HBVdb

Dataset for nucleotide sequence SP of genotype E

[Download (right click)] [Alignment] [Repertoires]

364 sequence(s)

>gnl|hbvcds|AB091255_SP_P-E Feature FT:CDS AB091255_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB091256_SP_P-E Feature FT:CDS AB091256_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccattac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB106564_SP_C-E Feature FT:CDS AB106564_SP_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactctggctcaaggaacctctatgtttccctcatgttgctgttcaaaacctgcggacg
gaaattgcacttgtacccccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB194947_SP_P-E Feature FT:CDS AB194947_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB194948_SP_P-E Feature FT:CDS AB194948_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB201287_SP_P-E Feature FT:CDS AB201287_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB201288_SP_P-E Feature FT:CDS AB201288_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB201289_SP_P-E Feature FT:CDS AB201289_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB201290_SP_P-E Feature FT:CDS AB201290_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205129_SP_P-E Feature FT:CDS AB205129_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205188_SP_P-E Feature FT:CDS AB205188_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcgtatcaacacttcccgagaatactgttgttagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaagggacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205189_SP_P-E Feature FT:CDS AB205189_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205190_SP_P-E Feature FT:CDS AB205190_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcagcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205191_SP_P-E Feature FT:CDS AB205191_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205192_SP_P-E Feature FT:CDS AB205192_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB219529_SP_P-E Feature FT:CDS AB219529_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219533_SP_P-E Feature FT:CDS AB219533_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaagggacctctatgtttccctcatgttgctgtttaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219534_SP_P-E Feature FT:CDS AB219534_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagatgcggaggcaggacctctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tagctcagtttactag
>gnl|hbvcds|AB274969_SP_P-E Feature FT:CDS AB274969_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274970_SP_P-E Feature FT:CDS AB274970_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccacaagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274971_SP_P-E Feature FT:CDS AB274971_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274972_SP_P-E Feature FT:CDS AB274972_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274973_SP_P-E Feature FT:CDS AB274973_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcgggcg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274974_SP_P-E Feature FT:CDS AB274974_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274975_SP_P-E Feature FT:CDS AB274975_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgagtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274976_SP_P-E Feature FT:CDS AB274976_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274977_SP_P-E Feature FT:CDS AB274977_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttcttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274978_SP_P-E Feature FT:CDS AB274978_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274979_SP_P-E Feature FT:CDS AB274979_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacatgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274980_SP_P-E Feature FT:CDS AB274980_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274981_SP_P-E Feature FT:CDS AB274981_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgacccttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274982_SP_P-E Feature FT:CDS AB274982_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274984_SP_P-E Feature FT:CDS AB274984_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaacaccagtac
aggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctttggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB274985_SP_P-E Feature FT:CDS AB274985_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB915175_SP_P-E Feature FT:CDS AB915175_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcytgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB915176_SP_P-E Feature FT:CDS AB915176_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB915177_SP_P-E Feature FT:CDS AB915177_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctttgtttccctcatgttgctgctcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB915178_SP_P-E Feature FT:CDS AB915178_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtgtccctcatgttgctgtttaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB915180_SP_P-E Feature FT:CDS AB915180_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgaggtgcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494689_SP_P-E Feature FT:CDS AM494689_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatctacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494690_SP_P-E Feature FT:CDS AM494690_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494691_SP_P-E Feature FT:CDS AM494691_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaagggacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttaggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494692_SP_P-E Feature FT:CDS AM494692_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494693_SP_P-E Feature FT:CDS AM494693_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494694_SP_P-E Feature FT:CDS AM494694_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494695_SP_P-E Feature FT:CDS AM494695_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacacagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaacaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494696_SP_P-E Feature FT:CDS AM494696_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494697_SP_P-E Feature FT:CDS AM494697_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494698_SP_P-E Feature FT:CDS AM494698_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494699_SP_P-E Feature FT:CDS AM494699_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaagccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494700_SP_P-E Feature FT:CDS AM494700_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494701_SP_P-E Feature FT:CDS AM494701_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494702_SP_P-E Feature FT:CDS AM494702_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494703_SP_P-E Feature FT:CDS AM494703_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctaaaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtttaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AM494704_SP_P-E Feature FT:CDS AM494704_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494705_SP_P-E Feature FT:CDS AM494705_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaacaaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494706_SP_P-E