HBVdb

Dataset for nucleotide sequence PreS2 of genotype E

[Download (right click)] [Alignment] [Repertoires]

367 sequence(s)

>gnl|hbvcds|AB091255_PreS2_P-E Feature FT:CDS AB091255_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB091256_PreS2_P-E Feature FT:CDS AB091256_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctctctcatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccattacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106564_PreS2_C-E Feature FT:CDS AB106564_PreS2_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagcggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactctggctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctgcggacggaaattgcacttgtacccccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194947_PreS2_P-E Feature FT:CDS AB194947_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB194948_PreS2_P-E Feature FT:CDS AB194948_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcgtcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacaccttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201287_PreS2_P-E Feature FT:CDS AB201287_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201288_PreS2_P-E Feature FT:CDS AB201288_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201289_PreS2_P-E Feature FT:CDS AB201289_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB201290_PreS2_P-E Feature FT:CDS AB201290_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205129_PreS2_P-E Feature FT:CDS AB205129_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205189_PreS2_P-E Feature FT:CDS AB205189_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205190_PreS2_P-E Feature FT:CDS AB205190_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgtttcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcatcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatattgccc
gtttgtcctctacttccaggatcagcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttctgttgtctttgggcatacagttaa
>gnl|hbvcds|AB205191_PreS2_P-E Feature FT:CDS AB205191_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205192_PreS2_P-E Feature FT:CDS AB205192_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219533_PreS2_P-E Feature FT:CDS AB219533_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctc
tatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
caaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgaagccctt
tatacctctgttactaatttccttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274969_PreS2_P-E Feature FT:CDS AB274969_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274970_PreS2_P-E Feature FT:CDS AB274970_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccacaagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274971_PreS2_P-E Feature FT:CDS AB274971_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274973_PreS2_P-E Feature FT:CDS AB274973_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=840 residues).
atgcagtggaattccacaacattccaccaagttcagcaggatcacagagtaagaggcctgcctgctggtggctccagttc
cggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccatgcaccgaaca
tggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttta
tcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
cctctaattccaggatcatcaaccaccagtacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtt
tccctcatgttgctgttcaaaaccttcgggcggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaat
tcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcc
cccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatacc
tctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB274974_PreS2_P-E Feature FT:CDS AB274974_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctt
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274975_PreS2_P-E Feature FT:CDS AB274975_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatctcctcgaggattggggaccctgtac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274976_PreS2_P-E Feature FT:CDS AB274976_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274977_PreS2_P-E Feature FT:CDS AB274977_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274978_PreS2_P-E Feature FT:CDS AB274978_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaacaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274979_PreS2_P-E Feature FT:CDS AB274979_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274980_PreS2_P-E Feature FT:CDS AB274980_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaggctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtttctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274981_PreS2_P-E Feature FT:CDS AB274981_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274982_PreS2_P-E Feature FT:CDS AB274982_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|AB274984_PreS2_P-E Feature FT:CDS AB274984_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgcaattccctgctggtggctc
cagttccggaacagtgagccctgttccgactactgtctcacgcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaacaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB274985_PreS2_P-E Feature FT:CDS AB274985_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=840 residues).
attcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgcctgctggtggctccagttc
cggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccctgcaccgaaca
tggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
cctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtt
tccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaat
tcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcc
cccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacc
tctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915175_PreS2_P-E Feature FT:CDS AB915175_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaaacctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915176_PreS2_P-E Feature FT:CDS AB915176_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacgacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915177_PreS2_P-E Feature FT:CDS AB915177_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacgacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgaatactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tttgtttccctcatgttgctgctcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB915178_PreS2_P-E Feature FT:CDS AB915178_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaagacattccaccaagctctgcaggatmccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtgtccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494690_PreS2_P-E Feature FT:CDS AM494690_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494691_PreS2_P-E Feature FT:CDS AM494691_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttag
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagctatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494692_PreS2_P-E Feature FT:CDS AM494692_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494693_PreS2_P-E Feature FT:CDS AM494693_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494694_PreS2_P-E Feature FT:CDS AM494694_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggawtggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494695_PreS2_P-E Feature FT:CDS AM494695_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaatatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494696_PreS2_P-E Feature FT:CDS AM494696_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494697_PreS2_P-E Feature FT:CDS AM494697_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctctaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494699_PreS2_P-E Feature FT:CDS AM494699_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494700_PreS2_P-E Feature FT:CDS AM494700_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494701_PreS2_P-E Feature FT:CDS AM494701_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494702_PreS2_P-E Feature FT:CDS AM494702_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494703_PreS2_P-E Feature FT:CDS AM494703_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494704_PreS2_P-E Feature FT:CDS AM494704_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494705_PreS2_P-E Feature FT:CDS AM494705_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494706_PreS2_P-E Feature FT:CDS AM494706_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494707_PreS2_P-E Feature FT:CDS AM494707_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494708_PreS2_P-E Feature FT:CDS AM494708_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494709_PreS2_P-E Feature FT:CDS AM494709_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
tgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494710_PreS2_P-E Feature FT:CDS AM494710_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494711_PreS2_P-E Feature FT:CDS AM494711_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaaggggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattc
gcagtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttat
accgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494712_PreS2_P-E Feature FT:CDS AM494712_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
gtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaaggggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccga
acatggaaagcatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattc
gcagtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
actgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494713_PreS2_P-E Feature FT:CDS AM494713_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494714_PreS2_P-E Feature FT:CDS AM494714_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatactgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AM494715_PreS2_P-E Feature FT:CDS AM494715_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494717_PreS2_P-E Feature FT:CDS AM494717_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738144_PreS2_P-E Feature FT:CDS AY738144_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcggtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738145_PreS2_C-E Feature FT:CDS AY738145_PreS2_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738146_PreS2_P-E Feature FT:CDS AY738146_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738147_PreS2_P-E Feature FT:CDS AY738147_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttaccatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY739674_PreS2_P-E Feature FT:CDS AY739674_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY739675_PreS2_P-E Feature FT:CDS AY739675_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY935700_PreS2_P-E Feature FT:CDS AY935700_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060822_PreS2_P-E Feature FT:CDS DQ060822_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060823_PreS2_P-E Feature FT:CDS DQ060823_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060824_PreS2_P-E Feature FT:CDS DQ060824_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060825_PreS2_P-E Feature FT:CDS DQ060825_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060826_PreS2_P-E Feature FT:CDS DQ060826_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccctcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060827_PreS2_P-E Feature FT:CDS DQ060827_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgttatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060828_PreS2_P-E Feature FT:CDS DQ060828_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060829_PreS2_P-E Feature FT:CDS DQ060829_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ060830_PreS2_P-E Feature FT:CDS DQ060830_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaagatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU159673_PreS2_P-E Feature FT:CDS EU159673_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Irish-16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239217_PreS2_P-E Feature FT:CDS EU239217_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgagcatggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239218_PreS2_P-E Feature FT:CDS EU239218_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239219_PreS2_P-E Feature FT:CDS EU239219_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccgaaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239220_PreS2_P-E Feature FT:CDS EU239220_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=846 residues).
gttcagtggaattccacaacattccaccaaaatctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccgggacagtgaaccctgttccgactactgcctcactcacctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctcccatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtactcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttactaattttcttttggctttgggcatacatttaa
>gnl|hbvcds|EU239221_PreS2_P-E Feature FT:CDS EU239221_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggcaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcgc
gtttgtcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatctgttcggtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtaccacatcttgagtccctt
tatacctctgttaccaattttcttgtgtctttgggcatacatttaa
>gnl|hbvcds|EU239222_PreS2_P-E Feature FT:CDS EU239222_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcagaatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtatcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239223_PreS2_P-E Feature FT:CDS EU239223_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239224_PreS2_P-E Feature FT:CDS EU239224_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgtttaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU239226_PreS2_P-E Feature FT:CDS EU239226_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgccaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgctaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349226_PreS2_P-E Feature FT:CDS FJ349226_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctccaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349237_PreS2_P-E Feature FT:CDS FJ349237_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349238_PreS2_P-E Feature FT:CDS FJ349238_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349239_PreS2_P-E Feature FT:CDS FJ349239_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FN545821_PreS2_P-E Feature FT:CDS FN545821_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctc
twtgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tatacctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545822_PreS2_P-E Feature FT:CDS FN545822_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaattccacaacattccaccaagctctgcaggatcccagaataaaaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545823_PreS2_P-E Feature FT:CDS FN545823_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattctacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattgggggccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545841_PreS2_P-E Feature FT:CDS FN545841_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545842_PreS2_P-E Feature FT:CDS FN545842_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagcattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594748_PreS2_P-E Feature FT:CDS FN594748_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594749_PreS2_P-E Feature FT:CDS FN594749_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtactctaattccaggatcatcaaccaccagtactggcctcaccagagcctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594750_PreS2_P-E Feature FT:CDS FN594750_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594751_PreS2_P-E Feature FT:CDS FN594751_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggccttcattyttccgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggactcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttggcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttctggtgggatcttcaggactatcaaggtatgttgcgc
gagtgtcctcaaactccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594752_PreS2_P-E Feature FT:CDS FN594752_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594756_PreS2_P-E Feature FT:CDS FN594756_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaacaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594758_PreS2_P-E Feature FT:CDS FN594758_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594759_PreS2_P-E Feature FT:CDS FN594759_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtgcgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594760_PreS2_P-E Feature FT:CDS FN594760_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggggctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggaatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctsgctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594761_PreS2_P-E Feature FT:CDS FN594761_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
aaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctt
tataccgctgtwaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|FN594762_PreS2_P-E Feature FT:CDS FN594762_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctggatcccacagtaggaggcctgtcttctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttccctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594763_PreS2_P-E Feature FT:CDS FN594763_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594765_PreS2_P-E Feature FT:CDS FN594765_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gcctgtcctctaactccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtgtccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttmg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN594766_PreS2_P-E Feature FT:CDS FN594766_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttcggactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcaccacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gtattttcatcttcctcttcatcctgctgctatgcctcatcttcttgttggatcttctggactatcaaggtatcttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161755_PreS2_P-E Feature FT:CDS GQ161755_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161757_PreS2_P-E Feature FT:CDS GQ161757_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161758_PreS2_P-E Feature FT:CDS GQ161758_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161759_PreS2_P-E Feature FT:CDS GQ161759_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161760_PreS2_P-E Feature FT:CDS GQ161760_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctc
tatgtttcccttatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161761_PreS2_P-E Feature FT:CDS GQ161761_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161762_PreS2_P-E Feature FT:CDS GQ161762_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
agaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161763_PreS2_P-E Feature FT:CDS GQ161763_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161764_PreS2_P-E Feature FT:CDS GQ161764_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161765_PreS2_P-E Feature FT:CDS GQ161765_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161766_PreS2_P-E Feature FT:CDS GQ161766_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161768_PreS2_P-E Feature FT:CDS GQ161768_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccatt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161769_PreS2_P-E Feature FT:CDS GQ161769_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161770_PreS2_P-E Feature FT:CDS GQ161770_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161771_PreS2_P-E Feature FT:CDS GQ161771_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgga
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161772_PreS2_P-E Feature FT:CDS GQ161772_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161773_PreS2_P-E Feature FT:CDS GQ161773_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgctc
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161774_PreS2_P-E Feature FT:CDS GQ161774_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161775_PreS2_P-E Feature FT:CDS GQ161775_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaacctctgcagaatcccagagtaagaggtcaggattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttcyctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccakgatcatcaaccaccagtacgggaccctgcmgaacctgcacgactcytgctcaaggmamctc
tatgtttccctcatgttgytgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcg
saaaattcctatgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|GQ161776_PreS2_P-E Feature FT:CDS GQ161776_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161777_PreS2_P-E Feature FT:CDS GQ161777_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161778_PreS2_P-E Feature FT:CDS GQ161778_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161779_PreS2_P-E Feature FT:CDS GQ161779_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161780_PreS2_P-E Feature FT:CDS GQ161780_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161781_PreS2_P-E Feature FT:CDS GQ161781_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161782_PreS2_P-E Feature FT:CDS GQ161782_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161783_PreS2_P-E Feature FT:CDS GQ161783_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161784_PreS2_P-E Feature FT:CDS GQ161784_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161785_PreS2_P-E Feature FT:CDS GQ161785_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161786_PreS2_P-E Feature FT:CDS GQ161786_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161787_PreS2_P-E Feature FT:CDS GQ161787_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161789_PreS2_P-E Feature FT:CDS GQ161789_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161790_PreS2_P-E Feature FT:CDS GQ161790_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161791_PreS2_P-E Feature FT:CDS GQ161791_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161792_PreS2_P-E Feature FT:CDS GQ161792_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161793_PreS2_P-E Feature FT:CDS GQ161793_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161794_PreS2_P-E Feature FT:CDS GQ161794_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161797_PreS2_P-E Feature FT:CDS GQ161797_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaaatcagaggcccgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161798_PreS2_P-E Feature FT:CDS GQ161798_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
taaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161799_PreS2_P-E Feature FT:CDS GQ161799_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU732). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161800_PreS2_P-E Feature FT:CDS GQ161800_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161801_PreS2_P-E Feature FT:CDS GQ161801_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161802_PreS2_P-E Feature FT:CDS GQ161802_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgctc
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161803_PreS2_P-E Feature FT:CDS GQ161803_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaaccttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161804_PreS2_P-E Feature FT:CDS GQ161804_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161805_PreS2_P-E Feature FT:CDS GQ161805_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1410). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161807_PreS2_P-E Feature FT:CDS GQ161807_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161808_PreS2_P-E Feature FT:CDS GQ161808_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161810_PreS2_P-E Feature FT:CDS GQ161810_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161811_PreS2_P-E Feature FT:CDS GQ161811_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161812_PreS2_P-E Feature FT:CDS GQ161812_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161814_PreS2_P-E Feature FT:CDS GQ161814_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161815_PreS2_P-E Feature FT:CDS GQ161815_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161816_PreS2_P-E Feature FT:CDS GQ161816_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161817_PreS2_P-E Feature FT:CDS GQ161817_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgttggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161818_PreS2_P-E Feature FT:CDS GQ161818_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1520). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161819_PreS2_P-E Feature FT:CDS GQ161819_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161820_PreS2_P-E Feature FT:CDS GQ161820_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagmtctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcytggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggrctatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161821_PreS2_P-E Feature FT:CDS GQ161821_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1405). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161822_PreS2_P-E Feature FT:CDS GQ161822_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1086). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtctctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|GQ161823_PreS2_P-E Feature FT:CDS GQ161823_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggccctgctggtggctccagttccgg
aacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatgg
aaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaata
ccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct
ctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttcc
ctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcc
tatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttccccc
actgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctct
gtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161824_PreS2_P-E Feature FT:CDS GQ161824_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161825_PreS2_P-E Feature FT:CDS GQ161825_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcatcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcaaaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161827_PreS2_P-E Feature FT:CDS GQ161827_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161828_PreS2_P-E Feature FT:CDS GQ161828_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161829_PreS2_P-E Feature FT:CDS GQ161829_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ161830_PreS2_P-E Feature FT:CDS GQ161830_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1365). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161832_PreS2_P-E Feature FT:CDS GQ161832_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtatgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161833_PreS2_P-E Feature FT:CDS GQ161833_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|GQ161834_PreS2_P-E Feature FT:CDS GQ161834_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctcttcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ161835_PreS2_P-E Feature FT:CDS GQ161835_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ161836_PreS2_P-E Feature FT:CDS GQ161836_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgacgattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363565_PreS2_P-E Feature FT:CDS HM363565_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggaccccagagtaaggggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaattccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggccggaaattgcacttgtactcccatcccatcatcatgggctttcg
gaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363566_PreS2_P-E Feature FT:CDS HM363566_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
tgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363567_PreS2_P-E Feature FT:CDS HM363567_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctggattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363568_PreS2_P-E Feature FT:CDS HM363568_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363569_PreS2_P-E Feature FT:CDS HM363569_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363570_PreS2_P-E Feature FT:CDS HM363570_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363571_PreS2_P-E Feature FT:CDS HM363571_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363572_PreS2_P-E Feature FT:CDS HM363572_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagatgcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaacc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM363573_PreS2_P-E Feature FT:CDS HM363573_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaatattctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM363574_PreS2_P-E Feature FT:CDS HM363574_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363575_PreS2_P-E Feature FT:CDS HM363575_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363576_PreS2_P-E Feature FT:CDS HM363576_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363577_PreS2_P-E Feature FT:CDS HM363577_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctctagtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363578_PreS2_P-E Feature FT:CDS HM363578_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363579_PreS2_P-E Feature FT:CDS HM363579_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363580_PreS2_P-E Feature FT:CDS HM363580_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363581_PreS2_P-E Feature FT:CDS HM363581_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363582_PreS2_P-E Feature FT:CDS HM363582_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363583_PreS2_P-E Feature FT:CDS HM363583_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363584_PreS2_P-E Feature FT:CDS HM363584_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363585_PreS2_P-E Feature FT:CDS HM363585_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtcttttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363586_PreS2_P-E Feature FT:CDS HM363586_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaaattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363587_PreS2_P-E Feature FT:CDS HM363587_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaagattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363588_PreS2_P-E Feature FT:CDS HM363588_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363589_PreS2_P-E Feature FT:CDS HM363589_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363590_PreS2_P-E Feature FT:CDS HM363590_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363591_PreS2_P-E Feature FT:CDS HM363591_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363592_PreS2_P-E Feature FT:CDS HM363592_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctatattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacataaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363593_PreS2_P-E Feature FT:CDS HM363593_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatcttcctgctggtggctc
tcattccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363594_PreS2_P-E Feature FT:CDS HM363594_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363595_PreS2_P-E Feature FT:CDS HM363595_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
agaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgggtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HM363596_PreS2_P-E Feature FT:CDS HM363596_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagaaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363597_PreS2_P-E Feature FT:CDS HM363597_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363598_PreS2_P-E Feature FT:CDS HM363598_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcagcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaagaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363599_PreS2_P-E Feature FT:CDS HM363599_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccatgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggatcctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggctaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363600_PreS2_P-E Feature FT:CDS HM363600_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattcaacaacattccaccaaactctgcagaatcccagagtaacaggcctgtatcctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattcccggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363601_PreS2_P-E Feature FT:CDS HM363601_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM363602_PreS2_P-E Feature FT:CDS HM363602_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcacgcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgataaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363603_PreS2_P-E Feature FT:CDS HM363603_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtcttgggggcgaggtctgtacaccatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363604_PreS2_P-E Feature FT:CDS HM363604_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363605_PreS2_P-E Feature FT:CDS HM363605_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363606_PreS2_P-E Feature FT:CDS HM363606_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatccggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363607_PreS2_P-E Feature FT:CDS HM363607_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcatcactcatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363608_PreS2_P-E Feature FT:CDS HM363608_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccagaacatttcaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaacagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgattccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgctcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363609_PreS2_P-E Feature FT:CDS HM363609_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
tttgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM363610_PreS2_P-E Feature FT:CDS HM363610_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttcaggaaaagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363611_PreS2_P-E Feature FT:CDS HM363611_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700550_PreS2_P-E Feature FT:CDS HQ700550_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatcgaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700552_PreS2_P-E Feature FT:CDS HQ700552_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604166_PreS2_P-E Feature FT:CDS JN604166_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 477-9536-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaktggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604168_PreS2_P-E Feature FT:CDS JN604168_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 477-9824-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgyctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604235_PreS2_P-E Feature FT:CDS JN604235_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 478-2158-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcagamtcccacagtcagaggcctgtattttcctgctggtggctg
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ000008_PreS2_P-E Feature FT:CDS JQ000008_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggmcggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ000009_PreS2_P-E Feature FT:CDS JQ000009_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacttgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170741_PreS2_P-E Feature FT:CDS KF170741_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttcagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170742_PreS2_P-E Feature FT:CDS KF170742_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcckggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170750_PreS2_P-E Feature FT:CDS KF170750_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_004). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatctccctgctggtggctc
cagttccggaacagtgaaccctgttccgactaccgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tacacttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170751_PreS2_P-E Feature FT:CDS KF170751_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_022). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccatcaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
csaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tacgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170753_PreS2_P-E Feature FT:CDS KF170753_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_120). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170779_PreS2_P-E Feature FT:CDS KF170779_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_058). Partial genome (Contains: SHBs, HBSP). [Hepadnaviridae] (length=837 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagagtccctgctggtggctccagttccgg
aacagtgaaccctgttccgactgctgcctcactcgtctcgtcaatcttctcgaggattggggaccctgcaccgaacatgg
aaagcatcacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaaaaatcctcacaata
ccgcagagtctagacacgtggtggacttctctcaattttctagggggagctcccgggtgtcttggccaaaattcgcagtc
cccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcttgctaaaggaacctctatgtttcc
ctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggagaatacc
tatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttccccc
actgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatacctct
gttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170782_PreS2_P-E Feature FT:CDS KF170782_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_002). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatctccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctgtcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatacttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170783_PreS2_P-E Feature FT:CDS KF170783_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtgagcgccctgtatctccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170784_PreS2_P-E Feature FT:CDS KF170784_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_066). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KF170785_PreS2_P-E Feature FT:CDS KF170785_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_084). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccacaaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170786_PreS2_P-E Feature FT:CDS KF170786_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_086). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170787_PreS2_P-E Feature FT:CDS KF170787_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_110). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaattctacaacattccaccaagctctacaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttcaggaacagtgaaccctgttccgactactgcctcactcacctcgtcaatcttctcgacgattggggaccttgtac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggaggggttttccttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctacctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KF170788_PreS2_P-E Feature FT:CDS KF170788_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170789_PreS2_P-E Feature FT:CDS KF170789_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF170790_PreS2_P-E Feature FT:CDS KF170790_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctc
cagttccgaaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtccaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849713_PreS2_P-E Feature FT:CDS KF849713_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849714_PreS2_P-E Feature FT:CDS KF849714_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849715_PreS2_P-E Feature FT:CDS KF849715_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcctcaatcttctcgaggactggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849716_PreS2_P-E Feature FT:CDS KF849716_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttccgacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849717_PreS2_P-E Feature FT:CDS KF849717_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaaaatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849718_PreS2_P-E Feature FT:CDS KF849718_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849719_PreS2_P-E Feature FT:CDS KF849719_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849720_PreS2_P-E Feature FT:CDS KF849720_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagyggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttcttatggttcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849721_PreS2_P-E Feature FT:CDS KF849721_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849722_PreS2_P-E Feature FT:CDS KF849722_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849723_PreS2_P-E Feature FT:CDS KF849723_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatggggttgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtctctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849724_PreS2_P-E Feature FT:CDS KF849724_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849725_PreS2_P-E Feature FT:CDS KF849725_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttcaggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849726_PreS2_P-E Feature FT:CDS KF849726_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF849727_PreS2_P-E Feature FT:CDS KF849727_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF922438_PreS2_P-E Feature FT:CDS KF922438_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KF922439_PreS2_P-E Feature FT:CDS KF922439_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108610_PreS2_P-E Feature FT:CDS KM108610_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH020overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattcaacaacattccaccaaactctgcaagatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgacgattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KM108622_PreS2_P-E