HBVdb

Dataset for nucleotide sequence S of genotype E

[Download (right click)] [Alignment] [Repertoires]

915 sequence(s)

>gnl|hbvcds|AB091255_S_P-E Feature FT:CDS AB091255_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091256_S_P-E Feature FT:CDS AB091256_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccattacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091257_S_P-E Feature FT:CDS AB091257_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-183). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091258_S_P-E Feature FT:CDS AB091258_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-239). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091259_S_P-E Feature FT:CDS AB091259_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-241). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091260_S_P-E Feature FT:CDS AB091260_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-259). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091261_S_P-E Feature FT:CDS AB091261_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-261). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091262_S_P-E Feature FT:CDS AB091262_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-302). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgtaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091263_S_P-E Feature FT:CDS AB091263_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-320). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091264_S_P-E Feature FT:CDS AB091264_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-331). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091265_S_P-E Feature FT:CDS AB091265_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-250). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091266_S_P-E Feature FT:CDS AB091266_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-165). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaccatcttgaggccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106564_S_C-E Feature FT:CDS AB106564_S_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactctggctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctgcggacggaaattgcacttgtacccccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194947_S_P-E Feature FT:CDS AB194947_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB194948_S_P-E Feature FT:CDS AB194948_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194954_S_P-E Feature FT:CDS AB194954_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR943). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctgtatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB194955_S_P-E Feature FT:CDS AB194955_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR927). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggcamctctatgt
ttccctcctgttgctgtacaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaga
ttcctatgggagtgggcatcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB201287_S_P-E Feature FT:CDS AB201287_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201288_S_P-E Feature FT:CDS AB201288_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201289_S_P-E Feature FT:CDS AB201289_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201290_S_P-E Feature FT:CDS AB201290_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205129_S_P-E Feature FT:CDS AB205129_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205188_S_P-E Feature FT:CDS AB205188_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205189_S_P-E Feature FT:CDS AB205189_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205190_S_P-E Feature FT:CDS AB205190_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatattgcccgtttg
tcctctacttccaggatcagcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttctgttgtctttgggcatacagttaa
>gnl|hbvcds|AB205191_S_P-E Feature FT:CDS AB205191_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205192_S_P-E Feature FT:CDS AB205192_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205323_S_P-E Feature FT:CDS AB205323_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G46). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgattcctgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgctatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205324_S_P-E Feature FT:CDS AB205324_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G48). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtggggctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtaaagctatcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205325_S_P-E Feature FT:CDS AB205325_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G50). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcctggttgataaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205326_S_P-E Feature FT:CDS AB205326_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G85). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacgcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205327_S_P-E Feature FT:CDS AB205327_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatctacgtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaac
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205328_S_P-E Feature FT:CDS AB205328_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G109). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggctgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205329_S_P-E Feature FT:CDS AB205329_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G2001). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219529_S_P-E Feature FT:CDS AB219529_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219533_S_P-E Feature FT:CDS AB219533_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgaagccctttatac
ctctgttactaatttccttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219534_S_P-E Feature FT:CDS AB219534_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatccagctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctagctcagtttactagtgccatttgttcagtgattcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274969_S_P-E Feature FT:CDS AB274969_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274970_S_P-E Feature FT:CDS AB274970_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274971_S_P-E Feature FT:CDS AB274971_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274972_S_P-E Feature FT:CDS AB274972_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB274973_S_P-E Feature FT:CDS AB274973_S_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcgggcggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB274974_S_P-E Feature FT:CDS AB274974_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274975_S_P-E Feature FT:CDS AB274975_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274976_S_P-E Feature FT:CDS AB274976_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274977_S_P-E Feature FT:CDS AB274977_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274978_S_P-E Feature FT:CDS AB274978_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274979_S_P-E Feature FT:CDS AB274979_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274980_S_P-E Feature FT:CDS AB274980_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtttctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274981_S_P-E Feature FT:CDS AB274981_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274982_S_P-E Feature FT:CDS AB274982_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|AB274984_S_P-E Feature FT:CDS AB274984_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaacaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274985_S_P-E Feature FT:CDS AB274985_S_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915175_S_P-E Feature FT:CDS AB915175_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915176_S_P-E Feature FT:CDS AB915176_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915177_S_P-E Feature FT:CDS AB915177_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctttgt
ttccctcatgttgctgctcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915178_S_P-E Feature FT:CDS AB915178_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
gtccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915180_S_P-E Feature FT:CDS AB915180_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaggtctgtacaccatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208871_S_P-E Feature FT:CDS AF208871_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate jt1836). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494689_S_P-E Feature FT:CDS AM494689_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494690_S_P-E Feature FT:CDS AM494690_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494691_S_P-E Feature FT:CDS AM494691_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494692_S_P-E Feature FT:CDS AM494692_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494693_S_P-E Feature FT:CDS AM494693_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494694_S_P-E Feature FT:CDS AM494694_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494695_S_P-E Feature FT:CDS AM494695_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494696_S_P-E Feature FT:CDS AM494696_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494697_S_P-E Feature FT:CDS AM494697_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctctaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494698_S_P-E Feature FT:CDS AM494698_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494699_S_P-E Feature FT:CDS AM494699_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494700_S_P-E Feature FT:CDS AM494700_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494701_S_P-E Feature FT:CDS AM494701_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494702_S_P-E Feature FT:CDS AM494702_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494703_S_P-E Feature FT:CDS AM494703_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494704_S_P-E Feature FT:CDS AM494704_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494705_S_P-E Feature FT:CDS AM494705_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494706_S_P-E Feature FT:CDS AM494706_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494707_S_P-E Feature FT:CDS AM494707_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494708_S_P-E Feature FT:CDS AM494708_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494709_S_P-E Feature FT:CDS AM494709_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494710_S_P-E Feature FT:CDS AM494710_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494711_S_P-E Feature FT:CDS AM494711_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494712_S_P-E Feature FT:CDS AM494712_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494713_S_P-E Feature FT:CDS AM494713_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494714_S_P-E Feature FT:CDS AM494714_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494715_S_P-E Feature FT:CDS AM494715_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494717_S_P-E Feature FT:CDS AM494717_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494719_S_P-E Feature FT:CDS AM494719_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR001). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcargattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494720_S_P-E Feature FT:CDS AM494720_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR012). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcrtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|AM494721_S_P-E Feature FT:CDS AM494721_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR016). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccgttacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494722_S_P-E Feature FT:CDS AM494722_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR027). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccccatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494723_S_P-E Feature FT:CDS AM494723_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR032). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494724_S_P-E Feature FT:CDS AM494724_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR040). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaacaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattctcatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AM494725_S_P-E Feature FT:CDS AM494725_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR046). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494726_S_P-E Feature FT:CDS AM494726_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR049). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgcctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgytgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494727_S_P-E Feature FT:CDS AM494727_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR055). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcrtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|AM494728_S_P-E Feature FT:CDS AM494728_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR065). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494729_S_P-E Feature FT:CDS AM494729_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR067). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494730_S_P-E Feature FT:CDS AM494730_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR069). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494731_S_P-E Feature FT:CDS AM494731_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR094). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494732_S_P-E Feature FT:CDS AM494732_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR113). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494733_S_P-E Feature FT:CDS AM494733_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccacactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494734_S_P-E Feature FT:CDS AM494734_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494735_S_P-E Feature FT:CDS AM494735_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR136). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttatac
ttctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AM494736_S_P-E Feature FT:CDS AM494736_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR139). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494737_S_P-E Feature FT:CDS AM494737_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR141). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494738_S_P-E Feature FT:CDS AM494738_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR149). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ctccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494739_S_P-E Feature FT:CDS AM494739_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494740_S_P-E Feature FT:CDS AM494740_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR194). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494741_S_P-E Feature FT:CDS AM494741_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR198). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494743_S_P-E Feature FT:CDS AM494743_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR217). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494744_S_P-E Feature FT:CDS AM494744_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR233). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
taccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494745_S_P-E Feature FT:CDS AM494745_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR234). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccgttacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494746_S_P-E Feature FT:CDS AM494746_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggacgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494747_S_P-E Feature FT:CDS AM494747_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaagttgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagcgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacgtttaa
>gnl|hbvcds|AM494748_S_P-E Feature FT:CDS AM494748_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494751_S_P-E Feature FT:CDS AM494751_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR194). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494752_S_P-E Feature FT:CDS AM494752_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR194). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494753_S_P-E Feature FT:CDS AM494753_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR194). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494832_S_P-E Feature FT:CDS AM494832_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177-4). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AY303878_S_P-E Feature FT:CDS AY303878_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate KM1149BTI). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaangcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaccaaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303881_S_P-E Feature FT:CDS AY303881_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1960). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aatwccgcagagtctagactcgtggtgsacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cyctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303882_S_P-E Feature FT:CDS AY303882_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1962). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303883_S_P-E Feature FT:CDS AY303883_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1965). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303884_S_P-E Feature FT:CDS AY303884_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1967). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303885_S_P-E Feature FT:CDS AY303885_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1969). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303886_S_P-E Feature FT:CDS AY303886_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1971). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303887_S_P-E Feature FT:CDS AY303887_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4501). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303888_S_P-E Feature FT:CDS AY303888_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4502). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaagaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|AY303889_S_P-E Feature FT:CDS AY303889_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4503). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgthtgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303890_S_P-E Feature FT:CDS AY303890_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4601). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303891_S_P-E Feature FT:CDS AY303891_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4607). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303892_S_P-E Feature FT:CDS AY303892_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4619). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303893_S_P-E Feature FT:CDS AY303893_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K4633). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303894_S_P-E Feature FT:CDS AY303894_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC222). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcatcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303895_S_P-E Feature FT:CDS AY303895_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC516). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agttcccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303896_S_P-E Feature FT:CDS AY303896_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC175). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303897_S_P-E Feature FT:CDS AY303897_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC276). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattccyaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccmtgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303898_S_P-E Feature FT:CDS AY303898_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303899_S_P-E Feature FT:CDS AY303899_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q174). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303901_S_P-E Feature FT:CDS AY303901_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttttttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgacgggctttc
ccccactgtttggctttcagttatatggatgatggggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctggtaccaattttcttttggctttgggtatacatttaa
>gnl|hbvcds|AY303902_S_P-E Feature FT:CDS AY303902_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q36). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303903_S_P-E Feature FT:CDS AY303903_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q142). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgycgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|AY303904_S_P-E Feature FT:CDS AY303904_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q211). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303905_S_P-E Feature FT:CDS AY303905_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303906_S_P-E Feature FT:CDS AY303906_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303907_S_P-E Feature FT:CDS AY303907_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q641). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303908_S_P-E Feature FT:CDS AY303908_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q639). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcmtcaaccaccagtacgggaccctgcmgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcmgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303909_S_P-E Feature FT:CDS AY303909_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4102). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcmaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303910_S_P-E Feature FT:CDS AY303910_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4156). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctgcagtcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303911_S_P-E Feature FT:CDS AY303911_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4523). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303912_S_P-E Feature FT:CDS AY303912_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4530). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303913_S_P-E Feature FT:CDS AY303913_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtctctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303914_S_P-E Feature FT:CDS AY303914_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4572). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcakagtctagactcgtggtgsacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303915_S_P-E Feature FT:CDS AY303915_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4625). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303916_S_P-E Feature FT:CDS AY303916_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4640). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303917_S_P-E Feature FT:CDS AY303917_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4525). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303918_S_P-E Feature FT:CDS AY303918_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4531). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303919_S_P-E Feature FT:CDS AY303919_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4534). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cactgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303920_S_P-E Feature FT:CDS AY303920_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4535). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303921_S_P-E Feature FT:CDS AY303921_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1060). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303922_S_P-E Feature FT:CDS AY303922_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1477). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303923_S_P-E Feature FT:CDS AY303923_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1458). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303924_S_P-E Feature FT:CDS AY303924_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1428). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303925_S_P-E Feature FT:CDS AY303925_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1508). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303926_S_P-E Feature FT:CDS AY303926_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1643). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccacagtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303927_S_P-E Feature FT:CDS AY303927_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1614). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303928_S_P-E Feature FT:CDS AY303928_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1647). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303929_S_P-E Feature FT:CDS AY303929_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1685). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303930_S_P-E Feature FT:CDS AY303930_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1698). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303931_S_P-E Feature FT:CDS AY303931_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1748). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atmatcttcctcttmatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|AY738144_S_P-E Feature FT:CDS AY738144_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
ggtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738145_S_C-E Feature FT:CDS AY738145_S_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738146_S_P-E Feature FT:CDS AY738146_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738147_S_P-E Feature FT:CDS AY738147_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
accatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738918_S_P-E Feature FT:CDS AY738918_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttacaaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY738919_S_P-E Feature FT:CDS AY738919_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggctgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccacgttctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY738920_S_P-E Feature FT:CDS AY738920_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggatttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY738921_S_P-E Feature FT:CDS AY738921_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctagaccccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY738922_S_P-E Feature FT:CDS AY738922_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atgggaagcatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY738923_S_P-E Feature FT:CDS AY738923_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggatttctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttttctttgggcatacatt
>gnl|hbvcds|AY738924_S_P-E Feature FT:CDS AY738924_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttatctttgggtatacatt
>gnl|hbvcds|AY738925_S_P-E Feature FT:CDS AY738925_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AY739674_S_P-E Feature FT:CDS AY739674_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY739675_S_P-E Feature FT:CDS AY739675_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY935700_S_P-E Feature FT:CDS AY935700_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060822_S_P-E Feature FT:CDS DQ060822_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060823_S_P-E Feature FT:CDS DQ060823_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060824_S_P-E Feature FT:CDS DQ060824_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060825_S_P-E Feature FT:CDS DQ060825_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060826_S_P-E Feature FT:CDS DQ060826_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccctcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060827_S_P-E Feature FT:CDS DQ060827_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgttatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060828_S_P-E Feature FT:CDS DQ060828_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060829_S_P-E Feature FT:CDS DQ060829_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060830_S_P-E Feature FT:CDS DQ060830_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299402_S_P-E Feature FT:CDS DQ299402_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FS_2290). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299403_S_P-E Feature FT:CDS DQ299403_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FS_2290). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299405_S_P-E Feature FT:CDS DQ299405_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BTI_808). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299406_S_P-E Feature FT:CDS DQ299406_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BTI_868). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299407_S_P-E Feature FT:CDS DQ299407_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC_177). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcaaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299410_S_P-E Feature FT:CDS DQ299410_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC_533). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcatatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299411_S_P-E Feature FT:CDS DQ299411_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC_546). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299412_S_P-E Feature FT:CDS DQ299412_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC_69). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299413_S_P-E Feature FT:CDS DQ299413_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HCC_87). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299414_S_P-E Feature FT:CDS DQ299414_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K1958). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299415_S_P-E Feature FT:CDS DQ299415_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4537). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299416_S_P-E Feature FT:CDS DQ299416_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4553). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299417_S_P-E Feature FT:CDS DQ299417_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M4589). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299418_S_P-E Feature FT:CDS DQ299418_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Q53). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|DQ299419_S_P-E Feature FT:CDS DQ299419_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1718). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299420_S_P-E Feature FT:CDS DQ299420_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1798). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412133_S_P-E Feature FT:CDS DQ412133_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S02005646). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaacaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgmcgagctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412134_S_P-E Feature FT:CDS DQ412134_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02006859). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412135_S_P-E Feature FT:CDS DQ412135_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S02009119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412136_S_P-E Feature FT:CDS DQ412136_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02011112). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaaccttcagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatctggagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412137_S_P-E Feature FT:CDS DQ412137_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S02019169). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412138_S_P-E Feature FT:CDS DQ412138_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02019170). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgyctggytttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412139_S_P-E Feature FT:CDS DQ412139_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S02019171). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412140_S_P-E Feature FT:CDS DQ412140_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02022145). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412141_S_P-E Feature FT:CDS DQ412141_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02022150). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412142_S_P-E Feature FT:CDS DQ412142_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s02025809). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412143_S_P-E Feature FT:CDS DQ412143_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03001912). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaagccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatccygctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgstcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|DQ412144_S_P-E Feature FT:CDS DQ412144_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03003585). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggstcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412145_S_P-E Feature FT:CDS DQ412145_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S03010012). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412146_S_P-E Feature FT:CDS DQ412146_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03010174). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412147_S_P-E Feature FT:CDS DQ412147_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03014731). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaagccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtgggggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412148_S_P-E Feature FT:CDS DQ412148_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03017507). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctttcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcactggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412149_S_P-E Feature FT:CDS DQ412149_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S03022819). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctyagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
cctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412150_S_P-E Feature FT:CDS DQ412150_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03023232). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agttyccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412151_S_P-E Feature FT:CDS DQ412151_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s03024567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttccagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgttaccaattttcttttgtctttgggtatacagttaa