Feature FT:CDS AM494706_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494707_SP_P-E Feature FT:CDS AM494707_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494708_SP_P-E Feature FT:CDS AM494708_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494709_SP_P-E Feature FT:CDS AM494709_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494710_SP_P-E Feature FT:CDS AM494710_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494711_SP_P-E Feature FT:CDS AM494711_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494712_SP_P-E Feature FT:CDS AM494712_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494713_SP_P-E Feature FT:CDS AM494713_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494714_SP_P-E Feature FT:CDS AM494714_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494715_SP_P-E Feature FT:CDS AM494715_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM494717_SP_P-E Feature FT:CDS AM494717_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY738144_SP_P-E Feature FT:CDS AY738144_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY738145_SP_C-E Feature FT:CDS AY738145_SP_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY738146_SP_P-E Feature FT:CDS AY738146_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY738147_SP_P-E Feature FT:CDS AY738147_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcaccaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY739674_SP_P-E Feature FT:CDS AY739674_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY739675_SP_P-E Feature FT:CDS AY739675_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY935700_SP_P-E Feature FT:CDS AY935700_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060822_SP_P-E Feature FT:CDS DQ060822_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060823_SP_P-E Feature FT:CDS DQ060823_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060824_SP_P-E Feature FT:CDS DQ060824_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060825_SP_P-E Feature FT:CDS DQ060825_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060826_SP_P-E Feature FT:CDS DQ060826_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccctcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060827_SP_P-E Feature FT:CDS DQ060827_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060828_SP_P-E Feature FT:CDS DQ060828_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060829_SP_P-E Feature FT:CDS DQ060829_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ060830_SP_P-E Feature FT:CDS DQ060830_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239217_SP_P-E Feature FT:CDS EU239217_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239218_SP_P-E Feature FT:CDS EU239218_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239219_SP_P-E Feature FT:CDS EU239219_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239220_SP_P-E Feature FT:CDS EU239220_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcgaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtactcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239221_SP_P-E Feature FT:CDS EU239221_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcgaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU239222_SP_P-E Feature FT:CDS EU239222_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU239223_SP_P-E Feature FT:CDS EU239223_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|EU239224_SP_P-E Feature FT:CDS EU239224_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacggagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtttaaagccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgttcctcc
tggctcagtttactag
>gnl|hbvcds|EU239226_SP_P-E Feature FT:CDS EU239226_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349226_SP_P-E Feature FT:CDS FJ349226_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349237_SP_P-E Feature FT:CDS FJ349237_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349238_SP_P-E Feature FT:CDS FJ349238_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349239_SP_P-E Feature FT:CDS FJ349239_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctacgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349240_SP_P-E Feature FT:CDS FJ349240_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545821_SP_P-E Feature FT:CDS FN545821_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaagggacctctwtgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545822_SP_P-E Feature FT:CDS FN545822_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545823_SP_P-E Feature FT:CDS FN545823_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagamtgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545827_SP_P-E Feature FT:CDS FN545827_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545841_SP_P-E Feature FT:CDS FN545841_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN545842_SP_P-E Feature FT:CDS FN545842_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594748_SP_P-E Feature FT:CDS FN594748_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594749_SP_P-E Feature FT:CDS FN594749_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
tggcctcaccagagcctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594750_SP_P-E Feature FT:CDS FN594750_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgttcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594751_SP_P-E Feature FT:CDS FN594751_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594752_SP_P-E Feature FT:CDS FN594752_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594753_SP_P-E Feature FT:CDS FN594753_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne137). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttyactag
>gnl|hbvcds|FN594756_SP_P-E Feature FT:CDS FN594756_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
aggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggaag
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594758_SP_P-E Feature FT:CDS FN594758_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594759_SP_P-E Feature FT:CDS FN594759_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtgc
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594760_SP_P-E Feature FT:CDS FN594760_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594761_SP_P-E Feature FT:CDS FN594761_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcgaaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FN594762_SP_P-E Feature FT:CDS FN594762_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgttcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594763_SP_P-E Feature FT:CDS FN594763_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594765_SP_P-E Feature FT:CDS FN594765_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtgtccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttmggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FN594766_SP_P-E Feature FT:CDS FN594766_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161755_SP_P-E Feature FT:CDS GQ161755_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161756_SP_P-E Feature FT:CDS GQ161756_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161757_SP_P-E Feature FT:CDS GQ161757_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactattgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161758_SP_P-E Feature FT:CDS GQ161758_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161759_SP_P-E Feature FT:CDS GQ161759_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161760_SP_P-E Feature FT:CDS GQ161760_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtttcccttatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161761_SP_P-E Feature FT:CDS GQ161761_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161762_SP_P-E Feature FT:CDS GQ161762_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161763_SP_P-E Feature FT:CDS GQ161763_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161764_SP_P-E Feature FT:CDS GQ161764_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161765_SP_P-E Feature FT:CDS GQ161765_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacytgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161766_SP_P-E Feature FT:CDS GQ161766_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161768_SP_P-E Feature FT:CDS GQ161768_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ161769_SP_P-E Feature FT:CDS GQ161769_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161770_SP_P-E Feature FT:CDS GQ161770_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161771_SP_P-E Feature FT:CDS GQ161771_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161772_SP_P-E Feature FT:CDS GQ161772_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161773_SP_P-E Feature FT:CDS GQ161773_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161774_SP_P-E Feature FT:CDS GQ161774_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161775_SP_P-E Feature FT:CDS GQ161775_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagtac
gggaccctgcmgaacctgcacgactcytgctcaaggmamctctatgtttccctcatgttgytgttcaaaaccttcggacg
gaaattgcacytgtattcccatcccatcatcatgggctttcgsaaaattcctatgggagtgggcctcagyccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161776_SP_P-E Feature FT:CDS GQ161776_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161777_SP_P-E Feature FT:CDS GQ161777_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161778_SP_P-E Feature FT:CDS GQ161778_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161779_SP_P-E Feature FT:CDS GQ161779_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccggacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161780_SP_P-E Feature FT:CDS GQ161780_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagatctccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161781_SP_P-E Feature FT:CDS GQ161781_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161782_SP_P-E Feature FT:CDS GQ161782_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161783_SP_P-E Feature FT:CDS GQ161783_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161784_SP_P-E Feature FT:CDS GQ161784_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161785_SP_P-E Feature FT:CDS GQ161785_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161786_SP_P-E Feature FT:CDS GQ161786_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|GQ161787_SP_P-E Feature FT:CDS GQ161787_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161789_SP_P-E Feature FT:CDS GQ161789_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161790_SP_P-E Feature FT:CDS GQ161790_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161791_SP_P-E Feature FT:CDS GQ161791_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
ccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161792_SP_P-E Feature FT:CDS GQ161792_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161793_SP_P-E Feature FT:CDS GQ161793_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161794_SP_P-E Feature FT:CDS GQ161794_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161795_SP_P-E Feature FT:CDS GQ161795_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161796_SP_P-E Feature FT:CDS GQ161796_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ161797_SP_P-E Feature FT:CDS GQ161797_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161798_SP_P-E Feature FT:CDS GQ161798_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcgtaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161799_SP_P-E Feature FT:CDS GQ161799_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU732). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161800_SP_P-E Feature FT:CDS GQ161800_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161801_SP_P-E Feature FT:CDS GQ161801_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161802_SP_P-E Feature FT:CDS GQ161802_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161803_SP_P-E Feature FT:CDS GQ161803_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161804_SP_P-E Feature FT:CDS GQ161804_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161805_SP_P-E Feature FT:CDS GQ161805_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1410). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161807_SP_P-E Feature FT:CDS GQ161807_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161808_SP_P-E Feature FT:CDS GQ161808_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161810_SP_P-E Feature FT:CDS GQ161810_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161811_SP_P-E Feature FT:CDS GQ161811_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161812_SP_P-E Feature FT:CDS GQ161812_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161814_SP_P-E Feature FT:CDS GQ161814_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccaacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161815_SP_P-E Feature FT:CDS GQ161815_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161816_SP_P-E Feature FT:CDS GQ161816_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161817_SP_P-E Feature FT:CDS GQ161817_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161818_SP_P-E Feature FT:CDS GQ161818_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1520). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161819_SP_P-E Feature FT:CDS GQ161819_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161820_SP_P-E Feature FT:CDS GQ161820_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161821_SP_P-E Feature FT:CDS GQ161821_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1405). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161823_SP_P-E Feature FT:CDS GQ161823_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161824_SP_P-E Feature FT:CDS GQ161824_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161825_SP_P-E Feature FT:CDS GQ161825_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=333 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagcaggtcctatagaagaagaactccctcacct
cgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtacggg
accctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacggaa
attgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctgg
ctcagtttactag
