HBVdb

Dataset for nucleotide sequence Genomes of genotype E

[Download (right click)] [Alignment] [Repertoires]

376 sequence(s)

>gnl|hbvnuc|AB201290_FT00000_P-E Feature FT:source AB201290_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatatggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggccgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgccctcaggcaagtcattctt
tgctggggagacctaatgactctagctacctgggtgggtgtaaatttggacgatccagcatcaagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtaatgc
ctgctagattttttcccatatctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacaccatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggaaagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatcca
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594758_FT00000_P-E Feature FT:source FN594758_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaatcaaagactgttttcgaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgagtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcccytcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatcatccagggaactagtagtcgg
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttg
tcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgcag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaatattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcmtggacggtccctctccaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF922438_FT00000_P-E Feature FT:source KF922438_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161756_FT00000_P-E Feature FT:source GQ161756_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Complete genome. [Hepadnaviridae] (length=3185 residues).
ttccacaacattccaccaagctctgccacctgctggtggctccagttccggaacagtgaaccctgttccgactactgcct
cactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggaccc
ctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttc
tctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctctt
gtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
atcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttcagttatatggatgat
gtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtat
acatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattggaagttgggggtcat
taccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccctgttaaccggcctattgattggaaagta
tgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgc
gtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttacc
ccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccat
cagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcag
gtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaatatacatcctttccatggctgctaggct
gtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcgg
ggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctc
cccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgc
ccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgaccttgaggcatact
tcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtcctaggaggctgtagg
cataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaa
gcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctactgtggagttact
ctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttag
aatctcctgagcattgttcaccgcaccacactgcattcaggcaagccattctttgctggggggacctaatgtctctagct
acctgggtgggtgtaaatttagaagatccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaa
gttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttg
gagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgtt
agacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
tcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctttactcttctactata
cctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattattaacaaatgtgaaca
atttgtaggtcctctaacagtaaatgaaaaacgaagactaaacttagttatgcctgctagattttttcccatctctacaa
aatatttgcccctagagaaaggtataaaatcttattacccagataatgtagttaatcattacttccaaaccagacactat
ttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttgtgggtcaccttattc
ttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgggggaagaatcattccaccaccaatcct
ctgggattttttcccgaccaccagttggatccagcattcagagcaaataccagaaatccagattgggaccacaatcccaa
caaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccggggctcactcccccacacggaggccttt
tggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcagtca
ggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161759_FT00000_P-E Feature FT:source GQ161759_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363571_FT00000_P-E Feature FT:source HM363571_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcccctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274984_FT00000_P-E Feature FT:source AB274984_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3188 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaggggcctgcaattccctgctggtggctccagttccggaa
cagtgagccctgttccgactactgtctcacgcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaacaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattcccttaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcacgttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcccctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctcctgcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctatccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatcaagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtttttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattatcaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacctagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacattatttgcataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttgggatggaaccctcaggctcaaggcatgcaaacaacattgccagcacggcgg
tcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ060822_FT00000_P-E Feature FT:source DQ060822_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtggctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaataccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849714_FT00000_P-E Feature FT:source KF849714_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctmtkgttcwkgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttacyctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AY738144_FT00000_P-E Feature FT:source AY738144_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggac
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcggtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacctcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctctcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcgaacaccag
aaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AY739675_FT00000_P-E Feature FT:source AY739675_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcctcttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctcgtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcgtatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaaggttaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggcataaaaccttactatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgcag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggaccgaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736895_FT00000_P-E Feature FT:source KU736895_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggcgcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctygtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattcta
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacttagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF922439_FT00000_P-E Feature FT:source KF922439_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623845_FT00000_P-E Feature FT:source LT623845_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattatcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgmtatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccgacctattgattggaaagtmtgtcaaagaattgtgggtcttttgggctttgctgccccctttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttayaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccwggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctrcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaawtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctagtc
atctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagacaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgargaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtacatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagccwaccccaatcactccacctttgagagacactcatcctcaggc
catgcartggaa
>gnl|hbvnuc|MN507845_FT00000_P-E Feature FT:source MN507845_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcacctcgtcaaccttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacttagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacagtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagatcactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcgggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161816_FT00000_P-E Feature FT:source GQ161816_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcrtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgyggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363606_FT00000_P-E Feature FT:source HM363606_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatccggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcactaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtcggtctattgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacttcatttccatggctgctaggctgtgctgccaactggctcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttatcatccgccggtccgtgtgcacttcgcttcacctctcc
acgtcgcatggagaccacagtgaacgctcaccaactctcgcccaaggtcggtcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggtcattgacccctataa
agaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtatcgggatgccttggaatctcctgagcattggtcacctcaccatactgcactcaggcacgtcattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttgtctcatgtttggaagagaaa
ccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaacgaaaaacgaagattaaacttagtcatgc
ctgctagattctttcccatctcaacgaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgggaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849713_FT00000_P-E Feature FT:source KF849713_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggrgaaytaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggmctaaagttcagggaattattgtggtttcacatttcttgtctcactttgggaagagaaa
ccgtcwtagactatttggtgtcttttggagtgtggattcccactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363583_FT00000_P-E Feature FT:source HM363583_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagtaagagatcttctagatactg
cctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctcttacggtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatattttcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcacataacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849725_FT00000_P-E Feature FT:source KF849725_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
gaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatactccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcctgtctt
tgctggggagatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttcttctatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttgtggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580616_FT00000_P-E Feature FT:source MH580616_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|FN594750_FT00000_P-E Feature FT:source FN594750_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggccaaaattcgcagtccc
caatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttaggaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaarcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgcaaactggatcctgcaagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctycacatactgcactcaggcaagccattctt
tgctggggggaccttatgtctctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactataccggtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaagacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgggggtcaccttattcttgggaacaagagctayatcatggggctttcttggaccgtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccwcctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161771_FT00000_P-E Feature FT:source GQ161771_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggactttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgcggaaccttcgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagccaaactcatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962193_FT00000_P-E Feature FT:source MZ962193_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS100_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcccgttgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggaaggaaacaccacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctgtactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccattcctcctggcatttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgcaagaagattcg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|DQ060830_FT00000_P-E Feature FT:source DQ060830_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaagatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagatactg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagagacttagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatccccaggc
catgcagtggaa
>gnl|hbvnuc|GQ161801_FT00000_P-E Feature FT:source GQ161801_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttrggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaagtaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacatgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggatggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736896_FT00000_P-E Feature FT:source KU736896_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggcgcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattcta
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacttagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB915178_FT00000_P-E Feature FT:source AB915178_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaagacattccaccaagctctgcaggatmccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtgtccct
catgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggccaattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtaytcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacgtctctttacgccgtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccatagaatctccggagcattgttcacctcaccacacggcactcaggcaagccattatt
tgctggggagacctaatgtctctagctacctgggtgggtgaaaatttgcaagatcaagcatccagggacctggtagtaag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcctttggagtgtggattcgcactcctcaagcttatagaccactaaatgcccctatctta
tcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggwcagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagccaaccccaatcactccacctttgagagatactccagtccaggc
catgcagtggaa
>gnl|hbvnuc|EU239219_FT00000_P-E Feature FT:source EU239219_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccgaaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcggccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaatcaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagacccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatttagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849728_FT00000_P-E Feature FT:source KF849728_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgcaggatcccaaagcaaaacctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggtccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattg
gtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgcttt
aatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaccaat
atatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactctyggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgta
ctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataaagaatttggagc
ttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctctgctttgt
ttcgggatgccttagaatcacctgagcattgttcacctcaccatactgcactcaggcaagccattctttgctggggtgat
gtaatgaatctagcgacatgggtgggtgtaaatttggaagatccggcatccagggacctagtagtgggttatgtcaatac
taatatgggcctaaagttccggcaattattgtggtttcacctttcttgtctcacttttggaagagaaaccgtcatagagt
atttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaattttacggggctt
tattcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgcctgctagatttt
ttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagttaatcattacttc
caaaccagacactatttacataccctatggaaggcgggcatcttatataagagagaaactacccgtagcgcctcattttg
tgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccagaaatccagattg
ggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctgggttcactcccc
cacacggaggccttttggggtggagccctcaggctcaaggcatcctaacaacattgccagcagatccgcctcctccctcc
accaatcggcagtcaggaaggcagcccaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB205189_FT00000_P-E Feature FT:source AB205189_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtccttaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgttgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtttcggggtcgcttggggatctttcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccagggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccccaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaaggactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactctacctgtctttaatcctaactggaaaactccctcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcctatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacaagtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363580_FT00000_P-E Feature FT:source HM363580_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaattttatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaatcaaagactgttttagaaaactccca
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaagctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH918655_FT00000_P-E Feature FT:source MH918655_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggcagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatcaagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctactaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggagactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161829_FT00000_P-E Feature FT:source GQ161829_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
rtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161833_FT00000_P-E Feature FT:source GQ161833_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363596_FT00000_P-E Feature FT:source HM363596_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagaaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccct
gttaaccggcctatagattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctgtcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgggctgccaactggatcctgggagggacgtcctttgtctacgtcccgtcagcg
ctgaatcgtgcggacgacccgtctcggggtcgcttgggggtctctcgtccccttctccgtctggcgttccggccgaccac
ggggcgcacctctctttacccgggctccccgtctggggcttctcatctggcggaccgggtggacttcgcttcacctctgg
acgtcacatggagaccacggtgaacgcgcagcaaatcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagctcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcgtcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FJ349240_FT00000_P-E Feature FT:source FJ349240_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccaccacattccaccaagctctgcaggatcccaaagtaactcctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggttatgtaattg
gaagttgggggtcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgcttt
aatgcctctgtatgcgtgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagcaggtctggagcaacacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccaaccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagactaggttaatgatctttgta
ctaggaggctgtaggcataaattggtgtgcgcaccaccaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataaagaatttggagc
tactgtggagttactctcttttttgcctcctgacttctttccttcagtaagagatcttctagataccgccaaagctctgt
ttcgggatgccttggaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgctggggggac
ctaatgactctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcagttatgtcaatat
taatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcgtagagt
atttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgagattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagatttt
ttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcaagataatgtagttaatcattacttc
caaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccagaaatccagattg
ggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtgggagcattcgggccggggttcactcccc
cacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161828_FT00000_P-E Feature FT:source GQ161828_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcactttctcaccgacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctatgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagaaaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HQ700550_FT00000_P-E Feature FT:source HQ700550_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatcgaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagatcacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcgtctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagagacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacatcattaacaaatgtgaacaatttgtaggacctctaacagtaaatcaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggagggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatccaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagacactcatccccaggc
catgcagtggaa
>gnl|hbvnuc|AM494693_FT00000_P-E Feature FT:source AM494693_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaactccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcctgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161778_FT00000_P-E Feature FT:source GQ161778_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccca
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcacggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgctcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaatcattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN507844_FT00000_P-E Feature FT:source MN507844_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttacaaaacattccaccaagatctgcagaatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaataataatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagactaaacttagtcatgc
ctgctagattttttcccatcgctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgcaaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagacacccatcctcaggc
catgcagtggca
>gnl|hbvnuc|KU736892_FT00000_P-E Feature FT:source KU736892_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatattgcccaaggtcttayataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatagacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagtatcaagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaccaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatattggcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736893_FT00000_P-E Feature FT:source KU736893_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacggataattctgtcgttctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagttgtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacraag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattgacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgacaacattgccagcaaatccg
cctcctgcttccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|X75657_FT00000_P-E Feature FT:source X75657_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggctattcccttaatttcatgg
gttatgtaattggaagttggggctcattaccacaggaacacatcatacaaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccctttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggcattcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggaccgataattctgtcgttctctcccggaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaactgtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatatttccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849722_FT00000_P-E Feature FT:source KF849722_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatataattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatacggcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736900_FT00000_P-E Feature FT:source KU736900_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactcccc
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacactgcactcaggcaagccattctg
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagttgtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgcgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttccccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaaagagaaactacacatag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN507841_FT00000_P-E Feature FT:source MN507841_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctttgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcccttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttccgttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagatcgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggcctcataaggtgggaaat
tttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
caatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161804_FT00000_P-E Feature FT:source GQ161804_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctgtactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccccagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736906_FT00000_P-E Feature FT:source KU736906_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagattgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcgrcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580628_FT00000_P-E Feature FT:source MH580628_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacagtgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494713_FT00000_P-E Feature FT:source AM494713_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagattgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggcctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
acacgtcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaatcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagagactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcattcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363611_FT00000_P-E Feature FT:source HM363611_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccct
gttaatcggcctattgattggaaagtgtgtcaaagaattgtgggtctattgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaaactttgtggctcctctgccgatccatactgcggaact
cctggctgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccctctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtggcttcacatctgccggtccgtggggacttcccttcacctctgc
acgtctcatggcgcccaccgtgaacgcccaccaaagcttggccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgagggatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttccgtggagttactctcttttttgcctactgacttctatccttccgtaagagatcttctagataccg
cctcagctctgtttagggatgccttggaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaggtccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttgcctcacttttgggagagaag
tcgtagtagagtttttggtgtcttttggggtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctggaagaagaactccctcgcctcgcagacgaag
acctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttactcttctactatacctgtctttaatcctaactggcaaactccatcttttcctgatattcatttgca
ccaggacattgttaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaatctagtcatgc
ctgctagattttttcccaactctacgaaatatttacccctagacaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctttggaaggcgggcatcttatataagagggaaactacacgtag
cgcttcattctttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacagtccctctcgaatgg
gggaagaatcagtctaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagcccgcaggctcaaggcacgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccgatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962195_FT00000_P-E Feature FT:source MZ962195_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS089_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggccccaattccggaa
caaggaaccctgttccgactactgccttactcctctcctcaatcttcccgaggattgggggcttggcaccggacatggaa
agcctcccatcaggattccttggacccctgcccgttttacaggcggggtttttcctgttgacaaaaatcctcccaatacc
gaagagtccagacttgtggtggacttctcccaattttctagggggagctccagtgtgtcttggcccaaattcgcagtccc
caaaccccaatcactcaccaacctctcttccctcaatttggcctgcctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274979_FT00000_P-E Feature FT:source AB274979_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtttgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcacacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcgactgtgcagttactctcgtttttgcctggtgaattctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcatcacacggcactcaggcaagccattctt
tgctggggggaactaatgacactagctacttgggtgggtgtaaatttggaagatccatcatccagggacctagtagtcag
ttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagacg
tcgttctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttgcggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagatcatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagagaaactacacatag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctctggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagtcactcatcctcaggc
cattcagtggaa
>gnl|hbvnuc|FN594766_FT00000_P-E Feature FT:source FN594766_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttcggactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcaccacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtattttcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggatcttctggactatcaaggtatcttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gtaatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctcggcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccktctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatagggatgccttgaaatctcctgagcattgttcmcctcaccacactgcactcaggcaagcaattctt
tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatcaagcatccagggacttagtagtcgg
ttatgtcaatactactgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagata
tcgtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcatttggggggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggatcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagycctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactcctcctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849726_FT00000_P-E Feature FT:source KF849726_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctcaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcggaactgataattctgtcgttctctcccggaaat
acacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctac
acgtcgcatggagaccaccgtgaccgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagtaagagaccttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaggatccatcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcatcacttccggagtgtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB205188_FT00000_P-E Feature FT:source AB205188_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Complete genome. [Hepadnaviridae] (length=3197 residues).
ttccacaacatttcaccaagctctgcaggatcccagagtacctgctggtggctccagttccggaacagtgaaccctgttc
cgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaaacatcacatcagga
ttcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactc
gtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatc
aaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgtttccctcatgttgctgttcaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctca
gcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttcagt
tatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttctttt
gtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattggaa
gttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccctgttaaccggcctatt
gattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgctttaat
gcctcggtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacc
tgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttg
gccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttt
tgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttccat
ggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggac
gacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaac
caccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacaggtctttgtacta
ggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
cctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctac
tgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatc
gagatgccttggaatctcctgagcattgttcacctcaccatactgcactcaggcaggccattctttgctggggggaccta
atgaatctaggtacctgggtgggtggaaatttggaagatccagcatccagggacctagtagtcagttatgtcaatactaa
tatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagataccgtcgtagagtatt
tggtgtcttttggagtgtggattcgcactcctccagcttatagaccacccaatgcccctatcgtatcaacacttcccgag
aatactgttgttagacgaagaagcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctttac
tcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattattaa
caaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgcctgctagattttttc
ccaattctacaaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagttaatcattacttccaa
accagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtagcgcctcattttgtgg
gtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcattcc
acctccaatccgctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattggga
ccacaatcccaacaaagaccactggacagatgccaacaaggtaggagtgggagcattcgggccggggttcactcccccac
acggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctccacc
aagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|GQ161808_FT00000_P-E Feature FT:source GQ161808_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcacggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaatcattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849718_FT00000_P-E Feature FT:source KF849718_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagatttgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataataggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atgtcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttcygacttctttccttcagtaagagatcttytagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagycattctt
tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggcatmttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacamgagctacatcatggggctttcttggrcggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN545821_FT00000_P-E Feature FT:source FN545821_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccaaagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctwtgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatacctctgt
tactaattttcttttgtctttgggtatacatttaaataccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcaraatgaaaatcaaagactgttttagaaaactccct
attaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcagrtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgaaaatttacaagatcaagcatccagggacctagtagtcag
ttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcytagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagacctccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctactaagtatttacccctagacaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttgggttggagccctcaggctcagggcatgctgaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161776_FT00000_P-E Feature FT:source GQ161776_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcactttctcaccgacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctatgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagaaaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962190_FT00000_P-E Feature FT:source MZ962190_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS012_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcttccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacgtcttgtccttctgtttgtcgtggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaatcaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctgcgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttggggatcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggaaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagggatcttctagataccg
cctcagctttgtatggggatgccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacttcaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494707_FT00000_P-E Feature FT:source AM494707_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtattgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcccaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161774_FT00000_P-E Feature FT:source GQ161774_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattgccgcaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttccttttctcgccaacttacaaggcctttc
tgtgtaaccaatacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggaccttgtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattttttcctgacattcatttgca
ccaggacattattaacagatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaagggataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580615_FT00000_P-E Feature FT:source MH580615_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|GQ161826_FT00000_P-E Feature FT:source GQ161826_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Complete genome. [Hepadnaviridae] (length=3194 residues).