Feature FT:CDS KM108622_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH116overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctctatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccagtcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108623_PreS2_P-E Feature FT:CDS KM108623_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH152OBIE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaccatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108624_PreS2_P-E Feature FT:CDS KM108624_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH174OBIE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaagatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatattctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|KM108625_PreS2_P-E Feature FT:CDS KM108625_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH188overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM108626_PreS2_P-E Feature FT:CDS KM108626_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDH193overtE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggacagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggactctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaatcttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KM606738_PreS2_P-E Feature FT:CDS KM606738_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattttcctgctggtggctc
cagttccggaacagtgaaccatgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcgaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtgaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|KM606739_PreS2_P-E Feature FT:CDS KM606739_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcgtctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtaaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|KR139749_PreS2_P-E Feature FT:CDS KR139749_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA45). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
aaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KT192626_PreS2_P-E Feature FT:CDS KT192626_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KT749841_PreS2_P-E Feature FT:CDS KT749841_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgaatactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736891_PreS2_P-E Feature FT:CDS KU736891_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736892_PreS2_P-E Feature FT:CDS KU736892_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736893_PreS2_P-E Feature FT:CDS KU736893_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736894_PreS2_P-E Feature FT:CDS KU736894_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|KU736895_PreS2_P-E Feature FT:CDS KU736895_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736896_PreS2_P-E Feature FT:CDS KU736896_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736897_PreS2_P-E Feature FT:CDS KU736897_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736898_PreS2_P-E Feature FT:CDS KU736898_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736899_PreS2_P-E Feature FT:CDS KU736899_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736900_PreS2_P-E Feature FT:CDS KU736900_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736901_PreS2_P-E Feature FT:CDS KU736901_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgccttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736902_PreS2_P-E Feature FT:CDS KU736902_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736903_PreS2_P-E Feature FT:CDS KU736903_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736904_PreS2_P-E Feature FT:CDS KU736904_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736905_PreS2_P-E Feature FT:CDS KU736905_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736906_PreS2_P-E Feature FT:CDS KU736906_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736907_PreS2_P-E Feature FT:CDS KU736907_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736908_PreS2_P-E Feature FT:CDS KU736908_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736909_PreS2_P-E Feature FT:CDS KU736909_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736910_PreS2_P-E Feature FT:CDS KU736910_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736911_PreS2_P-E Feature FT:CDS KU736911_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736912_PreS2_P-E Feature FT:CDS KU736912_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KU736913_PreS2_P-E Feature FT:CDS KU736913_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatattcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctyagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacaccttgagtccctt
tatacttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KX186584_PreS2_P-E Feature FT:CDS KX186584_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KY498770_PreS2_P-E Feature FT:CDS KY498770_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate P94). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcwgtggaattccacaacattccaccaagctctgcaggatcccagartaaraggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagytcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagyacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623842_PreS2_P-E Feature FT:CDS LT623842_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccayaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgttwccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tatacctctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623843_PreS2_P-E Feature FT:CDS LT623843_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcartggaattccacaacattccgccaagctctgcaggatcccagagtaagarrcctgwatcytcytgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggaggggtttttctygttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctcmaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactyttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|LT623844_PreS2_P-E Feature FT:CDS LT623844_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctt
tatacctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623845_PreS2_P-E Feature FT:CDS LT623845_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcartggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattatcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgmtatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623846_PreS2_P-E Feature FT:CDS LT623846_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623847_PreS2_P-E Feature FT:CDS LT623847_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcartggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623848_PreS2_P-E Feature FT:CDS LT623848_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623849_PreS2_P-E Feature FT:CDS LT623849_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctt
tatacctctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623850_PreS2_P-E Feature FT:CDS LT623850_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagaataagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|LT623851_PreS2_P-E Feature FT:CDS LT623851_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcwtgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgctatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggcgccaggtctgtgcaacaccttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772354_PreS2_P-E Feature FT:CDS MF772354_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772355_PreS2_P-E Feature FT:CDS MF772355_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaamcctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgtac
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaaatctgtacaacatcttgaggccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772357_PreS2_P-E Feature FT:CDS MF772357_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcat
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagttcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgcgcaacatcttgagtccatt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772360_PreS2_P-E Feature FT:CDS MF772360_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MF772362_PreS2_P-E Feature FT:CDS MF772362_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH464855_PreS2_P-E Feature FT:CDS MH464855_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA133). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH464856_PreS2_P-E Feature FT:CDS MH464856_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA134). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctc
tttgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacttctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580614_PreS2_P-E Feature FT:CDS MH580614_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580615_PreS2_P-E Feature FT:CDS MH580615_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580616_PreS2_P-E Feature FT:CDS MH580616_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580617_PreS2_P-E Feature FT:CDS MH580617_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580618_PreS2_P-E Feature FT:CDS MH580618_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580619_PreS2_P-E Feature FT:CDS MH580619_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580620_PreS2_P-E Feature FT:CDS MH580620_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580621_PreS2_P-E Feature FT:CDS MH580621_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580622_PreS2_P-E Feature FT:CDS MH580622_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580623_PreS2_P-E Feature FT:CDS MH580623_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580624_PreS2_P-E Feature FT:CDS MH580624_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580625_PreS2_P-E Feature FT:CDS MH580625_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580628_PreS2_P-E Feature FT:CDS MH580628_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580629_PreS2_P-E Feature FT:CDS MH580629_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgacttctgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580630_PreS2_P-E Feature FT:CDS MH580630_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgcaagatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcgc
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580631_PreS2_P-E Feature FT:CDS MH580631_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580632_PreS2_P-E Feature FT:CDS MH580632_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580634_PreS2_P-E Feature FT:CDS MH580634_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
ggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580635_PreS2_P-E Feature FT:CDS MH580635_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
ggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580636_PreS2_P-E Feature FT:CDS MH580636_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
ggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580637_PreS2_P-E Feature FT:CDS MH580637_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580638_PreS2_P-E Feature FT:CDS MH580638_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|MH580640_PreS2_P-E Feature FT:CDS MH580640_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580641_PreS2_P-E Feature FT:CDS MH580641_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580644_PreS2_P-E Feature FT:CDS MH580644_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagcgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580645_PreS2_P-E Feature FT:CDS MH580645_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580646_PreS2_P-E Feature FT:CDS MH580646_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580647_PreS2_P-E Feature FT:CDS MH580647_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580648_PreS2_P-E Feature FT:CDS MH580648_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580649_PreS2_P-E Feature FT:CDS MH580649_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MH580650_PreS2_P-E Feature FT:CDS MH580650_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaattccccaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580651_PreS2_P-E Feature FT:CDS MH580651_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH580652_PreS2_P-E Feature FT:CDS MH580652_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MH918655_PreS2_P-E Feature FT:CDS MH918655_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK321264_PreS2_P-E Feature FT:CDS MK321264_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK720631_PreS2_P-E Feature FT:CDS MK720631_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MK720632_PreS2_P-E Feature FT:CDS MK720632_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507840_PreS2_P-E Feature FT:CDS MN507840_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttttcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctctgtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507841_PreS2_P-E Feature FT:CDS MN507841_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctttgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcccttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttccgttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507842_PreS2_P-E Feature FT:CDS MN507842_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctaatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507843_PreS2_P-E Feature FT:CDS MN507843_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507844_PreS2_P-E Feature FT:CDS MN507844_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggcattacaaaacattccaccaagatctgcagaatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507845_PreS2_P-E Feature FT:CDS MN507845_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcacctcgtcaaccttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507846_PreS2_P-E Feature FT:CDS MN507846_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctacaacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaaaactgtacaccatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507847_PreS2_P-E Feature FT:CDS MN507847_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaacaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcgtatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|MN507848_PreS2_P-E Feature FT:CDS MN507848_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattctacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|X75657_PreS2_P-E Feature FT:CDS X75657_PreS2_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
© 1998-2020Legal notice