>gnl|hbvcds|GQ161826_SP_P-E Feature FT:CDS GQ161826_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagaac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ161827_SP_P-E Feature FT:CDS GQ161827_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161828_SP_P-E Feature FT:CDS GQ161828_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161829_SP_P-E Feature FT:CDS GQ161829_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161830_SP_P-E Feature FT:CDS GQ161830_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1365). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161831_SP_P-E Feature FT:CDS GQ161831_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU779). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaactaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161832_SP_P-E Feature FT:CDS GQ161832_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161833_SP_P-E Feature FT:CDS GQ161833_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161834_SP_P-E Feature FT:CDS GQ161834_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161835_SP_P-E Feature FT:CDS GQ161835_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ161836_SP_P-E Feature FT:CDS GQ161836_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU563552_SP_P-E Feature FT:CDS GU563552_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BV-122). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
tgcccctatcttatcaacacctccagagaatactgttgttagacgaagaggcagggcccctaaaagaagaactccctcgc
ctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgatcatcaaccaccagtaca
ggaccctgcagaacctgcacgactcttgctcaagcaacctctatgtttccctcatgttgctgttcaaaaccttcagacag
aaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcat
ggctcagtttactagt
>gnl|hbvcds|HM363565_SP_P-E Feature FT:CDS HM363565_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccattgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggccg
gaaattgcacttgtactcccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363566_SP_P-E Feature FT:CDS HM363566_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363567_SP_P-E Feature FT:CDS HM363567_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363568_SP_P-E Feature FT:CDS HM363568_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363569_SP_P-E Feature FT:CDS HM363569_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcagacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363570_SP_P-E Feature FT:CDS HM363570_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363571_SP_P-E Feature FT:CDS HM363571_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363572_SP_P-E Feature FT:CDS HM363572_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363573_SP_P-E Feature FT:CDS HM363573_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363574_SP_P-E Feature FT:CDS HM363574_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcagacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363575_SP_P-E Feature FT:CDS HM363575_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363576_SP_P-E Feature FT:CDS HM363576_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363577_SP_P-E Feature FT:CDS HM363577_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363578_SP_P-E Feature FT:CDS HM363578_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363579_SP_P-E Feature FT:CDS HM363579_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363580_SP_P-E Feature FT:CDS HM363580_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363581_SP_P-E Feature FT:CDS HM363581_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363582_SP_P-E Feature FT:CDS HM363582_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363583_SP_P-E Feature FT:CDS HM363583_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363584_SP_P-E Feature FT:CDS HM363584_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363585_SP_P-E Feature FT:CDS HM363585_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363586_SP_P-E Feature FT:CDS HM363586_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363587_SP_P-E Feature FT:CDS HM363587_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363588_SP_P-E Feature FT:CDS HM363588_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363589_SP_P-E Feature FT:CDS HM363589_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363590_SP_P-E Feature FT:CDS HM363590_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggaag
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363591_SP_P-E Feature FT:CDS HM363591_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363592_SP_P-E Feature FT:CDS HM363592_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgacacttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggaca
taaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363593_SP_P-E Feature FT:CDS HM363593_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363594_SP_P-E Feature FT:CDS HM363594_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363595_SP_P-E Feature FT:CDS HM363595_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363596_SP_P-E Feature FT:CDS HM363596_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaagaaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363597_SP_P-E Feature FT:CDS HM363597_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcacggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363598_SP_P-E Feature FT:CDS HM363598_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaagaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363599_SP_P-E Feature FT:CDS HM363599_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggatcctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363600_SP_P-E Feature FT:CDS HM363600_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagtac
gggaccctgccgaacatgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363601_SP_P-E Feature FT:CDS HM363601_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363602_SP_P-E Feature FT:CDS HM363602_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363603_SP_P-E Feature FT:CDS HM363603_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctacgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363604_SP_P-E Feature FT:CDS HM363604_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagaatgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363605_SP_P-E Feature FT:CDS HM363605_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgatcctcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363606_SP_P-E Feature FT:CDS HM363606_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363607_SP_P-E Feature FT:CDS HM363607_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgccgatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363608_SP_P-E Feature FT:CDS HM363608_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaacaaacagaac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgattccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363609_SP_P-E Feature FT:CDS HM363609_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363610_SP_P-E Feature FT:CDS HM363610_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM363611_SP_P-E Feature FT:CDS HM363611_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagacctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700550_SP_P-E Feature FT:CDS HQ700550_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700551_SP_P-E Feature FT:CDS HQ700551_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700552_SP_P-E Feature FT:CDS HQ700552_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ000008_SP_P-E Feature FT:CDS JQ000008_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggmcg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ000009_SP_P-E Feature FT:CDS JQ000009_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacttgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF170741_SP_P-E Feature FT:CDS KF170741_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatcccaaccccccccctgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF170742_SP_P-E Feature FT:CDS KF170742_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