>gnl|hbvcds|DQ412152_S_P-E Feature FT:CDS DQ412152_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04000578). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412153_S_P-E Feature FT:CDS DQ412153_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04000910). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412154_S_P-E Feature FT:CDS DQ412154_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04002544). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccgaaattctc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412155_S_P-E Feature FT:CDS DQ412155_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04005169). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggrgccaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttggggatacatctaa
>gnl|hbvcds|DQ412156_S_P-E Feature FT:CDS DQ412156_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04005838). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaacagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412157_S_P-E Feature FT:CDS DQ412157_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04007144). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412158_S_P-E Feature FT:CDS DQ412158_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04007149). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412159_S_P-E Feature FT:CDS DQ412159_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04009364). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412160_S_P-E Feature FT:CDS DQ412160_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04015283). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412161_S_P-E Feature FT:CDS DQ412161_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04015799). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412162_S_P-E Feature FT:CDS DQ412162_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04016388). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412163_S_P-E Feature FT:CDS DQ412163_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04016392). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcatcagcccgtttctcctggctcagtttactagtgccatttgttcaktggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412164_S_P-E Feature FT:CDS DQ412164_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04016393). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412165_S_P-E Feature FT:CDS DQ412165_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04016394). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcraagtctgttcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412166_S_P-E Feature FT:CDS DQ412166_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04024339). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412167_S_P-E Feature FT:CDS DQ412167_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04024457). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412168_S_P-E Feature FT:CDS DQ412168_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s04025341). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412169_S_P-E Feature FT:CDS DQ412169_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05004338). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412170_S_P-E Feature FT:CDS DQ412170_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05006102). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412171_S_P-E Feature FT:CDS DQ412171_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05008972). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagaccctttatac
cgctgtcacyaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412172_S_P-E Feature FT:CDS DQ412172_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05014482). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgayaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412173_S_P-E Feature FT:CDS DQ412173_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05017205). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ412174_S_P-E Feature FT:CDS DQ412174_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s05025257). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412175_S_P-E Feature FT:CDS DQ412175_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate s06000632). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
ctggaaagcatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctaggggaagttcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtccttgggkatacatttaa
>gnl|hbvcds|EF547857_S_P-E Feature FT:CDS EF547857_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FD123-0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaacactgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU159673_S_P-E Feature FT:CDS EU159673_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Irish-16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239217_S_P-E Feature FT:CDS EU239217_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239218_S_P-E Feature FT:CDS EU239218_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239219_S_P-E Feature FT:CDS EU239219_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239220_S_P-E Feature FT:CDS EU239220_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcccatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtactcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttggctttgggcatacatttaa
>gnl|hbvcds|EU239221_S_P-E Feature FT:CDS EU239221_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggcaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcgcgtttg
tcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatctgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtaccacatcttgagtccctttatac
ctctgttaccaattttcttgtgtctttgggcatacatttaa
>gnl|hbvcds|EU239222_S_P-E Feature FT:CDS EU239222_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtatcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239223_S_P-E Feature FT:CDS EU239223_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239224_S_P-E Feature FT:CDS EU239224_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239226_S_P-E Feature FT:CDS EU239226_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgctaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349226_S_P-E Feature FT:CDS FJ349226_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349227_S_P-E Feature FT:CDS FJ349227_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H147). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgtcgaacctgcacaactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349237_S_P-E Feature FT:CDS FJ349237_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349238_S_P-E Feature FT:CDS FJ349238_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349239_S_P-E Feature FT:CDS FJ349239_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349240_S_P-E Feature FT:CDS FJ349240_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692540_S_P-E Feature FT:CDS FJ692540_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_48051). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcay
aataccgcagartctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctkgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692542_S_P-E Feature FT:CDS FJ692542_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_48107). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtccctttwtac
cyctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692543_S_P-E Feature FT:CDS FJ692543_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_48122). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggararcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgaactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccaycatcatgggctttcggaaaa
ttcctatgggagtgggtctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692544_S_P-E Feature FT:CDS FJ692544_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_48139). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692545_S_P-E Feature FT:CDS FJ692545_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50040). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgytgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692546_S_P-E Feature FT:CDS FJ692546_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50046). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccmtgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692547_S_P-E Feature FT:CDS FJ692547_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50063). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692548_S_P-E Feature FT:CDS FJ692548_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50065). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692550_S_P-E Feature FT:CDS FJ692550_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50080). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692551_S_P-E Feature FT:CDS FJ692551_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692552_S_P-E Feature FT:CDS FJ692552_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50047). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactrgtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692553_S_P-E Feature FT:CDS FJ692553_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_50048). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295507_S_P-E Feature FT:CDS FN295507_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctttgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295509_S_P-E Feature FT:CDS FN295509_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatga
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295510_S_P-E Feature FT:CDS FN295510_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
taccctcatgctgctgttcaaaaccttcggwcggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggttcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295520_S_P-E Feature FT:CDS FN295520_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate M28). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggmtatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggcaaggtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|FN295550_S_P-E Feature FT:CDS FN295550_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E2_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295551_S_P-E Feature FT:CDS FN295551_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C4_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295552_S_P-E Feature FT:CDS FN295552_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E5_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295553_S_P-E Feature FT:CDS FN295553_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E6_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtatgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295554_S_P-E Feature FT:CDS FN295554_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate AR2C_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295555_S_P-E Feature FT:CDS FN295555_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate AR7C_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545821_S_P-E Feature FT:CDS FN545821_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctwtgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545822_S_P-E Feature FT:CDS FN545822_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545823_S_P-E Feature FT:CDS FN545823_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545827_S_P-E Feature FT:CDS FN545827_S_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccartcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagwctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545841_S_P-E Feature FT:CDS FN545841_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545842_S_P-E Feature FT:CDS FN545842_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547154_S_P-E Feature FT:CDS FN547154_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttttttgttgacaaaaatcctcac
aataccgcagagcctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547155_S_P-E Feature FT:CDS FN547155_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtrtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctytcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgytaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547156_S_P-E Feature FT:CDS FN547156_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547158_S_P-E Feature FT:CDS FN547158_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547159_S_P-E Feature FT:CDS FN547159_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgycgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547160_S_P-E Feature FT:CDS FN547160_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547161_S_P-E Feature FT:CDS FN547161_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|FN547162_S_P-E Feature FT:CDS FN547162_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgycgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547163_S_P-E Feature FT:CDS FN547163_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaargtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtrtacatttaa
>gnl|hbvcds|FN547164_S_P-E Feature FT:CDS FN547164_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcmtaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcwtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547165_S_P-E Feature FT:CDS FN547165_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccgaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggytatcgctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547167_S_P-E Feature FT:CDS FN547167_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|FN547168_S_P-E Feature FT:CDS FN547168_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547169_S_P-E Feature FT:CDS FN547169_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtagacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtttctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547170_S_P-E Feature FT:CDS FN547170_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547171_S_P-E Feature FT:CDS FN547171_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547172_S_P-E Feature FT:CDS FN547172_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttrccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547173_S_P-E Feature FT:CDS FN547173_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547174_S_P-E Feature FT:CDS FN547174_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547175_S_P-E Feature FT:CDS FN547175_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgc
ttccctcatgttgctgtwcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttatac
ctctgttaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|FN547176_S_P-E Feature FT:CDS FN547176_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN547177_S_P-E Feature FT:CDS FN547177_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547178_S_P-E Feature FT:CDS FN547178_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtactggctatcgctggatgtgcctgcggcgtttt
atcaccttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547179_S_P-E Feature FT:CDS FN547179_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtaygggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547180_S_P-E Feature FT:CDS FN547180_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547181_S_P-E Feature FT:CDS FN547181_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547182_S_P-E Feature FT:CDS FN547182_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatccagctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547183_S_P-E Feature FT:CDS FN547183_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547184_S_P-E Feature FT:CDS FN547184_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatytcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtrcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547185_S_P-E Feature FT:CDS FN547185_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547186_S_P-E Feature FT:CDS FN547186_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcamggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547187_S_P-E Feature FT:CDS FN547187_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547188_S_P-E Feature FT:CDS FN547188_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtwcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547189_S_P-E Feature FT:CDS FN547189_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547190_S_P-E Feature FT:CDS FN547190_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcctcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547191_S_P-E Feature FT:CDS FN547191_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggamggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547192_S_P-E Feature FT:CDS FN547192_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547193_S_P-E Feature FT:CDS FN547193_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547194_S_P-E Feature FT:CDS FN547194_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547195_S_P-E Feature FT:CDS FN547195_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggaragctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547196_S_P-E Feature FT:CDS FN547196_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547197_S_P-E Feature FT:CDS FN547197_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547198_S_P-E Feature FT:CDS FN547198_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagaatctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547199_S_P-E Feature FT:CDS FN547199_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547200_S_P-E Feature FT:CDS FN547200_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|FN547201_S_P-E Feature FT:CDS FN547201_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctycttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaaacacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547202_S_P-E Feature FT:CDS FN547202_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547203_S_P-E Feature FT:CDS FN547203_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547204_S_P-E Feature FT:CDS FN547204_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaccatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547205_S_P-E Feature FT:CDS FN547205_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547206_S_P-E Feature FT:CDS FN547206_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcat
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaac
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547207_S_P-E Feature FT:CDS FN547207_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547209_S_P-E Feature FT:CDS FN547209_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547210_S_P-E Feature FT:CDS FN547210_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccyctaattccaggatcatcaaccaccagtacgggaccytgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547211_S_P-E Feature FT:CDS FN547211_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtycccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctrgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547212_S_P-E Feature FT:CDS FN547212_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgytcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547213_S_P-E Feature FT:CDS FN547213_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547214_S_P-E Feature FT:CDS FN547214_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547215_S_P-E Feature FT:CDS FN547215_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547217_S_P-E Feature FT:CDS FN547217_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547218_S_P-E Feature FT:CDS FN547218_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547219_S_P-E Feature FT:CDS FN547219_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcatcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccggactttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtccctttatac
ctctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|FN547220_S_P-E Feature FT:CDS FN547220_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctwtgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547221_S_P-E Feature FT:CDS FN547221_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN547222_S_P-E Feature FT:CDS FN547222_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tccycyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgaggccctttatac
ctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547223_S_P-E Feature FT:CDS FN547223_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547224_S_P-E Feature FT:CDS FN547224_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcatcaaccaccagtacgggaccctgycgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547225_S_P-E Feature FT:CDS FN547225_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547226_S_P-E Feature FT:CDS FN547226_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547227_S_P-E Feature FT:CDS FN547227_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547229_S_P-E Feature FT:CDS FN547229_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547230_S_P-E Feature FT:CDS FN547230_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547231_S_P-E Feature FT:CDS FN547231_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547232_S_P-E Feature FT:CDS FN547232_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547233_S_P-E Feature FT:CDS FN547233_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgttacyaattttcttktgtctttgggtatacatctaa
>gnl|hbvcds|FN547234_S_P-E Feature FT:CDS FN547234_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547236_S_P-E Feature FT:CDS FN547236_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547237_S_P-E Feature FT:CDS FN547237_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547239_S_P-E Feature FT:CDS FN547239_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccrtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|FN547240_S_P-E Feature FT:CDS FN547240_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgsaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtrtacatttaa
>gnl|hbvcds|FN547246_S_P-E Feature FT:CDS FN547246_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgtaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547248_S_P-E Feature FT:CDS FN547248_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcmaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547250_S_P-E Feature FT:CDS FN547250_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgcacgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctacttccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctmtgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547251_S_P-E Feature FT:CDS FN547251_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547252_S_P-E Feature FT:CDS FN547252_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaacctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547253_S_P-E Feature FT:CDS FN547253_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactmttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547254_S_P-E Feature FT:CDS FN547254_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctggttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547255_S_P-E Feature FT:CDS FN547255_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttgtgtctttgggtgtacatttaa
>gnl|hbvcds|FN547256_S_P-E Feature FT:CDS FN547256_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547257_S_P-E Feature FT:CDS FN547257_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547258_S_P-E Feature FT:CDS FN547258_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547259_S_P-E Feature FT:CDS FN547259_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547260_S_P-E Feature FT:CDS FN547260_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgtttcccgtttg
tcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547261_S_P-E Feature FT:CDS FN547261_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN547262_S_P-E Feature FT:CDS FN547262_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagactgtaccacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547263_S_P-E Feature FT:CDS FN547263_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN547264_S_P-E Feature FT:CDS FN547264_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547265_S_P-E Feature FT:CDS FN547265_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547266_S_P-E Feature FT:CDS FN547266_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN547267_S_P-E Feature FT:CDS FN547267_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547268_S_P-E Feature FT:CDS FN547268_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgwacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547269_S_P-E Feature FT:CDS FN547269_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccmtttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547270_S_P-E Feature FT:CDS FN547270_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547271_S_P-E Feature FT:CDS FN547271_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547272_S_P-E Feature FT:CDS FN547272_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547274_S_P-E Feature FT:CDS FN547274_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccycactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547275_S_P-E Feature FT:CDS FN547275_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547276_S_P-E Feature FT:CDS FN547276_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547277_S_P-E Feature FT:CDS FN547277_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547278_S_P-E Feature FT:CDS FN547278_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcayctgcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547279_S_P-E Feature FT:CDS FN547279_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547280_S_P-E Feature FT:CDS FN547280_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcacgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctkgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaycaaccaacagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctyatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|FN547281_S_P-E Feature FT:CDS FN547281_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgtttcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
twcctatgggagtgggcctcagcccgtttctcctggctcartttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547282_S_P-E Feature FT:CDS FN547282_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547283_S_P-E Feature FT:CDS FN547283_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547284_S_P-E Feature FT:CDS FN547284_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547285_S_P-E Feature FT:CDS FN547285_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547286_S_P-E Feature FT:CDS FN547286_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547287_S_P-E Feature FT:CDS FN547287_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547288_S_P-E Feature FT:CDS FN547288_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547289_S_P-E Feature FT:CDS FN547289_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagttcactagcgccatttgttcagtggttcgccgggcattc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547290_S_P-E Feature FT:CDS FN547290_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtatgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacgcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547292_S_P-E Feature FT:CDS FN547292_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547293_S_P-E Feature FT:CDS FN547293_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547294_S_P-E Feature FT:CDS FN547294_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttactaattttcttttatctttggggataaatataa
>gnl|hbvcds|FN547295_S_P-E Feature FT:CDS FN547295_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
twccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaaaactgttcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547296_S_P-E Feature FT:CDS FN547296_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcmcgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgactcagtttactagtgccatttgctcrgtgattcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547297_S_P-E Feature FT:CDS FN547297_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggtgcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547298_S_P-E Feature FT:CDS FN547298_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgracctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttyggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547299_S_P-E Feature FT:CDS FN547299_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaagccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547300_S_P-E Feature FT:CDS FN547300_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcagcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttccagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcggggtatgttacccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttctgttgtctttgggtatacagttaa
>gnl|hbvcds|FN547301_S_P-E Feature FT:CDS FN547301_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547302_S_P-E Feature FT:CDS FN547302_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggatggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547303_S_P-E Feature FT:CDS FN547303_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtcccttttttc
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547304_S_P-E Feature FT:CDS FN547304_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaarcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547310_S_P-E Feature FT:CDS FN547310_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547311_S_P-E Feature FT:CDS FN547311_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctttatac
ytctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547318_S_P-E Feature FT:CDS FN547318_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547319_S_P-E Feature FT:CDS FN547319_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547333_S_P-E Feature FT:CDS FN547333_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547339_S_P-E Feature FT:CDS FN547339_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547347_S_P-E Feature FT:CDS FN547347_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FN547356_S_P-E Feature FT:CDS FN547356_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547358_S_P-E Feature FT:CDS FN547358_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547359_S_P-E Feature FT:CDS FN547359_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattygc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgyaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547362_S_P-E Feature FT:CDS FN547362_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaagacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594748_S_P-E Feature FT:CDS FN594748_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594749_S_P-E Feature FT:CDS FN594749_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tactctaattccaggatcatcaaccaccagtactggcctcaccagagcctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594750_S_P-E Feature FT:CDS FN594750_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594751_S_P-E Feature FT:CDS FN594751_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggactcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttggcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctggtgggatcttcaggactatcaaggtatgttgcgcgagtg
tcctcaaactccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594752_S_P-E Feature FT:CDS FN594752_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594753_S_P-E Feature FT:CDS FN594753_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne137). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctatatac
atctgtgaccaatttccttttgtccttgggcatacatttaa
>gnl|hbvcds|FN594756_S_P-E Feature FT:CDS FN594756_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594758_S_P-E Feature FT:CDS FN594758_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594759_S_P-E Feature FT:CDS FN594759_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtgcgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594760_S_P-E Feature FT:CDS FN594760_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggggctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggaatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctsgctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594761_S_P-E Feature FT:CDS FN594761_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgaaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatac
cgctgtwaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|FN594762_S_P-E Feature FT:CDS FN594762_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
cctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594763_S_P-E Feature FT:CDS FN594763_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594765_S_P-E Feature FT:CDS FN594765_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgcctg
tcctctaactccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
gtccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttmggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594766_S_P-E Feature FT:CDS FN594766_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcaccacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtatt
ttcatcttcctcttcatcctgctgctatgcctcatcttcttgttggatcttctggactatcaaggtatcttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161755_S_P-E Feature FT:CDS GQ161755_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161756_S_P-E Feature FT:CDS GQ161756_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161757_S_P-E Feature FT:CDS GQ161757_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161758_S_P-E Feature FT:CDS GQ161758_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161759_S_P-E Feature FT:CDS GQ161759_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161760_S_P-E Feature FT:CDS GQ161760_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
ttcccttatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161761_S_P-E Feature FT:CDS GQ161761_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161762_S_P-E Feature FT:CDS GQ161762_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161763_S_P-E Feature FT:CDS GQ161763_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161764_S_P-E Feature FT:CDS GQ161764_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161765_S_P-E Feature FT:CDS GQ161765_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161766_S_P-E Feature FT:CDS GQ161766_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161768_S_P-E Feature FT:CDS GQ161768_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccatttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161769_S_P-E Feature FT:CDS GQ161769_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161770_S_P-E Feature FT:CDS GQ161770_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161771_S_P-E Feature FT:CDS GQ161771_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggactttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161772_S_P-E Feature FT:CDS GQ161772_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161773_S_P-E Feature FT:CDS GQ161773_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161774_S_P-E Feature FT:CDS GQ161774_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161775_S_P-E Feature FT:CDS GQ161775_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttcyctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccakgatcatcaaccaccagtacgggaccctgcmgaacctgcacgactcytgctcaaggmamctctatgt
ttccctcatgttgytgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcgsaaaa
ttcctatgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|GQ161776_S_P-E Feature FT:CDS GQ161776_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161777_S_P-E Feature FT:CDS GQ161777_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161778_S_P-E Feature FT:CDS GQ161778_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161779_S_P-E Feature FT:CDS GQ161779_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161780_S_P-E Feature FT:CDS GQ161780_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161781_S_P-E Feature FT:CDS GQ161781_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161782_S_P-E Feature FT:CDS GQ161782_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161783_S_P-E Feature FT:CDS GQ161783_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161784_S_P-E Feature FT:CDS GQ161784_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161785_S_P-E Feature FT:CDS GQ161785_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161786_S_P-E Feature FT:CDS GQ161786_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161787_S_P-E Feature FT:CDS GQ161787_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161789_S_P-E Feature FT:CDS GQ161789_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161790_S_P-E Feature FT:CDS GQ161790_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161791_S_P-E Feature FT:CDS GQ161791_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161792_S_P-E Feature FT:CDS GQ161792_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161793_S_P-E Feature FT:CDS GQ161793_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161794_S_P-E Feature FT:CDS GQ161794_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161795_S_P-E Feature FT:CDS GQ161795_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161796_S_P-E Feature FT:CDS GQ161796_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161797_S_P-E Feature FT:CDS GQ161797_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161798_S_P-E Feature FT:CDS GQ161798_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgtaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161799_S_P-E Feature FT:CDS GQ161799_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU732). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161800_S_P-E Feature FT:CDS GQ161800_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161801_S_P-E Feature FT:CDS GQ161801_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161802_S_P-E Feature FT:CDS GQ161802_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161803_S_P-E Feature FT:CDS GQ161803_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161804_S_P-E Feature FT:CDS GQ161804_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161805_S_P-E Feature FT:CDS GQ161805_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1410). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161807_S_P-E Feature FT:CDS GQ161807_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161808_S_P-E Feature FT:CDS GQ161808_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161810_S_P-E Feature FT:CDS GQ161810_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161811_S_P-E Feature FT:CDS GQ161811_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161812_S_P-E Feature FT:CDS GQ161812_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161814_S_P-E Feature FT:CDS GQ161814_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161815_S_P-E Feature FT:CDS GQ161815_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161816_S_P-E Feature FT:CDS GQ161816_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161817_S_P-E Feature FT:CDS GQ161817_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161818_S_P-E Feature FT:CDS GQ161818_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1520). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161819_S_P-E Feature FT:CDS GQ161819_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161820_S_P-E Feature FT:CDS GQ161820_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcytggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggrctatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161821_S_P-E Feature FT:CDS GQ161821_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1405). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161822_S_P-E Feature FT:CDS GQ161822_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1086). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtctctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|GQ161823_S_P-E Feature FT:CDS GQ161823_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161824_S_P-E Feature FT:CDS GQ161824_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161825_S_P-E Feature FT:CDS GQ161825_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161826_S_P-E Feature FT:CDS GQ161826_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161827_S_P-E Feature FT:CDS GQ161827_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161828_S_P-E Feature FT:CDS GQ161828_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161829_S_P-E Feature FT:CDS GQ161829_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161830_S_P-E Feature FT:CDS GQ161830_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1365). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161831_S_P-E Feature FT:CDS GQ161831_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU779). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggcaatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggtccttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161832_S_P-E Feature FT:CDS GQ161832_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtatgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161833_S_P-E Feature FT:CDS GQ161833_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|GQ161834_S_P-E Feature FT:CDS GQ161834_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ161835_S_P-E Feature FT:CDS GQ161835_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161836_S_P-E Feature FT:CDS GQ161836_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486079_S_P-E Feature FT:CDS GQ486079_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS44). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacamcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ486093_S_P-E Feature FT:CDS GQ486093_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS58). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgccgggctttc
ccycaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486116_S_P-E Feature FT:CDS GQ486116_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS81). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggcmaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486131_S_P-E Feature FT:CDS GQ486131_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486240_S_P-E Feature FT:CDS GQ486240_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS205). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattytctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486258_S_P-E Feature FT:CDS GQ486258_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS223). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgckcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgkgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486295_S_P-E Feature FT:CDS GQ486295_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS260). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcstggccaaaattcgc
agtycccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486411_S_P-E Feature FT:CDS GQ486411_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS376). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486451_S_P-E Feature FT:CDS GQ486451_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS416). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttcttgttgacaaaaatcctmac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatctggagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486548_S_P-E Feature FT:CDS GQ486548_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS513). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486579_S_P-E Feature FT:CDS GQ486579_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS544). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486656_S_P-E Feature FT:CDS GQ486656_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS621). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486664_S_P-E Feature FT:CDS GQ486664_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS629). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|GQ486665_S_P-E Feature FT:CDS GQ486665_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS630). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ486692_S_P-E Feature FT:CDS GQ486692_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS657). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcrtcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486701_S_P-E Feature FT:CDS GQ486701_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS666). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctmgactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcatcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486707_S_P-E Feature FT:CDS GQ486707_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS672). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccscagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggsgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccrtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagwctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486728_S_P-E Feature FT:CDS GQ486728_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS693). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ486756_S_P-E Feature FT:CDS GQ486756_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS721). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486765_S_P-E Feature FT:CDS GQ486765_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS730). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgaytcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatrgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtwaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ486778_S_P-E Feature FT:CDS GQ486778_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GS743). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggttcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttacac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ491107_S_P-E Feature FT:CDS GQ491107_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8804335). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgaccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563552_S_P-E Feature FT:CDS GU563552_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BV-122). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
tagaaggcatcacatcaggattcctaagacccctgctcgtgttacaggcgaggtttttcttgttgacaaaaatcctcaca
ataccgcagagtctagactcgtagtagacttctctcagttttctaaaaagagctcccgtgtgtcctggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctagctatcgctagatgtgactgcggcatttta
tcatcttcctcttcatcctgctgctatgcctcatcttcttgttagttcttctggactatcaaggtatgttgcccgtttgt
cctccaattccaagatcatcaaccaccagtacaggaccctgcagaacctgcacgactcttgctcaagcaacctctatgtt
tccctcatgttgctgttcaaaaccttcagacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaat
tcctatgggggtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttcc
cccattgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacc
tctgttaccaattttcttttgtctttgggtatacatttaaa
>gnl|hbvcds|HM363565_S_P-E Feature FT:CDS HM363565_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aattccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggccggaaattgcacttgtactcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363566_S_P-E Feature FT:CDS HM363566_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363567_S_P-E Feature FT:CDS HM363567_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363568_S_P-E Feature FT:CDS HM363568_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363569_S_P-E Feature FT:CDS HM363569_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363570_S_P-E Feature FT:CDS HM363570_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363571_S_P-E Feature FT:CDS HM363571_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363572_S_P-E Feature FT:CDS HM363572_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaaccctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM363573_S_P-E Feature FT:CDS HM363573_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaatattctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM363574_S_P-E Feature FT:CDS HM363574_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363575_S_P-E Feature FT:CDS HM363575_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363576_S_P-E Feature FT:CDS HM363576_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363577_S_P-E Feature FT:CDS HM363577_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctctagtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363578_S_P-E Feature FT:CDS HM363578_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363579_S_P-E Feature FT:CDS HM363579_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363580_S_P-E Feature FT:CDS HM363580_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363581_S_P-E Feature FT:CDS HM363581_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363582_S_P-E Feature FT:CDS HM363582_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363583_S_P-E Feature FT:CDS HM363583_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363584_S_P-E Feature FT:CDS HM363584_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363585_S_P-E Feature FT:CDS HM363585_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363586_S_P-E Feature FT:CDS HM363586_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363587_S_P-E Feature FT:CDS HM363587_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363588_S_P-E Feature FT:CDS HM363588_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363589_S_P-E Feature FT:CDS HM363589_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363590_S_P-E Feature FT:CDS HM363590_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363591_S_P-E Feature FT:CDS HM363591_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363592_S_P-E Feature FT:CDS HM363592_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacataaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363593_S_P-E Feature FT:CDS HM363593_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363594_S_P-E Feature FT:CDS HM363594_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363595_S_P-E Feature FT:CDS HM363595_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgggtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HM363596_S_P-E Feature FT:CDS HM363596_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagaaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363597_S_P-E Feature FT:CDS HM363597_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363598_S_P-E Feature FT:CDS HM363598_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcagcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaagaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363599_S_P-E Feature FT:CDS HM363599_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggatcctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggctaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363600_S_P-E Feature FT:CDS HM363600_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattcccggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363601_S_P-E Feature FT:CDS HM363601_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363602_S_P-E Feature FT:CDS HM363602_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgataaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363603_S_P-E Feature FT:CDS HM363603_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtcttgggggcgaggtctgtacaccatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363604_S_P-E Feature FT:CDS HM363604_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363605_S_P-E Feature FT:CDS HM363605_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363606_S_P-E Feature FT:CDS HM363606_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatccggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363607_S_P-E Feature FT:CDS HM363607_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363608_S_P-E Feature FT:CDS HM363608_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaacagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatga
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgctcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363609_S_P-E Feature FT:CDS HM363609_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363610_S_P-E Feature FT:CDS HM363610_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363611_S_P-E Feature FT:CDS HM363611_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700550_S_P-E Feature FT:CDS HQ700550_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=681 residues).
atcgaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700551_S_P-E Feature FT:CDS HQ700551_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
cctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HQ700552_S_P-E Feature FT:CDS HQ700552_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN226074_S_P-E Feature FT:CDS JN226074_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PTV777_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcccaggacccctgctcgtgttacaggcggggttttcctcgttgacaaaaatcctcac
aataccgcggartmtagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggakcatcaaccaccagtacgggaccctgccgaacctgcacgactgttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JN604166_S_P-E Feature FT:CDS JN604166_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 477-9536-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604168_S_P-E Feature FT:CDS JN604168_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 477-9824-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604192_S_P-E Feature FT:CDS JN604192_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 479-6870-8). Partial genome (Contains: HBe, HBc, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atgaaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggwggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|JN604235_S_P-E Feature FT:CDS JN604235_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 478-2158-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ000002_S_P-E Feature FT:CDS JQ000002_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000003_S_P-E Feature FT:CDS JQ000003_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000004_S_P-E Feature FT:CDS JQ000004_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cactgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000005_S_P-E Feature FT:CDS JQ000005_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cactgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000006_S_P-E Feature FT:CDS JQ000006_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000007_S_P-E Feature FT:CDS JQ000007_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacttgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacagaaattgcacttgaattcccatcccctcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|JQ000008_S_P-E Feature FT:CDS JQ000008_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggmcggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ000009_S_P-E Feature FT:CDS JQ000009_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacttgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972812_S_P-E Feature FT:CDS JQ972812_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972813_S_P-E Feature FT:CDS JQ972813_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972814_S_P-E Feature FT:CDS JQ972814_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972815_S_P-E Feature FT:CDS JQ972815_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcttggccaaaattcgc
rgtcccmaacctccartcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcatgggctttcgsaaaa
ttcctatgggaatgggcctcagcccgtttctcctggctcartttactagygcmatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtwcaacatcttgartccctttatac
ctctgtraccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972816_S_P-E Feature FT:CDS JQ972816_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972817_S_P-E Feature FT:CDS JQ972817_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972818_S_P-E Feature FT:CDS JQ972818_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
taccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972819_S_P-E Feature FT:CDS JQ972819_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972820_S_P-E Feature FT:CDS JQ972820_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttkcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972821_S_P-E Feature FT:CDS JQ972821_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972822_S_P-E Feature FT:CDS JQ972822_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|JQ972823_S_P-E Feature FT:CDS JQ972823_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972824_S_P-E Feature FT:CDS JQ972824_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972825_S_P-E Feature FT:CDS JQ972825_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972826_S_P-E Feature FT:CDS JQ972826_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctrattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacymytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctkgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972827_S_P-E Feature FT:CDS JQ972827_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccartcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccamcagtacgggaccctgccgaacctgcacgactcttgytcaaggaacctctatgt
ttccctcatgttgctgttyaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972828_S_P-E Feature FT:CDS JQ972828_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ972829_S_P-E Feature FT:CDS JQ972829_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849596_S_P-E Feature FT:CDS JX849596_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PTV777_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcccaggacccctgctcgtgttacaggcggggttttcctcgttgacaaaaatcctcac
aataccgcggartmtagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggakcatcaaccaccagtacgggaccctgccgaacctgcacgactgttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JX849617_S_P-E Feature FT:CDS JX849617_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES001_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849618_S_P-E Feature FT:CDS JX849618_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES002_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849619_S_P-E Feature FT:CDS JX849619_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES003_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttcttgttgacaaaaatcctmac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctcyaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatctggagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849620_S_P-E Feature FT:CDS JX849620_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES004_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849621_S_P-E Feature FT:CDS JX849621_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES005_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcstggccaaaattcgc
agtycccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849622_S_P-E Feature FT:CDS JX849622_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES006_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattytctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849623_S_P-E Feature FT:CDS JX849623_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES007_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849624_S_P-E Feature FT:CDS JX849624_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES008_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggcmaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849625_S_P-E Feature FT:CDS JX849625_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES009_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgccgggctttc
ccycaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849626_S_P-E Feature FT:CDS JX849626_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BES010_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacamcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849629_S_P-E Feature FT:CDS JX849629_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PTV088_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849630_S_P-E Feature FT:CDS JX849630_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 120). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JX849631_S_P-E Feature FT:CDS JX849631_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 151). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|KC885607_S_P-E Feature FT:CDS KC885607_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate hetero26-08). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170741_S_P-E Feature FT:CDS KF170741_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttcagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170742_S_P-E Feature FT:CDS KF170742_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcckggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170750_S_P-E Feature FT:CDS KF170750_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_004). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttacac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170751_S_P-E Feature FT:CDS KF170751_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_022). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgt
ttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170752_S_P-E Feature FT:CDS KF170752_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_088). Partial genome (Contains: SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgt
atccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagagtgtacaccatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170753_S_P-E Feature FT:CDS KF170753_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_120). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170779_S_P-E Feature FT:CDS KF170779_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_058). Partial genome (Contains: SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagacacgtggtggacttctctcaattttctagggggagctcccgggtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcttgctaaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggagaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170780_S_P-E Feature FT:CDS KF170780_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_059). Partial genome (Contains: SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170781_S_P-E Feature FT:CDS KF170781_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_095). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170782_S_P-E Feature FT:CDS KF170782_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_002). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctgtcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170783_S_P-E Feature FT:CDS KF170783_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170784_S_P-E Feature FT:CDS KF170784_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_066). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KF170785_S_P-E Feature FT:CDS KF170785_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_084). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170786_S_P-E Feature FT:CDS KF170786_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_086). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170787_S_P-E Feature FT:CDS KF170787_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_110). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggaggggttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctacctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KF170788_S_P-E Feature FT:CDS KF170788_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170789_S_P-E Feature FT:CDS KF170789_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170790_S_P-E Feature FT:CDS KF170790_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtccaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771921_S_P-E Feature FT:CDS KF771921_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771926_S_P-E Feature FT:CDS KF771926_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC42). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgcctcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771927_S_P-E Feature FT:CDS KF771927_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctygttggktcttctggactatcaaggtatgttgcccgtttg
tcctctrattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771930_S_P-E Feature FT:CDS KF771930_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC40). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KF771933_S_P-E Feature FT:CDS KF771933_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC39). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771939_S_P-E Feature FT:CDS KF771939_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC49). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaagacatcacatcaggattcctagaacccctgcgcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtctctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaacagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF771944_S_P-E Feature FT:CDS KF771944_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ARC19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849713_S_P-E Feature FT:CDS KF849713_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849714_S_P-E Feature FT:CDS KF849714_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849715_S_P-E Feature FT:CDS KF849715_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849716_S_P-E Feature FT:CDS KF849716_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttccgacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849717_S_P-E Feature FT:CDS KF849717_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849718_S_P-E Feature FT:CDS KF849718_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849719_S_P-E Feature FT:CDS KF849719_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849720_S_P-E Feature FT:CDS KF849720_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttcttatggttcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849721_S_P-E Feature FT:CDS KF849721_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849722_S_P-E Feature FT:CDS KF849722_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849723_S_P-E Feature FT:CDS KF849723_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatggggttgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtctctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849724_S_P-E Feature FT:CDS KF849724_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849725_S_P-E Feature FT:CDS KF849725_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849726_S_P-E Feature FT:CDS KF849726_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849727_S_P-E Feature FT:CDS KF849727_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849728_S_P-E Feature FT:CDS KF849728_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF922438_S_P-E Feature FT:CDS KF922438_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF922439_S_P-E Feature FT:CDS KF922439_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108590_S_P-E Feature FT:CDS KM108590_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH120overtDE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgaagccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108610_S_P-E Feature FT:CDS KM108610_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH020overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KM108622_S_P-E Feature FT:CDS KM108622_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH116overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108623_S_P-E Feature FT:CDS KM108623_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH152OBIE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaccatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108624_S_P-E Feature FT:CDS KM108624_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH174OBIE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|KM108625_S_P-E Feature FT:CDS KM108625_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH188overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108626_S_P-E Feature FT:CDS KM108626_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH193overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggactctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaatcttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KM606738_S_P-E Feature FT:CDS KM606738_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcgaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|KM606739_S_P-E Feature FT:CDS KM606739_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KM983581_S_P-E Feature FT:CDS KM983581_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab2219). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtctctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983582_S_P-E Feature FT:CDS KM983582_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab2709117). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggctctttacac
cgctgttactaactttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983583_S_P-E Feature FT:CDS KM983583_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab1213). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttacac
ctctgttactaattttcttttatctttgggtatacatttga
