttaaatacctctaaaacgaaaagatggggttataccc
taaatttcatgggttatgttattggcagttggggatcattaccacaagatcacattgtacaaaaaatcaaagattgtttt
cgtaaacttcctgtaaatcgccctatagattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgccccctt
tactcaatgtggttatcctgctctcatgcctctgtatgcctgtataactgctaaacaggcttttgtcttttcgccaactt
acaaggcctttctatgtcaacaatacatgaacctttaccccgttgcccggcaacggccaggcctgtgccaagtgtttgct
gacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatcca
tactgcggaactccttgcagcttgtttcgctcgcagccggtctggagcgaaactcatcggcacagacaactctgttgtcc
tctctaggaagtacacctccttcccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtttac
gtcccgtcggcgctgaatcccgcggacgatccctctcggggtcgcttggggctgtatcgcccccttctccgtctgccgtt
ccagccgacgacgggtcgcacctctctttacgcggcctccccgtctgttccttctcatctgccggaccgtgtgcacttcg
cttcacctctgcacgtcgcatggagaccaccgtgaacgccccgcgaagcttgccaacagtcttacataagcggactcttg
gactttcaggacggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagttgggggag
gagattaggttaatgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcac
ctctgcctagtcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacat
tgacccttataaagaatttggagcttctgtggaattactctcttttttgccttctgatttcttcccgtcagttcgggacc
tactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctctcagg
caagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataatttggaagatcctgctgctaggga
cttagtggttaactatgtcaatactaacatgggcctaaaaattagacaattactgtggtttcacatttcctgccttactt
ttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgtttatagaccaccaaat
gcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcc
tcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcat
aaggtgggaaactttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctga
cattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaa
aattggttatgccatccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcct
gataacgtggttaatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatataagagaga
atccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacg
actcgaaggggcatgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctatt
cagggcaaattccagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgg
gaggatacggtcctgggttcacacccccacacggtggcctgttggggtggagcccacaggcacagggtgtgcttacaaca
ttgccagcagatccgcctcctgctcccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagaga
cactcatccacaggccatgcagtggaa
>gnl|hbvnuc|MG098565_FT00000_P-F Feature FT:source MG098565_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_111). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccttgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggac
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctgsccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctcmaacttgtcctgtctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cttgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtgttgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacattttatgg
gttatgtaattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgttttagaaaacttcct
gtaaatcgtccaattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtatacctgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacagtacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcgganct
ccttgcagcttgtttcgctcgcggccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctaggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgggg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgctgttccagccgaccac
gggtcgcacctctctttacgcggaccccccgtctgttccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactcttggactttcaggaa
agtcaatgacctggatcgaagaatacatcccatactgtgtatttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagctctctacagggatgctttagagtcaccggaacattgcaccccctctcataccgctctcaggcaagctattttg
tgttggggtgaattaatgactttggcttcctgggtgggcaataatttggaggaccctgcagccagggatttagtagttaa
ctatgtcaacaataacatgggcttaaagattagacaattattgtggtttcacatttcctgcctaacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattggttatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccaraacatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcagtccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MG098580_FT00000_P-F Feature FT:source MG098580_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate NOA_128). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggccctgttggatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cacagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaagactgggggccctgttatgaacatggac
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttgaatacctctaaaacaaaaagatggggttacaatttacatttcatgg