kggctcagtttactag
>gnl|hbvcds|KF849713_SP_P-E Feature FT:CDS KF849713_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KF849714_SP_P-E Feature FT:CDS KF849714_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849715_SP_P-E Feature FT:CDS KF849715_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagcac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849716_SP_P-E Feature FT:CDS KF849716_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttccgacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849717_SP_P-E Feature FT:CDS KF849717_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849718_SP_P-E Feature FT:CDS KF849718_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849719_SP_P-E Feature FT:CDS KF849719_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849720_SP_P-E Feature FT:CDS KF849720_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcacggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctta
tggttcagtttactag
>gnl|hbvcds|KF849721_SP_P-E Feature FT:CDS KF849721_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849722_SP_P-E Feature FT:CDS KF849722_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849723_SP_P-E Feature FT:CDS KF849723_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatggggttgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KF849724_SP_P-E Feature FT:CDS KF849724_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849725_SP_P-E Feature FT:CDS KF849725_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849726_SP_P-E Feature FT:CDS KF849726_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggagtgtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849727_SP_P-E Feature FT:CDS KF849727_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF849728_SP_P-E Feature FT:CDS KF849728_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF922438_SP_P-E Feature FT:CDS KF922438_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF922439_SP_P-E Feature FT:CDS KF922439_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM606738_SP_P-E Feature FT:CDS KM606738_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcgaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM606739_SP_P-E Feature FT:CDS KM606739_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccatagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT192626_SP_P-E Feature FT:CDS KT192626_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KT749841_SP_P-E Feature FT:CDS KT749841_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtat
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736891_SP_P-E Feature FT:CDS KU736891_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736892_SP_P-E Feature FT:CDS KU736892_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736893_SP_P-E Feature FT:CDS KU736893_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacraagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736894_SP_P-E Feature FT:CDS KU736894_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736895_SP_P-E Feature FT:CDS KU736895_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736896_SP_P-E Feature FT:CDS KU736896_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736897_SP_P-E Feature FT:CDS KU736897_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736898_SP_P-E Feature FT:CDS KU736898_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736899_SP_P-E Feature FT:CDS KU736899_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736900_SP_P-E Feature FT:CDS KU736900_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736901_SP_P-E Feature FT:CDS KU736901_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgacacttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736902_SP_P-E Feature FT:CDS KU736902_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736903_SP_P-E Feature FT:CDS KU736903_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736904_SP_P-E Feature FT:CDS KU736904_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736905_SP_P-E Feature FT:CDS KU736905_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736906_SP_P-E Feature FT:CDS KU736906_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736907_SP_P-E Feature FT:CDS KU736907_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736908_SP_P-E Feature FT:CDS KU736908_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736909_SP_P-E Feature FT:CDS KU736909_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736910_SP_P-E Feature FT:CDS KU736910_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736911_SP_P-E Feature FT:CDS KU736911_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736912_SP_P-E Feature FT:CDS KU736912_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU736913_SP_P-E Feature FT:CDS KU736913_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccamtgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctyagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX186584_SP_P-E Feature FT:CDS KX186584_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY498770_SP_P-E Feature FT:CDS KY498770_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate P94). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcawcacttccggagamtactgttrttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctmaatctccagcttcccaatgatcatcaaccaccagyac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggccttagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623842_SP_P-E Feature FT:CDS LT623842_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacwcttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgttwccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623843_SP_P-E Feature FT:CDS LT623843_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactyttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623844_SP_P-E Feature FT:CDS LT623844_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcratcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623845_SP_P-E Feature FT:CDS LT623845_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgargaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623846_SP_P-E Feature FT:CDS LT623846_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcacctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623847_SP_P-E Feature FT:CDS LT623847_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
caaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623848_SP_P-E Feature FT:CDS LT623848_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623849_SP_P-E Feature FT:CDS LT623849_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcs
cctcscagacgaagatctcaatcgccgcgtcscagaagatctcaatctccascttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623850_SP_P-E Feature FT:CDS LT623850_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT623851_SP_P-E Feature FT:CDS LT623851_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgamgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcwtgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772354_SP_P-E Feature FT:CDS MF772354_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772355_SP_P-E Feature FT:CDS MF772355_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgttgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|MF772356_SP_P-E Feature FT:CDS MF772356_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1834). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgatcctcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgttnccctcatgttgctgttcaaaaccttcggaag
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772357_SP_P-E Feature FT:CDS MF772357_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772358_SP_P-E Feature FT:CDS MF772358_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggccccctagaggaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772359_SP_P-E Feature FT:CDS MF772359_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 335). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcacggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|MF772360_SP_P-E Feature FT:CDS MF772360_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772361_SP_P-E Feature FT:CDS MF772361_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 801). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctccagcttccaaatgatcctcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF772362_SP_P-E Feature FT:CDS MF772362_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcctcgaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580614_SP_P-E Feature FT:CDS MH580614_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580615_SP_P-E Feature FT:CDS MH580615_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580616_SP_P-E Feature FT:CDS MH580616_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580617_SP_P-E Feature FT:CDS MH580617_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580618_SP_P-E Feature FT:CDS MH580618_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580619_SP_P-E Feature FT:CDS MH580619_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580620_SP_P-E Feature FT:CDS MH580620_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580621_SP_P-E Feature FT:CDS MH580621_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580622_SP_P-E Feature FT:CDS MH580622_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580623_SP_P-E Feature FT:CDS MH580623_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580624_SP_P-E Feature FT:CDS MH580624_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580625_SP_P-E Feature FT:CDS MH580625_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580626_SP_P-E Feature FT:CDS MH580626_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtttaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580628_SP_P-E Feature FT:CDS MH580628_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580629_SP_P-E Feature FT:CDS MH580629_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580630_SP_P-E Feature FT:CDS MH580630_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580631_SP_P-E Feature FT:CDS MH580631_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580632_SP_P-E Feature FT:CDS MH580632_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580633_SP_P-E Feature FT:CDS MH580633_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 398). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactattgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580634_SP_P-E Feature FT:CDS MH580634_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580635_SP_P-E Feature FT:CDS MH580635_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580636_SP_P-E Feature FT:CDS MH580636_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580637_SP_P-E Feature FT:CDS MH580637_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580638_SP_P-E Feature FT:CDS MH580638_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|MH580640_SP_P-E Feature FT:CDS MH580640_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580641_SP_P-E Feature FT:CDS MH580641_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580644_SP_P-E Feature FT:CDS MH580644_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580645_SP_P-E Feature FT:CDS MH580645_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagatcaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccgatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580646_SP_P-E Feature FT:CDS MH580646_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580647_SP_P-E Feature FT:CDS MH580647_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580648_SP_P-E Feature FT:CDS MH580648_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccatcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgttgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580649_SP_P-E Feature FT:CDS MH580649_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580650_SP_P-E Feature FT:CDS MH580650_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580651_SP_P-E Feature FT:CDS MH580651_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH580652_SP_P-E Feature FT:CDS MH580652_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH918655_SP_P-E Feature FT:CDS MH918655_SP_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK321264_SP_P-E Feature FT:CDS MK321264_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK720631_SP_P-E Feature FT:CDS MK720631_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK720632_SP_P-E Feature FT:CDS MK720632_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507840_SP_P-E Feature FT:CDS MN507840_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgtagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctctgtttactag
>gnl|hbvcds|MN507841_SP_P-E Feature FT:CDS MN507841_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcccttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507842_SP_P-E Feature FT:CDS MN507842_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507843_SP_P-E Feature FT:CDS MN507843_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507844_SP_P-E Feature FT:CDS MN507844_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507845_SP_P-E Feature FT:CDS MN507845_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507846_SP_P-E Feature FT:CDS MN507846_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507847_SP_P-E Feature FT:CDS MN507847_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507848_SP_P-E Feature FT:CDS MN507848_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X75657_SP_P-E Feature FT:CDS X75657_SP_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
© 1998-2020Legal notice