>gnl|hbvcds|KM983584_S_P-E Feature FT:CDS KM983584_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab745). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataaaaatcctcac
aataccgcaaagtctaggctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagccactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ctccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983585_S_P-E Feature FT:CDS KM983585_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab98). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983586_S_P-E Feature FT:CDS KM983586_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab2370). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctaaactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983587_S_P-E Feature FT:CDS KM983587_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab2333). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983588_S_P-E Feature FT:CDS KM983588_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab2249). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcttggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatccagctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaacctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983589_S_P-E Feature FT:CDS KM983589_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab92BMB). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM983590_S_P-E Feature FT:CDS KM983590_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gab1213BMB). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttacac
ctctgttactaattttcttttatctttgggtatacatttga
>gnl|hbvcds|KP997699_S_P-E Feature FT:CDS KP997699_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 337). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctccttattggttcttctggattctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcmgracctgcacgactcytgctcaaggaacctctatgt
twccctcatgttgctgttyaaaaccttcggacggaaaytgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KR139749_S_P-E Feature FT:CDS KR139749_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA45). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgaaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KT192626_S_P-E Feature FT:CDS KT192626_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KT749841_S_P-E Feature FT:CDS KT749841_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711608_S_P-E Feature FT:CDS KU711608_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 019N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaacatcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711609_S_P-E Feature FT:CDS KU711609_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 162E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711610_S_P-E Feature FT:CDS KU711610_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 078N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711611_S_P-E Feature FT:CDS KU711611_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 157N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711612_S_P-E Feature FT:CDS KU711612_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 063N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgactccctttatac
ctctgttaccaattttcttttatctttgggcatccatttaa
>gnl|hbvcds|KU711617_S_P-E Feature FT:CDS KU711617_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 057N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711620_S_P-E Feature FT:CDS KU711620_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 076N). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KU711628_S_P-E Feature FT:CDS KU711628_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 064N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcagcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaac
ttcctatgggggtgggcctcagcccgtttctcctggctcagttcactagcgccatctgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttacac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711629_S_P-E Feature FT:CDS KU711629_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 127E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaga
ttcctatgggtgtgggcctcagcccgtttctcctggctcagttcacaagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711630_S_P-E Feature FT:CDS KU711630_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 091E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtgcgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcatggctcagttcactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|KU711631_S_P-E Feature FT:CDS KU711631_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtatttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctgcttgttggttcttctggactctcgaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaagc
ttcctatggggttgggcctcagcccgtttctcatggctcagtttactagtgcaatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711632_S_P-E Feature FT:CDS KU711632_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 224E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcgtggccaaaattcga
ggtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggatggaaattgcacttgtattcccatcccatcgtcatgggctttcggaaaa
ttcctatgggactgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711633_S_P-E Feature FT:CDS KU711633_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 079N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaatttcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacaggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711634_S_P-E Feature FT:CDS KU711634_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatatgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711635_S_P-E Feature FT:CDS KU711635_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 109E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggactgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|KU711636_S_P-E Feature FT:CDS KU711636_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 139E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711637_S_P-E Feature FT:CDS KU711637_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 018N). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttaactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711638_S_P-E Feature FT:CDS KU711638_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 095E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaacgcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctatggacggaaattgcacttgtattcccatcccaccatcatgggctttcggaaaa
ttcctatgggagtgggccttagcccgtttctcctggctcaattcactagcgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711639_S_P-E Feature FT:CDS KU711639_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 159N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711640_S_P-E Feature FT:CDS KU711640_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 039N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711641_S_P-E Feature FT:CDS KU711641_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 061N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttctcttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711643_S_P-E Feature FT:CDS KU711643_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 029N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggttttttcttgttgataaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtgtg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggcacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711646_S_P-E Feature FT:CDS KU711646_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 073N). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttacttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgnttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711647_S_P-E Feature FT:CDS KU711647_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 051N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711648_S_P-E Feature FT:CDS KU711648_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 208E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711651_S_P-E Feature FT:CDS KU711651_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 054N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggccggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KU711652_S_P-E Feature FT:CDS KU711652_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 083N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711653_S_P-E Feature FT:CDS KU711653_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 086N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711654_S_P-E Feature FT:CDS KU711654_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 236E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcgcgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttctggtgtctttgggtatacatttaa
>gnl|hbvcds|KU711655_S_P-E Feature FT:CDS KU711655_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 071N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KU711656_S_P-E Feature FT:CDS KU711656_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 059N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcaaaacctgcacgactcttgctcaaggaacctctatgt
ttccctcctgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711657_S_P-E Feature FT:CDS KU711657_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 069N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcccaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaccctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711658_S_P-E Feature FT:CDS KU711658_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 027N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KU711659_S_P-E Feature FT:CDS KU711659_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 233E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgttttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaac
ttcctatgggtntgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcggtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711661_S_P-E Feature FT:CDS KU711661_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatggggttgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacagttaa
>gnl|hbvcds|KU711662_S_P-E Feature FT:CDS KU711662_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 068E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711663_S_P-E Feature FT:CDS KU711663_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 035N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU711664_S_P-E Feature FT:CDS KU711664_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 065N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|KU711665_S_P-E Feature FT:CDS KU711665_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 172E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736891_S_P-E Feature FT:CDS KU736891_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736892_S_P-E Feature FT:CDS KU736892_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736893_S_P-E Feature FT:CDS KU736893_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736894_S_P-E Feature FT:CDS KU736894_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KU736895_S_P-E Feature FT:CDS KU736895_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736896_S_P-E Feature FT:CDS KU736896_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736897_S_P-E Feature FT:CDS KU736897_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736898_S_P-E Feature FT:CDS KU736898_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736899_S_P-E Feature FT:CDS KU736899_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736900_S_P-E Feature FT:CDS KU736900_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736901_S_P-E Feature FT:CDS KU736901_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgccttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736902_S_P-E Feature FT:CDS KU736902_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736903_S_P-E Feature FT:CDS KU736903_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736904_S_P-E Feature FT:CDS KU736904_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736905_S_P-E Feature FT:CDS KU736905_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736906_S_P-E Feature FT:CDS KU736906_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736907_S_P-E Feature FT:CDS KU736907_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736908_S_P-E Feature FT:CDS KU736908_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736909_S_P-E Feature FT:CDS KU736909_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736910_S_P-E Feature FT:CDS KU736910_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736911_S_P-E Feature FT:CDS KU736911_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736912_S_P-E Feature FT:CDS KU736912_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736913_S_P-E Feature FT:CDS KU736913_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctyagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacaccttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KX186584_S_P-E Feature FT:CDS KX186584_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KX372216_S_P-E Feature FT:CDS KX372216_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate B130_2012_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctkcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgsaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggckaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KX372217_S_P-E Feature FT:CDS KX372217_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate B154_2013_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgycttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY271380_S_P-E Feature FT:CDS KY271380_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S33634). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY271381_S_P-E Feature FT:CDS KY271381_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S34678). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaagaccttcggacaaaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY271383_S_P-E Feature FT:CDS KY271383_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S34058). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaagaccttcggacaaaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY271386_S_P-E Feature FT:CDS KY271386_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S34803). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcgc
aatcccgcctggtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctaattggaagttggggatcattgccactggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcgaacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaac
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY493921_S_P-E Feature FT:CDS KY493921_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate D1761). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggraagcatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacyaytgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaatttccttgtgtctttgggtatacatctaa
>gnl|hbvcds|KY494018_S_P-E Feature FT:CDS KY494018_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K3620). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggagcctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY494038_S_P-E Feature FT:CDS KY494038_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate K719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggctaagtctrtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY494047_S_P-E Feature FT:CDS KY494047_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate N1205). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaamgcatcacatcargactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcggaagraaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttrttcagtggttcgccgsgctttc
ccccactgtctggctttcagttatatggatratgtggtattgrgggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY494096_S_P-E Feature FT:CDS KY494096_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S4105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggaytcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcytggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagtacgggaacctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgsaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcrgtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY494098_S_P-E Feature FT:CDS KY494098_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S4205). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY498770_S_P-E Feature FT:CDS KY498770_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate P94). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagytcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagyacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY697839_S_P-E Feature FT:CDS KY697839_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV_Mrs_E_034447_26-4-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|KY697849_S_P-E Feature FT:CDS KY697849_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV_Mrs_E_319385_9-8-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgaccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|L24071_S_P-E Feature FT:CDS L24071_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcagaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcctgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|L29017_S_P-E Feature FT:CDS L29017_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623842_S_P-E Feature FT:CDS LT623842_S_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
twccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623843_S_P-E Feature FT:CDS LT623843_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggaggggtttttctygttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctcmaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactyttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|LT623844_S_P-E Feature FT:CDS LT623844_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
ctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623845_S_P-E Feature FT:CDS LT623845_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgmtatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623846_S_P-E Feature FT:CDS LT623846_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623847_S_P-E Feature FT:CDS LT623847_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623848_S_P-E Feature FT:CDS LT623848_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623849_S_P-E Feature FT:CDS LT623849_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctttatac
ctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623850_S_P-E Feature FT:CDS LT623850_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623851_S_P-E Feature FT:CDS LT623851_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcwtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgctatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggcgccaggtctgtgcaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623852_S_P-E Feature FT:CDS LT623852_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaayttgtcctggctwtcgctkgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcaatttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgyacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|LT623853_S_P-E Feature FT:CDS LT623853_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggmaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623854_S_P-E Feature FT:CDS LT623854_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623855_S_P-E Feature FT:CDS LT623855_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtytgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttyttctggactatcaaggtatgttgcccgtttg
tccyctaattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623856_S_P-E Feature FT:CDS LT623856_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaaactgtacaacatcttgaatccctttatac
ttctgtttccaattttcttttgtctttgggcattcatttaa
>gnl|hbvcds|LT623857_S_P-E Feature FT:CDS LT623857_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623858_S_P-E Feature FT:CDS LT623858_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623859_S_P-E Feature FT:CDS LT623859_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcatggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcraccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttatac
ctctgttacyaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623860_S_P-E Feature FT:CDS LT623860_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623861_S_P-E Feature FT:CDS LT623861_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|LT623862_S_P-E Feature FT:CDS LT623862_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagytcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcraccaccagtacgggaccctgccgaacctgcacgactcttgctcwaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtwcaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|LT623863_S_P-E Feature FT:CDS LT623863_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623864_S_P-E Feature FT:CDS LT623864_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcam
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgwacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623865_S_P-E Feature FT:CDS LT623865_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623866_S_P-E Feature FT:CDS LT623866_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagartctagactcgtggtggacttctctcaattttctagggggagctcccgkgtgtcttggccaaaattcgc
agtcccmaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtwttgggggccamgtctgtacaacatcttgagtccctttatac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623867_S_P-E Feature FT:CDS LT623867_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctkgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623868_S_P-E Feature FT:CDS LT623868_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623869_S_P-E Feature FT:CDS LT623869_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcktgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623870_S_P-E Feature FT:CDS LT623870_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgytggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccycaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623871_S_P-E Feature FT:CDS LT623871_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacgcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623872_S_P-E Feature FT:CDS LT623872_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaamcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggcmaagtctgtacaacatcttgagtccctttatac
ctctgtwaccaattttcttttatctttgggtatacatctaa
>gnl|hbvcds|LT623873_S_P-E Feature FT:CDS LT623873_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aatacckcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgraaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623874_S_P-E Feature FT:CDS LT623874_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtckgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgaygtggtattgggggccaartctgtacaacatctkgagtccctttatac
ctctgttaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|LT623875_S_P-E Feature FT:CDS LT623875_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctccaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggamggaaattgcacttgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|LT623876_S_P-E Feature FT:CDS LT623876_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagytcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttyagttatatggatgatgtggtwttgggggccaartctgtacaacaycttgaggccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623877_S_P-E Feature FT:CDS LT623877_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaar
ttcctatgggrttgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623878_S_P-E Feature FT:CDS LT623878_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623879_S_P-E Feature FT:CDS LT623879_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623880_S_P-E Feature FT:CDS LT623880_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623881_S_P-E Feature FT:CDS LT623881_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623882_S_P-E Feature FT:CDS LT623882_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgyattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcggagtctagactcgtggtggacttctctcagttttctagggggagtgcccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaayctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaggtctgtacaacatcttgagtcmctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623883_S_P-E Feature FT:CDS LT623883_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccracctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623884_S_P-E Feature FT:CDS LT623884_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatctaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatat
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623885_S_P-E Feature FT:CDS LT623885_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623886_S_P-E Feature FT:CDS LT623886_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772354_S_P-E Feature FT:CDS MF772354_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772355_S_P-E Feature FT:CDS MF772355_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaaatctgtacaacatcttgaggccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772356_S_P-E Feature FT:CDS MF772356_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1834). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcccagaacccctgcgcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgc
agttcccaatctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatctccctcttcatcctgctgctatgcctcatcttctggttggttcttctggactatcaaagtatcttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
tnccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtaactaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|MF772357_S_P-E Feature FT:CDS MF772357_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agttcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgcgcaacatcttgagtccatttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772358_S_P-E Feature FT:CDS MF772358_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgttcaacatcttgaagccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772359_S_P-E Feature FT:CDS MF772359_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 335). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772360_S_P-E Feature FT:CDS MF772360_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772361_S_P-E Feature FT:CDS MF772361_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 801). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772362_S_P-E Feature FT:CDS MF772362_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MG383615_S_P-E Feature FT:CDS MG383615_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate NL13_2015_E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH165306_S_P-E Feature FT:CDS MH165306_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MANET_125). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH464855_S_P-E Feature FT:CDS MH464855_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA133). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH464856_S_P-E Feature FT:CDS MH464856_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA134). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctctttgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580614_S_P-E Feature FT:CDS MH580614_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580615_S_P-E Feature FT:CDS MH580615_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580616_S_P-E Feature FT:CDS MH580616_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580617_S_P-E Feature FT:CDS MH580617_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580618_S_P-E Feature FT:CDS MH580618_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580619_S_P-E Feature FT:CDS MH580619_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580620_S_P-E Feature FT:CDS MH580620_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580621_S_P-E Feature FT:CDS MH580621_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580622_S_P-E Feature FT:CDS MH580622_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580623_S_P-E Feature FT:CDS MH580623_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580624_S_P-E Feature FT:CDS MH580624_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580625_S_P-E Feature FT:CDS MH580625_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580626_S_P-E Feature FT:CDS MH580626_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580628_S_P-E Feature FT:CDS MH580628_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580629_S_P-E Feature FT:CDS MH580629_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580630_S_P-E Feature FT:CDS MH580630_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580631_S_P-E Feature FT:CDS MH580631_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580632_S_P-E Feature FT:CDS MH580632_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580633_S_P-E Feature FT:CDS MH580633_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 398). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580634_S_P-E Feature FT:CDS MH580634_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580635_S_P-E Feature FT:CDS MH580635_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580636_S_P-E Feature FT:CDS MH580636_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580637_S_P-E Feature FT:CDS MH580637_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580638_S_P-E Feature FT:CDS MH580638_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|MH580640_S_P-E Feature FT:CDS MH580640_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580641_S_P-E Feature FT:CDS MH580641_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580644_S_P-E Feature FT:CDS MH580644_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580645_S_P-E Feature FT:CDS MH580645_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580646_S_P-E Feature FT:CDS MH580646_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580647_S_P-E Feature FT:CDS MH580647_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580648_S_P-E Feature FT:CDS MH580648_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580649_S_P-E Feature FT:CDS MH580649_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580650_S_P-E Feature FT:CDS MH580650_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580651_S_P-E Feature FT:CDS MH580651_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580652_S_P-E Feature FT:CDS MH580652_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH918655_S_P-E Feature FT:CDS MH918655_S_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK321264_S_P-E Feature FT:CDS MK321264_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK720631_S_P-E Feature FT:CDS MK720631_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK720632_S_P-E Feature FT:CDS MK720632_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK840522_S_P-E Feature FT:CDS MK840522_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Homeless SDF025). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK840524_S_P-E Feature FT:CDS MK840524_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Homeless SDF097). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagaggaagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcatttt
atcatctccctctccatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgggaggccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK840527_S_P-E Feature FT:CDS MK840527_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Homeless SDF247). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattccaaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK840528_S_P-E Feature FT:CDS MK840528_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Homeless SDF356). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK840530_S_P-E Feature FT:CDS MK840530_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Homeless SDF427). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN420455_S_P-E Feature FT:CDS MN420455_S_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ttctgttaccaattttcttttatctttgggtataaatttaa
>gnl|hbvcds|MN507840_S_P-E Feature FT:CDS MN507840_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttttcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctctgtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507841_S_P-E Feature FT:CDS MN507841_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctttgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcccttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttccgttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507842_S_P-E Feature FT:CDS MN507842_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctaatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507843_S_P-E Feature FT:CDS MN507843_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507844_S_P-E Feature FT:CDS MN507844_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507845_S_P-E Feature FT:CDS MN507845_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507846_S_P-E Feature FT:CDS MN507846_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctacaacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaaaactgtacaccatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507847_S_P-E Feature FT:CDS MN507847_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507848_S_P-E Feature FT:CDS MN507848_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|X75657_S_P-E Feature FT:CDS X75657_S_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
© 1998-2020Legal notice