gttatgtcattggcagttggggagcattaccccaagatcatattgtacacaaaatcaaagaatgtttcagaaaacttcct
gtaaatcgtcccattgactggaaagtttgtcaacgtattgtgggacttttgggctttgctgctccttttacccaatgtgg
ttatcctgctctcatgcctctgtataactgtatcactgcgaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaagcaatacatgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaatctcatcggcacagacaactctgttgtcctctctcggaagt
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggggtctaccgccctcttctgcgtctgccgttccagccgaccac
gggtcgcacctctctttacgcggactccccgtctgttccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgacgcatggagaccaccgtgaacgccccctggagtttgccaacagtcttacataagaggactattggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtccttggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcacttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtcggttcgggacctactcgacaccg
cttcagccctcttcagggatgctttagagtcaccggaacattgcaccccccatcataccgctctcaggcaagctattgtg
tgttggaatgaggtaatagctttggcttcctgggtgggcaataatttggatgaccctgcagccagggatttagtagttaa
ctatgttaacactaacatgggcttaaagattagacaactattgtggtttcacatttcctgccttacttttgggagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatccta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactgtacctgctttcaatcctcactggttaactccttcttttcctgatattcatttgca
tcaagacctgatatctaaatgtgaacaatttgtaggcccacttaccaaaaatgaattgagaaggttgaaattgattatgc
cagccagattctttcctaaacttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatataagagagaatccacacctag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggacagaatctctctgtgcccaatccactgggattctttccagaccatcagctggatcctcttttcagagcaaattc
cagcagtcccgattgggacttcaacaaaaacaaggacacttggccaatggcaaacaaggtaggagtgggaggttacggtc
cagggttcacacccccacacggtggcctgttggggtggagccctcaggcacaaggtgttctaacaaccttgccagcagat
ccgcctcctgcttccaccaatcggcgatccgggaggaagccaaccccagtctctccacctctaagagacacacatccaca
ggcaatgcagtggaa
>gnl|hbvnuc|MH051986_FT00000_P-F Feature FT:source MH051986_FT00000_P-F of [Viruses] Hepatitis B Virus genotype F (isolate B106W). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacccagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcaggga
cgcagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgccatgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggactacccgggtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatccacgaccaccagcacgggaccatgcaaaacctgcacaactcttgctcaaggaacctctatgtttccct
cctgttgctgttccaaaccctcggacggaaactgcacctgtattcccatcccatcatcttgggctttaggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcaatttgttcagtggtgcgtagggctttcccccac
tgtctggcttttagttatatggatgatctggtattgggggccaaatctgtgcagcatcttgagtccctttataccgctgt
taccaattttctgttatctgtgggtatccatttaaatactgctaaaacaaaaagatggggttacaccctacatttcatgg
gttatgttattggtagttggggaacgttaccccaagatcatattgtacacaaaatcaaagattgttttcggaaacttcct
gtaaatcgtccaattgattggaaagtttgtcagcgcattgtgggtcttttgggctttgcggcccctttcacccaatgtgg
ttatcctgctctcatgcctttgtatacctgtattactgctaaacaggcttttgtcttttcgccaacttacaaggcctttc
tctgtaaacaatacatgcacctttaccccgttgttaggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggagcgaacgttatcggcacagacaactctgttgtcctctctaggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctgtaccgcccccttcttcgtctgccgttccagccgacaac
gggtcgcacctctctttacgcggactccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgccccctggagtctgccaacagtcttacataagaggactcttggactttcaggac
ggtcaatgacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattgctctcttttttgccttctgatttcttcccgtctgttcgggacctactcgacaccg
cttcagccctgtaccgggatgctctagagtcaccggaacattgcacccccaatcatactgctctcaggcaagctattttg
tgctggggtgagttaatgactttggcttcctgggtgggtaataatttggaagaccctgcagctagggatttagtagttaa
ttatgtcaacactaatatgggcctgaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
cagttcttgagtatttggtgtcctttggagtgtggattcgcactccacctgcttatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttcttttcctgatattcatttaca
tcaagatctgatatctaaatgtgaacaatttgtaggcccgctcactaaaaatgaattgagaagattaaaattggtcatgc
cagctagattttatcctaaggttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatataagagagaatccacacgtag
cgcctcattttgtgggtcaccgtattcctgggaacaagagctacagcatgggagcacctctctcaacgacaagaaggggc
atgggactgaatctttctgtgcccaatcctctgggcttcttgccagaccatcagctggatccgctattcaaagcaaattc
cagcagtcccgactgggacttcaacacaaacaaggacagttggccaatggcaaacaaggtaggagtgggaggctacggtc
cagggttcacacccccacacggtggcctgctggggtggagccctcaggcccagggtgttttaacaactttgccagcagat
ccgcctcctgcttccaccaatcggcggtccgggagaaagccaacccctgtctctccacctctaagagacacacatccaca
ggccatgcagtggaa
© 1998-2020Legal notice