ttccacaacattccaccaagctctgcaggatcccattcctgctggtggctccagttccggaacagtgaaccctgttccga
ctactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattc
ctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtg
gtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcac
caacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctg
ctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaac
caccagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaac
cttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcc
cgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttcagttat
atggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtc
tttgggtatacatttaaatcccaacaaaacaagaagatggggatattccctacacttcatgggttatgtaattggaagtt
gggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccctgttaaccggcctattgat
tggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgggtatcckgctttaatgcc
tctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtgtaaacaatacctga
acctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggct
ataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgc
tcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaatatacatcatttccatggc
tgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgac
ccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctctcttta
cgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccac
cgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgaccttg
aggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtactagga
ggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcct
actgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctactgt
ggagttactctcgtttttgccttctgacttctttccttcagtaaaagatcttctatataccgcctcagctctgtatcggg
atgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctttgctggggggacttaatg
aatctagcgacctgggtgggtgtaaatttggaagatccagcatccagggacctggtagtcagttatgtcaatactaatat
gggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagtatttgg
tgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatcttatcaacacttccggagaat
actgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcg
cagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctttactct
tctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattattaacaa
atgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacctagtcatgcctgctagattttttccca
tctctacaaaatatttgcccctcgagaaaggtataaaaccttattatccagataatgtagttaatcattacttccaaacc
agacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttgtgggtc
accttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcattccacc
accaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattgggacca
caatcccaacaaagaccactggatggaagccaacaaggtaggagtgggagcattcgggccggggttcactcccccacacg
gaggccttttggggtggaaccctcaggctcaaggcatgctaaaaacattgccagtagatccacctcctgcctccaccaag
cggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT192626_FT00000_P-E Feature FT:source KT192626_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagacaattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736891_FT00000_P-E Feature FT:source KU736891_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcmtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatagacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacckcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatcaagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaccaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatattggcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274975_FT00000_P-E Feature FT:source AB274975_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatctcctcgaggattggggaccctgtaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctttcccggaaat
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctcctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgttgacttctatccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttacaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacgtaatgaatctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtctcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctaaatcgccgagtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagggaaactacgcgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcaaagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggtgcattcgggccgg
ggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaacaacattgccaacagatccg
cctactgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|EU239224_FT00000_P-E Feature FT:source EU239224_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgtttaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctgttgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgatccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactcgctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagtaagggatcttctagataccg
cctcagcactgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacggagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
aactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgcgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaacactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849727_FT00000_P-E Feature FT:source KF849727_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacgtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgacgctagctacctgggtgggggtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttgcataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggcagaatcattccaccaccaatcctctg
ggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattgggaccacaatcccaacaa
agaccactggacagaagccaacaaggtaggagtgggagcatttgggccggggttcactcccccacacggaggccttttgg
ggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccgcctcctgcctccaccaatcggcagtcagga
aggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545842_FT00000_P-E Feature FT:source FN545842_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaattaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccggctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccrtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcractttttcacctctgcctartc
atctcttgttcatgtcctayttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtsgagttactctcatttttgcctggtgacttctttccttcagtaagagatcttctagataccg
cccaagctctgtttcgggatgctttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
tgctggggggacctaatgtctctagctacctgggtgggtacaaatttggatgatccagcatccagggaccwagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtcttacttttggaagagaaa
tcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catacagtggaa
>gnl|hbvnuc|HM363608_FT00000_P-E Feature FT:source HM363608_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccagaacatttcaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaacagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgattccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgctcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacataagatcaaaaatcaaagactgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaagggcttacataagaggactcttggactctctgcaa
tgtcaacgacggaccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtgcatgtcatactgttcaagccttcaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcaccccaccacactgcactcaggcaagccattctt
tgctggggggatgtaatgaatctagctacctgggtgggtgcaaatttggaagatcccacatccagggaccttgtagtcag
ttatgtcaatactcatatgggcttaaagaccaggcaattattgtggtttcacatttcttgtctcacttttggaagagata
tcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttactatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccg
cctcctgcctccatcaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MW679682_FT00000_P-E Feature FT:source MW679682_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FE032_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttttctgctggtggctccagttccggaa
cagtgaaccctggtccgactactgccttactcatctcgtcaatcttctcgagggttgggggccctgccccgaacatggaa
aggatcacatcaggattcctagggcccccgctcgtgttacaggcggggtttttcttggttacaaaaatccttacaattcc
gcagagtccagactcgtggtggacttctttcaattttctagggggaggttccgtgtgttttggccaaaatttgcaggccc
caacccccaatcactcaccaacctcttgtcctccgatttggcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatacctctgt
kaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagactgaaaatcaaagactgttttagaaacctccct
gttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcccctcccagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccaccttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcacttccccccacggaggccttttgggggggagccctcaggcccaaggcatgctaaaaaaattgcaagaagatccg
cctctggcttccacaattgggaattcaggaaggccggcttacccaatcaccccaactttgagagacactcattctcaggc
catgcagtggaa
>gnl|hbvnuc|AB194947_FT00000_P-E Feature FT:source AB194947_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctacctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctaggttttttcccctctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccgatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161832_FT00000_P-E Feature FT:source GQ161832_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtatgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcacgttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcactttcggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattatcaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363582_FT00000_P-E Feature FT:source HM363582_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattcccacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttgcccataggccatcagcgcatgcctggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtagttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagtaagagatcttctagatactg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|DQ060829_FT00000_P-E Feature FT:source DQ060829_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaggaacacatcatacaaaaaatcaaagactgttttagaaaactgcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccttcagcgcatgcgtggaacctttgtggctcctctgccaatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccataccgcactcaggcaagccattctt
tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcttaaagttcaggcaattactgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaatggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161765_FT00000_P-E Feature FT:source GQ161765_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccttacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatccaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggactggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736910_FT00000_P-E Feature FT:source KU736910_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagattgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtacgcgtgtactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacttagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttctkgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB091255_FT00000_P-E Feature FT:source AB091255_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgatccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagcctgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagactaaacttagttatgc
ctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274970_FT00000_P-E Feature FT:source AB274970_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggttattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtattcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggacaattctgtcgtcctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgacattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatactaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB915180_FT00000_P-E Feature FT:source AB915180_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Complete genome. [Hepadnaviridae] (length=3194 residues).
ttccacgacattccaccaagctctgcaggatcccactcctgctggtggctccagttccggaacagtgaaccctgttccga
ctactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattc
ctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtg
gtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtcactcac
caacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctg
ctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaac
caccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaac
cttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcc
cgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccactgtctggctttcagttat
atggatgatgtggtattgggggcgaggtctgtacaccatcttgagtccctttataccgctgttaccaattttcttttgtc
tttgggtatacatttaaatcctaacaaaacaaaacgatggggatattccctcaatttcatgggttatgtcattggaagtt
gggggtcattgccacaagaacacatcagaatgaaaatcaaagaatgttttagaaaacttcctgttaaccggcctattgat
tggaaagtctgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggttatcctgctttgatgcc
tctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctga
acctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggcc
ataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatattgcggaactcctagccgcttgttttgc
tcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcctttccatggc
tgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcccgtcagcgctgaatccagcggacgac
ccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctcttta
cgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccac
cgtgagcgcccaccaaatattgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccgaccttg
aggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtactagga
ggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcacctcttgttcatgtcct
actgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataaagaatttggagctactgt
ggagttaatctcgtttttgcctagtgacttctttccttckgtacgagatctactagataccgcctcagctctgtttcggg
atgccttagaatcttctgagcattgctcacctcaccacactgcactcaggcaagccgttctttgctggggggatataatg
aatatagctacctgggtgggtgcaaatttggaagatccagcatccagggaactagtagtaagttatgtcaatactaacat
gggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagtatttgg
tgtcttttggagtgtggattcgcactcctccagcgtacagaccaccaaatgcccctatcttatcaacacttccggagact
actgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcg
caaaagatctcaatctcgaggtgcccaatgttagtattccttggacgcacaaggtgggaaattttacgggactttactct
tctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattattaacaa
atgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagattttttccca
tctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagttaatcattacttccaaacc
agacactatttacataccctttggaaggcgggcatcttatataagagagaaactacacgtagcgcctcattttttgggtc
actttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcagtccacc
accaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattgggacca
caatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctgggctcactcccccacacg
gaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctccaccaat
cggcagtcaggaaggcagcctactccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161755_FT00000_P-E Feature FT:source GQ161755_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagtttcggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttggggatcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggaaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagggatcttctagataccg
cctcagctttgtatggggatgccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcctccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgagaaactacatgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactccccctcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363603_FT00000_P-E Feature FT:source HM363603_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
accatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtcttgggggcgaggtctgtacaccatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagagtgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgactggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgactcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagacaattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctcc
acgtcgcatggaaaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagccttcaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cccaagctctgtatcgggatgccttagaatcttctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgtccctaggtacctgggtggggggaaatttggaagatcaagcgtccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaacgggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgccaaaaacattgccatcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962196_FT00000_P-E Feature FT:source MZ962196_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS168_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaagttcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttggcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctctacatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcgaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcactgctattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggaaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagggatcttctagataccg
cctcagctttgtatggggatgccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgtctctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttccagatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgagaaactacatgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactccccctcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274981_FT00000_P-E Feature FT:source AB274981_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacccttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
atttcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
catagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctcggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctactccgtctgccgttccacccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtcgagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtttcgggatgccttagaatctccagagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccactaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
tttgcggggctttactcttctactatacctgtctttaatcctaattggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctactaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatattatataagagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgagtgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaacccaacgaggtaggagtgagtgcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcacgctaaaaacattgccaacagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FJ349226_FT00000_P-E Feature FT:source FJ349226_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctccaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggctcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatttctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactgttcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaacttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgccagattttttcccatctctactaaatatcttcccttagataaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacattatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962189_FT00000_P-E Feature FT:source MZ962189_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS018_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggatcctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccagggtcttgtcctccaatttggcctggctacccctggatgggccttcggggttttctggtc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcacggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
ttctcgggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagactaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacttcaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161791_FT00000_P-E Feature FT:source GQ161791_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgccttgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363593_FT00000_P-E Feature FT:source HM363593_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatcttcctgctggtggctctcattccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcgtcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccctttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatgtatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactcttggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatcctgagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN967528_FT00000_P-E Feature FT:source MN967528_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR_78). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcatcgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatactacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgtttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274980_FT00000_P-E Feature FT:source AB274980_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaggctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtttctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggatccttaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactcccg
gttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcacagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctwtccgtcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcatcatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgaaaatttggaagatccagcatccagggacctcgtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctaatattcatttgca
ccaggacattgttaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtaatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccgccaatcggcagtcaggcaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363577_FT00000_P-E Feature FT:source HM363577_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctctagtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtatcaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HQ700551_FT00000_P-E Feature FT:source HQ700551_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Complete genome. [Hepadnaviridae] (length=3197 residues).
ttccacaacattccaccaagctctgcaggatcccagagttcctgctggtggctccagttccggaacagtgaaccctgttc
cgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactc
gtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatc
aaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctca
gcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttccctcactgtctggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttctttt
gtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattggaa
gttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccctgttaatcggcctatt
gattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgctttaat
gcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacc
tgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttg
gccatcggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttt
tgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttccat
ggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggac
gacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtgtttgtacta
ggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
cctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctac
tgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatc
gggatgccttggaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctttgctggggggaccta
atgactctagctacctgggtgggtgttaatttggaagatccagcatccagagacctagtagttagttatgtcaatactaa
tgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagaatatt
tggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatcttatcaacacttccggag
aatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctttac
tcttctactatacctgtctttaatcctaactggaaaactccaacttttcctgatattcatttgcaccaggacattattaa
caaatgtgaacaatttgtaggtcctctaacagtaaatgaaaagcgaagattaaacttagtcatgcctgctagattttttc
ccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagttaatcattacttccaa
accagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttgtgg
gtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcattcc
accaccaatcctctgggattttttcccgaccaccagttggatccagctttcagagcaaacaccagaaatccagattggga
ccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggttcactcccccac
acggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatcctcctcctgcctccacc
aatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161769_FT00000_P-E Feature FT:source GQ161769_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccttacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatccaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcttttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctcaacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363600_FT00000_P-E Feature FT:source HM363600_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttcaacaacattccaccaaactctgcagaatcccagagtaacaggcctgtatcctcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattcccggatcatcaaccaccagtacgggaccctgccgaacatgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccctttacacaatgtgg
atatcctgctttaatgcctatatatgcgtgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgttgttctctcccggaaat
atacatcatttccatgggtgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtccccttctccgtctgccgttccggccgtccac
ggggcgcacctctctttacccggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagtgcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagtaagagatcttctagatactg
cctcagctctgtttcgggatgccttagaaggtcctgagcattgtacacctcaccatactgcactcaggcaagccattatt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagacgatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagata
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccacgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatatctacgaaatatttccccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattctttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcacccccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctacaccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623843_FT00000_P-E Feature FT:source LT623843_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccgccaagctctgcaggatcccagagtaagarrcctgwatcytcytgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtattacaggaggggtttttctygttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctcmaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactyttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctacacttcatgg
gttatataattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgtttgggggtctmtcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
ccagagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgtycctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgcctcacttttggaagagaaa
ccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccakgacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctttggaaggsgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttathcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccwccaatccgctgggaktttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaratccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggt
catgcartggaa
>gnl|hbvnuc|EU239226_FT00000_P-E Feature FT:source EU239226_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgccaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgc
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacattatttacataccctatggaaggcgggcatcttatataaaagagaaactacgcgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggtgcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccatctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736894_FT00000_P-E Feature FT:source KU736894_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgtcctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttgggggtctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactaaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN967526_FT00000_P-E Feature FT:source MN967526_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR_39). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacttctgt
taccaattttcttttatctttgggtataaatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtcttcgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtattgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacttaatgagtctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttaatcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaaaaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacagtcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363595_FT00000_P-E Feature FT:source HM363595_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacagaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgggtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaacaaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacctcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgagaggagttgggggaggagagtagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagatgtcccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagtaagagatcttatagatactg
cctcagctttgtatcgggatgccttcgaatctcctgagcattgttcaccttaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaattggaaaactccttcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacaaaatatttacccctagagaaaggtataaaaccttattatccagatgaggtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtgggagcattcgggccgg
gattcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363607_FT00000_P-E Feature FT:source HM363607_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcatcactcatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtacgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggcaatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgttgttctctcccggaaat
atacatcatttccatgggtgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtccccttctccgtctgccgttccggccgtccac
ggggcgcacctctctttacccggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagtgcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgagaggagttgggggaggagagtagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctagtgttcaagcatccaagatgtcccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatattatagatactg
cctcaggtttgtttcgggatgccttcgaatctcttgagcattgttcaccttaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacttctcttgtatcacttttggaagagaca
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgccg
atctcaatcgccgcgtcgcagaagatctcaatctccatcttcccactgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catacagtggaa
>gnl|hbvnuc|KU736912_FT00000_P-E Feature FT:source KU736912_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagattgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggatataatgactatakctacctgggtkggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594749_FT00000_P-E Feature FT:source FN594749_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattctcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtactct
aattccaggatcatcaaccaccagtactggcctcaccagagcctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctcagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgyggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctggaa
tgtcaacgaccgtccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcaactctgtatcgggatgccttagaatctcctccgcattgttcaccctcacatactgcwctcaggcaagccgttctt
tgctggggggatgtaatgaatctagctaccggggtgggtacaaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtctcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatttctacgaaatatttrcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgggggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgaagtggaa
>gnl|hbvnuc|KF849715_FT00000_P-E Feature FT:source KF849715_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcctcaatcttctcgaggactggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaagctccct
gttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctctatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtygtcctctcccggaaat
acacatcatttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattcgatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgttactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtaaaaaaccttattatccagataatgtaktt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagagaaactacmcgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggcckg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623846_FT00000_P-E Feature FT:source LT623846_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccttaaattttatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcgttttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacggataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagatacag
cctcagctctgtatcgggatgccttagaatctccggaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccascttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcacctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcctaatattcatttaca
ccaggacattattaacaaatgtgaacaattcgtaggtccgctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaacaagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB219533_FT00000_P-E Feature FT:source AB219533_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=3218 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctctatgtttccct
catgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgaagccctttatacctctgt
tactaatttccttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgaaattggcagtttcgggtcattaccacaagaacacatcagaatgaaaatcaaggactgttttagaaaactccca
gttaaccgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctgtcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgctcatcaaatattgcccaaggtcttatataagaggactcttggactct
ctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaact
agattaatgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgaccc
ttataaagaatttggagctactgtggagttactctcgtttttgcctactgatttctttccttcagtaagagatcttctag
ataccgcctcagctctgtatcgggatgccttagaatcttctcagcattgttcacctcaccatactgcactcaggcaagcc
attctttgctggggggatataatgactatagctacntgggtgggtgtgaatttgcaagatcaagaatccagggacctagt
agtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaa
gagaaatcgttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
atcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtg
ggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattca
tttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttag
tcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataat
gtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactac
acgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctc
gaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
caccaaaaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttg
ggccggggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacattgccagca
gatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcc
tcaggccatgcagtggaa
>gnl|hbvnuc|KU736899_FT00000_P-E Feature FT:source KU736899_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagtttcggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacgaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcggaacrgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580623_FT00000_P-E Feature FT:source MH580623_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|AM494714_FT00000_P-E Feature FT:source AM494714_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcctcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatactgctgt
taccaattttcttatgtctttgggtatacatttaaatcccaacaaaacaaagagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacttaatgaatctagctacctgggtgggtgtaaacttggaagatccagcatccagagacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatattttcctttagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgtttccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctctggc
cgtgcagtggaa
>gnl|hbvnuc|HM363609_FT00000_P-E Feature FT:source HM363609_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaatccaaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatattgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgcaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgacggaccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtgcatgtcatactgttcaagccttcaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttttggtaaccg
ctccggctcggaaccggaatgccttagaatttcctgagcattgttcaactcaacctaccgcaatcaggccaagccttttt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcttaacttgaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatatctacgaaatattcgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgggaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggaacattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggaatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF849720_FT00000_P-E Feature FT:source KF849720_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
tctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttcttatggttcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggtt
atgtcattggtagttgggggtcattaccccargaacacatcagattgaaaatcaaagactgtttcagaaaactccctgta
acccggcctattgattggaaagyaygtcarrgaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacggataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctcctccgtctgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgccatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggatttgggggaggagactagattaatg
atctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggtcatcgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
ctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctttgc
tggggagaattaatgactctagctacctgggtgggtggaaatttgcaagatccaacatccagggacctagtggtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgcctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgccccttgagaagggtataaaaccttattatccagataatgtagttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtagcgc
ctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacgaggtaggagtgggagcatttgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaaccttgccagcagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagyggaa
>gnl|hbvnuc|FN545822_FT00000_P-E Feature FT:source FN545822_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagaataaaaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccarcaaaacaaaaagatggggatattcccttaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctctgtatgcrtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcamaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgagcgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagttagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcaytgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctggtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggacwcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgccagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaagtcagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggatttttwcccgaccaccagttggatccagcattcagggcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcagggcatgcaaaaaacattgccagcagatccg
cctcttgcctccaccaatcggaagtcaggaaggcagcctaccccaatcactccacctttgagagaaactcatcctcaggc
catgaagtggaa
>gnl|hbvnuc|GQ161784_FT00000_P-E Feature FT:source GQ161784_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcactttctcaccgacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctatgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagaaaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161800_FT00000_P-E Feature FT:source GQ161800_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594751_FT00000_P-E Feature FT:source FN594751_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctgcaggatcccagagtaagaggccttcattyttccgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggactcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttggcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctggtgggatcttcaggactatcaaggtatgttgcgcgagtgtcctca
aactccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgctgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtccccttctccgtctgccgttccgaccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaamtattgcccaaggtcttatataagaggactattggactctctgcaa
tgtcaacgaccggccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctastgtggagttactctcgtttttgccgtctgatttctttccgtcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacytcaccctgctgcwctcaggcaagccattctc
tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaacaccaa
ccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
tcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatacttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaccattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catacagtggaa
>gnl|hbvnuc|GQ161802_FT00000_P-E Feature FT:source GQ161802_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgctccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattctctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaacaggcctattgattggaaagtttgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaaccttttccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgcaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaataagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatcatccagggaactagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagacaag
tcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcaatggaa
>gnl|hbvnuc|GQ161815_FT00000_P-E Feature FT:source GQ161815_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtcattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggamctaatgactctagctacctgggtgggagttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttgtggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccgtcaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagttccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274971_FT00000_P-E Feature FT:source AB274971_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|DQ060823_FT00000_P-E Feature FT:source DQ060823_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattagtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcttgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacttagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaatcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagagaaactacccgtag
cgcctcattttgtgggtcaccttactcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363605_FT00000_P-E Feature FT:source HM363605_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtatacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttatcatccaacggaccgtgtgcacttcgcttcacctttcc
acgtcgcatggaaaccaccgtgaacgctcaccaactcttgcccaaggttttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtaagagatcttctagataccg
catcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggacgatccagcatccagggacctagtagtcag
ttatgttaatactcatatgggcctaaagttcaggcaattattgtggtttcacctttcttgtctcatgtttggaagagaca
ctgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatatccatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgatcaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AY738146_FT00000_P-E Feature FT:source AY738146_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggac
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
tgctggggagaattaatgactctagctacctgggtgggcgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctctcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacgcgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcgaacaccag
aaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161781_FT00000_P-E Feature FT:source GQ161781_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccattccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagactactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|JQ000009_FT00000_P-E Feature FT:source JQ000009_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacttgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagatcgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctttcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggcctcataaggtgggaaat
tttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgataaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363579_FT00000_P-E Feature FT:source HM363579_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaattttatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaatcaaagactgttttagaaaactccca
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgagtattcaatctaagcaagctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363598_FT00000_P-E Feature FT:source HM363598_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcagcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaagaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggactgataattctgtagttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgggagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtggacttcgcttcacctctgc
acgtcgcatggagaccatcgtgaacgccccccaaatattggccaagggcttacataaaaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggaggtactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtatcgggatgccttagaatctcctgagcattgcacacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcaaggatccagggacctagtagtcag
ttatgtcaataatcatatgggcctaaagttcaggcaattgatgtggtttcacatttcttgtctcacttttggaagagaaa
tcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattacccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggactgtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccatcagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggatgtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF170742_FT00000_P-E Feature FT:source KF170742_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcckggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtrccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN545827_FT00000_P-E Feature FT:source FN545827_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagtcctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccartc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggcsaagwctgtacaacatcttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggttatgtaattg
gaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgcttt
aatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcctg
ttttgctcgcagcaggtctggagcgaaacttatcggaactgataactctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgcttggggatctatcgtccccttctccggctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagagtaggttaatgatctttgta
ttaggaggctgtaggcataaatkggtstgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacccttataaagaatttggagc
tactgtggagttactctcgtttttgccttctgacttctttccttcagtaaragatcttctagataccgcctcagctctgt
atagggatgccttggaatctcctgagcattgttcacctcaccacactgcactcaggcaagccmttctttgctggggggac
ctaatgaatctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagttatgtcaatac
tcmtgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagt
atttggtgtcttttggagtgtggattcgcactcctcyagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcckgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagatttt
ttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaatcattacttc
caaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattg
ggacmacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggttcactcccc
cacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccgcctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161825_FT00000_P-E Feature FT:source GQ161825_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcatcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaaaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtattcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctggtgacttctttccttcagtaagagatcttctatataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcatcatactgcactcaggcaagccattctt
tgctggggagatgtaatgaatttagctacctgggtgggtgcaaatttggaggatcctgtatccagggacctagtcgtcag
ctatgtcaataataatatgggcctaaagttcaggcaattattgtgggttcacatttcttgtctcacttttggaagagaaa
cagtcctacagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagaccaagcaggtcctatagaagaagaactccctcacctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttcttctatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatccagataatgtagttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccagaag
tccagattgggaccacaatcccaacaaagatcactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactccaccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|MN507842_FT00000_P-E Feature FT:source MN507842_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctaatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatatcccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccccaggaacacatcaaacaaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaggaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgcattcaatccgggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacggataattctgtcgttctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagcatccagagacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcactttgggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaagccttattatccagataatctagtt
aatcattacttccaaaccagacactatttacacaccctatggaaggcgggcatcttatataaaagagaaactacacggta
cgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB205191_FT00000_P-E Feature FT:source AB205191_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcctgatattcatttgca
ccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacagtgccaacagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB205192_FT00000_P-E Feature FT:source AB205192_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattctcttaatttcatgg
gatatgtaattgggagttgggggtcattaccacaggaacacatccgaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtgttcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctatatttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaaatcttgcccaaggtcttacataagcggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccgtcagttagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgaggaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580650_FT00000_P-E Feature FT:source MH580650_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccccaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtactcaatctaagcaggctttcactttttcgccaacttacaaggcttttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgtatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcaacg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattactttcaaaccagacactatttacataccctttggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcggtggaa
>gnl|hbvnuc|FN545823_FT00000_P-E Feature FT:source FN545823_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttctacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattgggggccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatmggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtmaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagrtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatcgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcrgtaaragatctcctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggamytaaygamtctagctacctgggtgggkgtaaatttggaagatccagcatccagggacckagtagttag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagata
ccgttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatctta
tcaacacttccggagamtgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggwggagccctcaggctcaaggcatgctaacaacgttgccagcaaatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161803_FT00000_P-E Feature FT:source GQ161803_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaaccttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatccggctttaatgcctctgtatgcgtgtattcaatctaagaaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttgggagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccacgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatttctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatgggaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccaaaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
cgtgcagtggaa
>gnl|hbvnuc|GQ161817_FT00000_P-E Feature FT:source GQ161817_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgttggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttcgaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctaccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggaacattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363589_FT00000_P-E Feature FT:source HM363589_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggacggataattctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtggcttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgctcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cttcagctctgtatcgggatgccttagaatctcctgagcattgcacacctcaccatactgcactcaggcaagccattctt
tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaagttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcaatggaa
>gnl|hbvnuc|MH580614_FT00000_P-E Feature FT:source MH580614_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|MZ962198_FT00000_P-E Feature FT:source MZ962198_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS184_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagcggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccccgttcccgctactgcctcactcatctcctcaatcttctccaggattggcgaccttgtaccgaccatggag
agcatcacatcaggtttcctaggacccctgctcgcgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcccctttctagggggagcccccgtgtgtcttggccaaaattcccagtccc
caagctacaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgttccagcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctacacgactcttgctcaaggaacctctatgtttccct
catgttgcagttcagaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagactactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccctacacggaggccttttggggtgcagccctcaggctcaaggcctgctaaaaacattgccagcagtaccg
cctcctgcatccaccattcggccgtcaagaaggcagcctaccccaatcactccacctttgagagacaatcatcctcaggc
catccagtggaa
>gnl|hbvnuc|AY935700_FT00000_P-E Feature FT:source AY935700_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagatgtaatgtctctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacagggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaaccttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161772_FT00000_P-E Feature FT:source GQ161772_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgrattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcraaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaacttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaaacctaactggaaaactccatcttttccagatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggaaggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736905_FT00000_P-E Feature FT:source KU736905_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaatcaaagattgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161773_FT00000_P-E Feature FT:source GQ161773_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgctccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattctctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaacaggcctattgattggaaagtttgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaaccttttccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgcaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaataagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatcatccagggaactagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagacaag
tcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcaatggaa
>gnl|hbvnuc|LT623851_FT00000_P-E Feature FT:source LT623851_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcagttttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcwtgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgctatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggcgccaggtctgtgcaacaccttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccgcaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtctgtcaacgaatcgtgggtcttttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctctgtatgcrtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgygtaaacaatacttgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcrgca
ctgaatcctgcggacgacccgtcccggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgwccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagmgtagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
ccacagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccatamta
tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggamgatccagcatccagggacctrgtagtcag
ttatgttaayactaatatgggcctaaagttcagacaattactrtggtttcacatttcttgtctcacttttggaagagaag
tcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgamgaggcaggwcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggatttactcttctactatacctacctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacatcattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaarttartcrtgc
ctgctagattttttcccatctctacgaaatatctgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttrtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcaktccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctraaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcargc
catgcagtggaa
>gnl|hbvnuc|MN507847_FT00000_P-E Feature FT:source MN507847_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaacaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcgtatcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaagatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagagacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggacctctaacagtaaatgaaaaacgaagactaaacttagttatgc
ctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggtgcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcagggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363569_FT00000_P-E Feature FT:source HM363569_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaatcaaaaactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtggtcag
ctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccaggcactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363604_FT00000_P-E Feature FT:source HM363604_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtagttcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
ctacatcatttccatggctgctaggctgtgctgccaactggctcctgccagggacgtccttggtatacgtgcagtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggataaaccatccccttctccgtctgccgttccggccgaccac
gcggcgcacctctctttacgcggtctcccagtctgtgccttctcatccgccggaccgtgagcacttcgcttcaccttcgc
acgtcgcatggagaccaccgtgaacgttcaccaactctcgcccaaggtcatacataagaggactcttggacactcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaataagagatcttctagataccg
cctcagctctcttccgggatgccttggaatctcctgatcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tccacacttccggagaatgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacccctcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggaagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623850_FT00000_P-E Feature FT:source LT623850_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagaataagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgcccctttcacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgrgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgyctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaaatcttgcccaaggtcttacacaagaggactcttggactctctgcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcactgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctcactggaaacctccatcttttcctgatattcatttgca
ccaggaccttattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcattttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB915175_FT00000_P-E Feature FT:source AB915175_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaaacctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcytgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494705_FT00000_P-E Feature FT:source AM494705_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagaatgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcacgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgtcctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaagatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggcaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagccttcgggccgg
ggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580626_FT00000_P-E Feature FT:source MH580626_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgcaggatcccaaagtaaatcctgctggtggctccagtttcggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgaagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
taaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattg
gaagttttgggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgttaatcggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgcggatatcctgcttt
aatgccgctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
aaccaccgtgaacgcccaccgactcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggaatcgggggaggagattaggttaatgatctttgta
ctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataaagaatttggagc
tactgtggagttactctcgtttttgccttctgacttttttccttcagtaagagatcttctagataccgcctcagctctgt
atcgggatgccttagaatcttctgagcattgctcacctcaccacactgcactcaggcaagccattctttgctggggagat
ctaatgaatctaggaacctgggtgggtggaaatttggaagatccagcatccagggacctagtagtcagttatgtcaatac
taacatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagt
atttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagatttt
ttcccatctctacgaaatatttgcccctagagaaaggtataaaaccgtattatccagataatgtagttaatcattacttc
caaaccagacactatttacatactctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattg
ggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggttcactcccc
cacacggaggccttttggggtggagcactcaggctcaaggcatgctaacaacattgccagcagatccgcctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM363573_FT00000_P-E Feature FT:source HM363573_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatattctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgttgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagacctccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttggtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363592_FT00000_P-E Feature FT:source HM363592_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctatattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacacttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacataaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctacagttcatgg
gttatgtaattggaagttggggatcattaccacaggatcatatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttactgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacctttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactttacctgtctttaaccctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatcctgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacgcgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggatagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MF772358_FT00000_P-E Feature FT:source MF772358_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagtcctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaagattggggtccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatc
actcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggccaggtctgttcaacatcttgaagccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaaggtggggatattccctaaatttcatgggttatgtaattg
gaagttgggggtcattaccacaggaccacatcaggatgaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgccaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgcttt
aatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acctgaccctttaccccgttgcccggcaacggccagggctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgcggcgcctttgtggctcctctgccgatccatactgcggaactcctagctgcttg
ttttgctcgcagcnggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
ggccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtagattaatgatttatgta
ctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataaagaatttggagc
ttctgtggagttactctcttttttgccggctgacttctatccttcagtaaaagatcttctagattccgccacagctctgt
ttcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctttgctggggggac
ttaatgaatctagctacctgggtgggtgttaatttggaagatcaagcatccagagacctagtagtcagttatgtcaatac
taatatgggcctaaagttcaggcaattattgtggttccacacttcttgtatcacgtttggaagagaaaccgtagtagagt
atttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagactactgttgttagacgaagaggcaggccccctagaggaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagatttt
ttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagacaatgtagttaatcattacttc
caaaccagacactatttacataccctttggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattg
ggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctgggctcactcccc
cacacggaggtcttttggggtggagccctcaggctcaaggcatgttaaaaacattgccagcagatccgcctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB219529_FT00000_P-E Feature FT:source AB219529_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaacacctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggttatgtaattg
gaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagaatgttttagaaaactccctgttaaccgtcct
attgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgcttt
aatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgtttgggggtctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccatcaacctttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattactgatctttgta
ctaggagactgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataaagaatttggagc
tactttgcagttactctcgtttttgcctggtgatttctttccttcagtaagagatcttctagataccgcctcagctctgt
ttcgggatgccttagaatctcctgagcattgtacccctcaccatactgcgctcaggcaagtcattctttgctggggagac
ctaatgaatctagctacctgggtgggtggaaatttgcaagatccagcatccagggatctagtagtcaattatgtcaatat
taatatgggactaaagttcaggcaattattgtggttccacatttcttgtctcacttttggaagagaaaccgttacagagt
atttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaacacttccg
gagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttactgggctt
tattcttctactatacctgtctttaatcctaactggaaaactccctcttttcctgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgctagatttt
ttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagttaatcattacttc
caaaccagacactatttacataccctctggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcatttta
tgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaaaaatcctgattg
ggacaacaatcctaacatagaccactggacagaagccaacaaggtaggagtgggagcatttgggccggggttcactcccc
cacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcggatccgcctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF849724_FT00000_P-E Feature FT:source KF849724_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagaatgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaatcaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtttcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccgttctt
tgctggggagaattaatgaatctagctacctgggtgggtgcaaatttgcaagatccgacatccagggatctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccatcagttggatccagcattcagagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagcaaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcacggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580638_FT00000_P-E Feature FT:source MH580638_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacaattaaatgccaacaaaacaaaaagatggggatattcactaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaataccagtacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagatactg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctggctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattcacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacacccg
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161786_FT00000_P-E Feature FT:source GQ161786_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactcttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
gcccagctctgtatcgggatgccttagaatctcctgagcattgtacaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttgcaagatcaagcatccagggacctagtagtcaa
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
tcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccactaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggagtt
catacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcctgatattcatttgca
ccaggacattatttacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgccactagagaagggtataaaaccttattatccaggtaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggcaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagttaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161796_FT00000_P-E Feature FT:source GQ161796_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttacacaacattccaccaagctctgcaggatcccaaagtaagacctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtttggctttc
agttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctaaatttcatgggttatgtaattg
gaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgggtatcctgcttt
aatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaat
acctgaacctttaccccgttgccaggcaacggscaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcctg
tttcgctcgcagcaggtctggagcgcaacttatcgggacggataattctgtcgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaaccctgcg
gacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagagtgtttgtttaaagactgggaggagttgggggaggagattagattacaggtgtttgta
ctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagc
tactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgt
atcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctttgctggggggac
ctaatgaatctaggtacctgggtgggtgcaaatttggatgatcaagcatccagggaccttgtagtcagttatgtcaatac
taatatgggcctaaagttcaggcaattattgtggtttcacatttcgtgtctcacttttggaagagaaaccgtcatagagt
atttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatcttatcaacacttccg
gagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattat
taacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagattaaacctagtcatgcctgctagatttt
ttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagttaatcattacttc
caaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcgtgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattg
ggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccggggttcactcccc
cacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagtagatccacctcctgcctcc
accaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK720632_FT00000_P-E Feature FT:source MK720632_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacccccgtgaacgcccgccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcctgacattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494701_FT00000_P-E Feature FT:source AM494701_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtattgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttttagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcctatctctacgaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggcctcttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363572_FT00000_P-E Feature FT:source HM363572_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagatgcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaaccctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccccaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcccctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgcgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaattatttacccctagataaaggtataaaaccttattacccagataatgtagtt
aatcattacttccaaacgagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363594_FT00000_P-E Feature FT:source HM363594_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagctcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcctgatattcatttgca
ccaggacattattaaaaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaacgggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggacccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
gattcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccc
cctcctgcctccaccaatcggcagtcaggaaggctgcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161820_FT00000_P-E Feature FT:source GQ161820_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagmtctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
rgcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcytggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatm
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggrctatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
kaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctamayttcatgg
gttatgtaattggaagttggggrtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaycggcctattgattggaaagtatgtcaamgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
rtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggycaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctmtgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcraaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcmtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcrgcg
ctgaatcctgcggacgayccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcrtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaycgcaccacactgcactcaggcaagccattctt
tgctggggggaastaatgactytagctacctgggtgggtgtaaatttggaagatccagcatccagggayctagtagtcag
ttatgtcaatamtaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccascttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggmaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggycctctaacagtaaatgaaaaacgaagaytaaacttagtyatgc
ctgctagattttttcccatckctacraaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccwcaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MF772357_FT00000_P-E Feature FT:source MF772357_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcatcgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagttcc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgcgcaacatcttgagtccatttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccca
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaataccaggacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgcggaacctttgtggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgttgagttactctcttttttgcctgctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgaacatttttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagaccacaaaatgcccctatctta
tccacacttccggaaactactgttattagacgaagagtcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttccactatacctatctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccagctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaacgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctctaccaatcggcagtcaaaaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580647_FT00000_P-E Feature FT:source MH580647_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaataaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtatcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274973_FT00000_P-E Feature FT:source AB274973_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3206 residues).
ttccacaacattccaccaagttcagcaggatcacagagtaagaggcctgcctgctggtggctccagttccggaacagtga
accctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccatgcaccgaacatggaaaacatc
acatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagag
tctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacct
ccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctc
ttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattcc
aggatcatcaaccaccagtacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtttccctcatgtt
gctgttcaaaaccttcgggcggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggag
tgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctg
gctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatacctctgttaccaa
ttttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggttatg
taattggcagttgggggtcattaccacaggagcacattagaatgaaaatcaaagactgttttagaaaactccctgttaac
aggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtggatatcc
tgctttaatgcctctgtatgcgtgtattcaatctcagcaggctttcactttctcgccgacttacaaggcctttctatgta
accaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggc
tggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagc
cgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgttctctcccggaaatatacat
catttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaat
cctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccacggggcg
cacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcg
catggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaa
cgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatc
tttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctct
tgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatt
tggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaaaagatcttctagataccgcctcag
ctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctttgctgg
ggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagttatgt
caatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtta
tagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaaca
cttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
atcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacg
gggctttactcttctactatacctgtctttaatcctaactggaaaacgccatcttttcctgatattcatttgcaccagga
cattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctgcta
gattctttcccatctctacaaaatatttgcccctagagaaaggtataaaaccctattatccagataatgtagttaatcat
tacttccaaaccagacactatttacataccctatgggaggcgggcatcttatataaaagggaaactacacgtagcgcctc
attttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacggtccctctcgaatgggggaag
aatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatcc
agattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggttca
ctcccccacacggaggccttttggggagcagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcct
gcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|EU239223_FT00000_P-E Feature FT:source EU239223_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcggccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaatcaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggatataatgactatagctacctgggtgggtgtaaatttagaagacccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatttagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccggcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161789_FT00000_P-E Feature FT:source GQ161789_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcactttctcaccgacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctatgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagaaaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494699_FT00000_P-E Feature FT:source AM494699_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaagccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcacagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcactctaagcaggctttcattttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatactacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtcggtcctctaacagtaaatgaaaaacggagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161787_FT00000_P-E Feature FT:source GQ161787_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatcttttccagatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KM606739_FT00000_P-E Feature FT:source KM606739_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcgtctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
aaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccca
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccaaccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtacttggaggctgtaggcttaaattcctctgctcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcaggtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgtacatgtttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggatgtaatgtctctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccatagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
tgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB201287_FT00000_P-E Feature FT:source AB201287_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaataccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaatcgtgggtcttctgggctttgctgctccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctgtgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttctcctcaccatacagcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactcccaaggtgggaaat
tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagacaatgtagtt
aatcattacttccaagccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggttttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|EU239221_FT00000_P-E Feature FT:source EU239221_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggca
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcgcgtttgtcctct
aattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatctgttcggtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtaccacatcttgagtccctttatacctctgt
taccaattttcttgtgtctttgggcatacatttaaatccaaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacagaaccacatcagaaggaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcgtttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363578_FT00000_P-E Feature FT:source HM363578_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccatcgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctaatgttcaagcctccaagttgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtgagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcagctcaccatactgctctcaggcaagccgttctt
tgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatcaagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagatactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274976_FT00000_P-E Feature FT:source AB274976_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
attaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagacaattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggccttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatattgacccttataa
agaatttggagctactgtggagttgctctcgtttttgcctactgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctcagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatcatccagggacctagtagtcgg
ttatgtcaatagtaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
tcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
ttttcggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagagaaacttcacgtag
cgcctcattttgcgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494708_FT00000_P-E Feature FT:source AM494708_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccgacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggcataaaaccttattatccagataatgtagtt
aatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580634_FT00000_P-E Feature FT:source MH580634_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacggaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtatttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaaaactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FJ349237_FT00000_P-E Feature FT:source FJ349237_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcacatttcttgtctaactttcggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccctcttttcctgatattcatttgca
ccaggacattattaacagatgtgagcaatttgtaggtcctttaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgccactagataaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcattttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580636_FT00000_P-E Feature FT:source MH580636_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacggaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtatttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaaaactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580645_FT00000_P-E Feature FT:source MH580645_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcccct
aattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaaggtggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ataccctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctgtcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtcgagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccaggatccagggaactagtagttag
ttatgtcaatactcatatgggcctaaagttcaggcaattaatgtggtttcacatttcttgtctcacttttggaagagaac
ttgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccacaaaatgcccctatctta
tcaacacttccggagactgctgttgttagatcaagaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagctccccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcaggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaacccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594752_FT00000_P-E Feature FT:source FN594752_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatacagcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtggttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcatctycacatctgccactcaggcaagccattctt
tgctggggggatgtaatgaacctagcaacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcgg
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttggtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgcag
cgcctcattttgggggtcaccttattcttgggaacaagggctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacgaggtaggagtgggagcttttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161760_FT00000_P-E Feature FT:source GQ161760_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
tatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacagataattctgtcgttctctcacggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacgtttggaagagaaa
ccgtagtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtcccactcgaatgg
ggaaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcaaatccg
cctcctgcctccaccatttggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962192_FT00000_P-E Feature FT:source MZ962192_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS007_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtatgttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaatcaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcactgctattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcccattgattggaaagtatgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatattgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtcattgtactcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggagctttcttggaacgtccctctcgaatcg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagccaacacctg
ttattcagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccctacacggaggccttttggggtggagccctcaggctcaaggcatgcagaacacagtgccagcagatccg
cctcctgcctccaccaatcggcagtcgggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736909_FT00000_P-E Feature FT:source KU736909_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcmttaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatygacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgamtctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtaaatactmatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cygtcatagagtatttggtgtcttttggagtgtggattcgcactcctmcagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623842_FT00000_P-E Feature FT:source LT623842_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccayaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgttwccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatacctctgt
gaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgcggatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccrgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcatytttcaccgcaccacactgcactcaggcaagccattctt
tgttggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctmaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccasyaaatgcccctatctta
tcaacwcttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagyattccttggactcacaaggtgggaaat
tttacrgggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgccccyagasaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctttggsaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggacaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcgrcagtcaggraggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN507843_FT00000_P-E Feature FT:source MN507843_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatataattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgatccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctggctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB201288_FT00000_P-E Feature FT:source AB201288_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccgtcagcgcatgcgtggtacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggttagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctggtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcctatctctactaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcagggcatgctaaaaacattgccagcagatccg
cctcttgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
aatgcagtggaa
>gnl|hbvnuc|AY738147_FT00000_P-E Feature FT:source AY738147_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggac
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttaccatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctctcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcgaacaccag
aaatccagattgggaccacaatcccaacaaagatcactggacggcagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161835_FT00000_P-E Feature FT:source GQ161835_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagtttcggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttggggatcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtatcgggatgccttagaatctcttgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcctccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactccccctcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AY738145_FT00000_C-E Feature FT:source AY738145_FT00000_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggac
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcggtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctctcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattctcgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcgaacaccag
aaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736903_FT00000_P-E Feature FT:source KU736903_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatattgcccaaggtcttacataagaggactcttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtaaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaattactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623849_FT00000_P-E Feature FT:source LT623849_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcktggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcamggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccay
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctttatacctctgt
kaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttacgtaattggaagttgggggtcattaccacaggaacacatcacactgaaaatcaaagactgttttagaaacctccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctactccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtcwttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctwctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaycacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatrtgggcctaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcscactcctcmagcttatagaccaccaaatgcccctatctta
tcaacacttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcscctcscagacgaag
atctcaatcgccgcgtcscagaagatctcaatctccascttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgmtattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttaccactagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagagaaaccacgcgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggtgcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacwgtgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161757_FT00000_P-E Feature FT:source GQ161757_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaccaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccca
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaataactctaagtacctgggtgggtgctaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaag
tcgttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagattgaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagataaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580635_FT00000_P-E Feature FT:source MH580635_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcacggaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtatttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaaaactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MW455164_FT00000_P-E Feature FT:source MW455164_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3509_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaccaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
tgctggggggaactaatgactttagctacctgggtgggtgtcaatttggaagatcaagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacacttcttgtatcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaagccttttggggtggagccctcaggctcaaggcatgctacaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccactcactccacctttgagagacacccatcctcaggc
catgcagtggca
>gnl|hbvnuc|AB106564_FT00000_C-E Feature FT:source AB106564_FT00000_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactctggctcaaggaacctctatgtttccct
catgttgctgttcaaaacctgcggacggaaattgcacttgtacccccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatatcccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccccaggaacacatcaaacaaaaaatcaaagactgttttagaaaactccct
gtaacccggcctatagattggaaagcacgtcaaggaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgcattcaatccgggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcagcaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagcatccagagacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcactttgggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaagccttattatccagataatctagtt
aatcattacttccaaaccagacactatttacacaccctatggaaggcgggcatcttatataaaagagaaactacacggta
cgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaagcctctgggatgtgttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgccaaaaacatcgccagcagaaccg
cctcctgcctccaccaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagcggaa
>gnl|hbvnuc|GQ161790_FT00000_P-E Feature FT:source GQ161790_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcattcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctaatcttgcccaaggttttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363574_FT00000_P-E Feature FT:source HM363574_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatccaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcctctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tccacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctcacagtaaatgaaaaacgacgattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcacacccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494690_FT00000_P-E Feature FT:source AM494690_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctaatatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363568_FT00000_P-E Feature FT:source HM363568_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctacagttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtcttggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
ttcacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacctagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatcctgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KT749841_FT00000_P-E Feature FT:source KT749841_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgaatactgcctctctcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
aaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggctattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgactggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacctttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaggatccagcatccagggatctagtagtcag
ttatgtcaatactactattggccttaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagata
tcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
caatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctactgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161836_FT00000_P-E Feature FT:source GQ161836_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgacgattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagactaaacttagttatgc
ctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|LT623847_FT00000_P-E Feature FT:source LT623847_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
aacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatm
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcmttaccacaggaacacatcagaatgaaaatcaaagaytgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggagcctttgtgactcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactcttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcgtttttgcctcctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgytggggggatataatgaatatagctacctgggtgggtgctaatttggaagatcaaacatccagggacctagtagtcag
ttatgtcaatactaatatgggcataaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaag
tagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgaaattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagaccaggtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatatagaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccamtcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcartggaa
>gnl|hbvnuc|OM256457_FT00000_P-E Feature FT:source OM256457_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ZAHMDM78). Complete genome. [Riboviria] (length=3212 residues).
ttccacaayattccaccaarctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccytgcaccgaacatggaa
agcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtgattggtggttgggggtcattgccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctatatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggaccgataattctgtcgttctctcccggaaat
atacatcttttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatacagcactcaggcaagccattctt
tgctggggagatttaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaawtattgtggtttcacatttcttgtctaacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgccccttgagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttgtggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363570_FT00000_P-E Feature FT:source HM363570_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaatcaaaaactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtcccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtggtcag
ctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccaggcactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363590_FT00000_P-E Feature FT:source HM363590_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaagatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaaatattgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736913_FT00000_P-E Feature FT:source KU736913_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatattcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctyagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacaccttgagtccctttatacttctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagattgtttcagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacggataattctgtcgtyctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctwstgtggagttgctctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacytaatgaatctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatrtgggcctaaagttcagrcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtmgtagagtatttggtgtcttttggagtgtggattcgcactcctryagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccamtgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaacaagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggcctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaycagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactccmccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN545841_FT00000_P-E Feature FT:source FN545841_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccggctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161792_FT00000_P-E Feature FT:source GQ161792_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccgscctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctctgtctgccgttccatccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaac
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcatctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580631_FT00000_P-E Feature FT:source MH580631_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaaagacgattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttacccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgg
gggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494710_FT00000_P-E Feature FT:source AM494710_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgacacttatcgggactgataattctgttgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcctgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacctagtcatgc
ctgctagattttttcccatctctacaaaatattttcccttagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagcgctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggtcttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161814_FT00000_P-E Feature FT:source GQ161814_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctctgtctgccgttccatccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatygacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggaactattagtcag
ttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgccaacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN967529_FT00000_P-E Feature FT:source MN967529_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR_93). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacggataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttagggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctacaccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161761_FT00000_P-E Feature FT:source GQ161761_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcccattgattggaaagtatgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatattgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaataccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccctacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161824_FT00000_P-E Feature FT:source GQ161824_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcacaatgaaaatcaaggactgttttagaaacctccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatacgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttgtatcacttttggaagacaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgaag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattccaagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagttccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcaatggaa
>gnl|hbvnuc|MH580629_FT00000_P-E Feature FT:source MH580629_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgacttctgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttaccgctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB201289_FT00000_P-E Feature FT:source AB201289_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
tgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161775_FT00000_P-E Feature FT:source GQ161775_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaacctctgcagaatcccagagtaagaggtcaggattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttcyctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccakgatcatcaaccaccagtacgggaccctgcmgaacctgcacgactcytgctcaaggmamctctatgtttccct
catgttgytgttcaaaaccttcggacggaaattgcacytgtattcccatcccatcatcatgggctttcgsaaaattccta
tgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatytaaayccycacaaaacaaaaagatggggatattccctacatttcatgg
gttayrtaattggaagttgggggtcattrccacaggawcayatcrkaawgaaaatcaaarattgttttagaaaactycct
rttaacmggcctattgattggaaagtatgtcaamgaattgtgggtctkttgggctttgcwgccccytttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcmgcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtrctgccaactggatycttcgmgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggycgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcatgtttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctaccatacctgtcttcaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363591_FT00000_P-E Feature FT:source HM363591_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaattcc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccacaaatcctctgggattttttcccgatcatcagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB274982_FT00000_P-E Feature FT:source AB274982_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtattcatttaaatcccaacaaaacaaaaagatggggatactcccttaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactcccg
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgtactctcccggaaat
atacatcttttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccaaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcatagttcaccgcatcacactgcactcaggcaagccattctt
tgctggggggacttaatgtctctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctaacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcacttgca
ccaggacattattaacaaatgtgaagaatttgtaggtcctctcacagtaaatgaaaaacgaagattaaatctagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttgtggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363610_FT00000_P-E Feature FT:source HM363610_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttcaggaa
aagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggcaatcagcgcatgcgtggaacctttgtggctcctctgccgacccaaacggcgaaact
cctagccgcttgtttggctcgcagcaggtctggagcgaaatttatcgggacgcaaaattcggtcgttctctccaggaaaa
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaacattgcccaaggtctaacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgagaggagttgggggaggagagtagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctcccagctgtcccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcctgatttctttccttcagtaagagatcttctggataccg
ccgcagctttgtttcgggatgccttcgaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaacttatgactctagctacctgggtgggtgcaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctgaagttcaggcaattattctggtttcacatttcttgtctcacttttggaagagaag
tcgtattagagtatttggtgtcttttggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacagggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaatcatgc
ctgctagattttatcccatctctacgaaatacttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacacccg
aaatccagattgggatcacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctccaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MW455165_FT00000_P-E Feature FT:source MW455165_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3517_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcgtatcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatattgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcacggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaagatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagccggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgtctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaataactctaagtacctgggtgggtgctaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaag
tcgttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggtgcattcgggccgg
ggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccactcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161770_FT00000_P-E Feature FT:source GQ161770_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttgtagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363581_FT00000_P-E Feature FT:source HM363581_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatttccctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaattttatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaatcaaagactgttttagaaaactccca
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaagctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccag
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KM606738_FT00000_P-E Feature FT:source KM606738_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattttcctgctggtggctccagttccggaa
cagtgaaccatgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcgaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
gaccaattttcttttgtctttgggtatacatataaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
tgctggggagacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgttaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaattggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagctttcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcttccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594762_FT00000_P-E Feature FT:source FN594762_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgctggatcccacagtaggaggcctgtcttctcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgttcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttccctcac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattg
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtaagagatcttctagataccg
cctcagctctctttcgggatgccttagaatctcctgagcattgctcacctcaccatagtgcactcaggcaagccgttctt
tgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagcctccagggacctggtagtcag
ttatgtcaatactgatatgggcctgaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagata
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctataccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctgctatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaatcctgc
ctgctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatccagataatctagtt
aatcactacttccaaacccgacactatttacataccctatgggaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttgggggtcaccttattcttgggaacaagagctacatcatgggtctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggaaaaaagccaacaaggtaggagtgggagcattctggccgg
ggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161783_FT00000_P-E Feature FT:source GQ161783_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcacaatgaaaatcaaggactgttttagaaacctccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatacgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttgtatcacttttggaagacaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgaag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattccaagcaaacaccag
aaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagttccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcaatggaa
>gnl|hbvnuc|MF772354_FT00000_P-E Feature FT:source MF772354_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtgattggtagttgggggtcattaccacaagaccacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccaaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaaatta
tcggtcattgtttggggaggctgtaggcataaattggtctgnnnnnnnnnnncatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcacacccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|DQ060824_FT00000_P-E Feature FT:source DQ060824_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggcattcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggggctatcgtccccttctccgtctgccgttccagccgacgac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgcgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacaaaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161777_FT00000_P-E Feature FT:source GQ161777_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctamatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccwacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatacgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgttctctcccggaaat
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580649_FT00000_P-E Feature FT:source MH580649_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494709_FT00000_P-E Feature FT:source AM494709_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcactgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatataattggaagttggggctcattaccacaagaacacatcagattaaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgttgttctctcccgaaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcttaaaattcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttaca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaacgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580617_FT00000_P-E Feature FT:source MH580617_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacagtgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580646_FT00000_P-E Feature FT:source MH580646_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AB205129_FT00000_P-E Feature FT:source AB205129_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattctcttaatttcatgg
gatatgtaattgggagttgggggtcattaccacaggaacacatccgaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtgttcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaaatcttgcccaaggtcttacataagcggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccgtcagttagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgggaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccgacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580648_FT00000_P-E Feature FT:source MH580648_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacattaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaataccggaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagctcaacttatcgggactgataattctgttgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttgaaagactgggaggagtcgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtcgagttactctcgtttttgcctcctgacttctttccttcagtaaaagatcttctagatacca
tctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactgcaatcaggcaagccattctt
tgctgggggaaccttatgaatctagctacctgggtgggtgtaaatttggaagatcaagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctacagttcaggcaattattgtggtttcacatgtcttgtatcatttttggaagggaaa
ctgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagacgatctcaatctccatcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcccgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcctgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacggttcctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacacaggccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatcct
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctctggc
cgtgcagtggaa
>gnl|hbvnuc|MW455163_FT00000_P-E Feature FT:source MW455163_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3485_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatatttccct
catgttgctgttcagaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtacacaatacatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttctcgggactgataattctgtcgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgtctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctaatattcatctgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgcaaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggca
>gnl|hbvnuc|DQ060826_FT00000_P-E Feature FT:source DQ060826_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccctcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccaatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactctctcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594760_FT00000_P-E Feature FT:source FN594760_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggggctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggaatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctsgctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaacacaaaaagatggggatatcccccaaatttcatgg
gcaatgtaattggaagttgggggtctttaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgtactctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttggaatctcctgagcattgttcccytcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatcatccagggaactagtagtcgg
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttg
tcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgcag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaatattccttggactcacaaggtgggaaat
tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
caatccagattgggacgacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcggcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161795_FT00000_P-E Feature FT:source GQ161795_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Complete genome. [Hepadnaviridae] (length=3185 residues).
ttccacaacattccaccaagctctgccacctgctggtggctccagttccggaacagtgaaccctgttccgactactgcct
cactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggaccc
ctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttc
tctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctctt
gtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
atcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagtac
gggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttcagttatatggatgat
gtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtat
acatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattggaagttgggggtcat
taccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccctgttaaccggcctattgattggaaagta
tgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgc
gtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttacc
ccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccat
cagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcag
gtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaatatacatcctttccatggctgctaggct
gtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcgg
ggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctc
cccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgc
ccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgaccttgaggcatact
tcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtcctaggaggctgtagg
cataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaa
gcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctactgtggagttact
ctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttag
aatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctttgctggggggacctaatgtctctagct
acctgggtgggtgtaaatttagaagatccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaa
gttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttg
gagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgtt
agacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatc
tcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctttactcttctactata
cctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacattattaacaaatgtgaaca
atttgtaggtcctctaacagtaaatgaaaaacgaagactaaacttagttatgcctgctagattttttcccatctctacaa
aatatttgcccctagagaaaggtataaaatcttattacccagataatgtagttaatcattacttccaaaccagacactat
ttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttgtgggtcaccttattc
ttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgggggaagaatcattccaccaccaatcct
ctgggattttttcccgaccaccagttggatccagcattcagagcaaataccagaaatccagattgggaccacaatcccaa
caaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccggggctcactcccccacacggaggccttt
tggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctccaccaatcggcagtca
ggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ060825_FT00000_P-E Feature FT:source DQ060825_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggtagttgggggtcattaccacaagaacatatcagattgaaaatcaaagactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccttcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacccgtag
cgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcatttgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaagacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161763_FT00000_P-E Feature FT:source GQ161763_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatacgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgttctctcccggaaat
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagattaaacttagtcatgc
ctgctagattttttcccatctgtacgaaatatttgcccctagagaaaggtataaaaccttattatcccgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161823_FT00000_P-E Feature FT:source GQ161823_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Complete genome. [Hepadnaviridae] (length=3203 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggccctgctggtggctccagttccggaacagtgaacc
ctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcaca
tcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtct
agactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctcca
atcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttc
atcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctacttccagg
atcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgct
gttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgg
gcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggct
ttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgtgaccaattt
tcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaa
ttggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccctgttaaccgg
cctattgattggaaagtctgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtgggtatcctgc
tttaatgcctctgtatgcgtgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttctgtgtaaac
aatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctgg
ggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagctgc
ttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaatatacatcat
ttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcct
gcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgcccacggggcgcac
ctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcat
ggaaaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacga
ccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatcttt
gtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttatgaagaatttgg
agctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctc
tgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacggcactcaggcaagccattctttgctggggg
gacctaatgaatctaggcacctgggtgggtgtaaatttagaagatcaagcatccagggaccgagtagtcagttatgtcaa
tactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcttag
agtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatcttatcaacactt
ccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatc
gccgcgtcgcagaagatctaaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacgggg
ctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcaccaggacat
tattaacagatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgcctgctagat
tttttcccatctctacaaaatatttgcccctagagaagggtataaaagcttattatccagataatgtagttaatcattac
ttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataagagagaaactacacgtagcgcctcatt
ttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgggggaagaat
cattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaataccagaaatccaga
ttgggaccacaatcccaacaaagaccactggaaggaagccaacaaggtaggagtgggagcattcgggccggggttcactc
ccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcc
tccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtg
gaa
>gnl|hbvnuc|GQ161764_FT00000_P-E Feature FT:source GQ161764_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactttagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161834_FT00000_P-E Feature FT:source GQ161834_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctcttcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctctgggtatacatttaaatcccaacaaaacaaaaagatggggatattcactacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcatggttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggacttaatgactctagctacctgggtgggggaaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgcgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaactcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctggaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaccaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatccccagcc
catgcagtggaa
>gnl|hbvnuc|MH580624_FT00000_P-E Feature FT:source MH580624_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactacacctatctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttaccgctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363585_FT00000_P-E Feature FT:source HM363585_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtcttttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccctttacgcaatgtgg
atatcctgctttaatgcctatatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacctcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgagaggagttgggggaggagagtagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctcccagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagtaagagatcttctagatactg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
tcaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363601_FT00000_P-E Feature FT:source HM363601_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgtttcagaaaactccct
gttaatcggcccattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgccgctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgctgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggacaattctgtcgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaacattgcccaaggtctaacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcaccgctgcctaatc
atctcttgttcatgtcctactgttcaagccttcaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgccgacttctttccttcagtaagagatcttctagataccg
cttcagctctgtttcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgttggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatcaagcatccagggacctaatagtcag
ttatgtcaatagtagtatgggcctaaagttcaggcaaatattctggtttcacatttcttgtctcacttttggaagagaag
tcgttctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttcctgagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggcggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctactccaatcactccacctttgagagacactcatcctcaggc
tatgcagtggaa
>gnl|hbvnuc|MN507840_FT00000_P-E Feature FT:source MN507840_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttttcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctctgtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgttattggtagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctggtagtcgg
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacacttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgtag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccctattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactgcacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|EU239220_FT00000_P-E Feature FT:source EU239220_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaaaatctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggga
cagtgaaccctgttccgactactgcctcactcacctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcccatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtactcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
tactaattttcttttggctttgggcatacatttaaatcccaacaaaacaaaaaggtggggttattccctcaatttcatgg
gttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccttgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacggacaattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcttttttgcctggtgacttctttccttcagtaagagatcttctagataccg
ccacagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaggccattctt
tgctggggggaactaatgactctagctacatgggtgggtgcaaatttagaagatccagcatccagggaccttgtagtcag
ttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaag
tcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagattactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaagacattattaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaccttagtcatgc
ctgctaggttttttcccatctccacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaatcttcacgtag
cgcctcattttgtgggtcgccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatctttccaccgtaaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaagacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaattactccacctttgagagacactcatcctcaggc
cgttcagtggaa
>gnl|hbvnuc|HM363576_FT00000_P-E Feature FT:source HM363576_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atttcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagatactg
gctcatctctgtgtggggatgccctagaatctcctgagcattgttcacctcaccatactgaactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaattatgc
ctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580644_FT00000_P-E Feature FT:source MH580644_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagcgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacagtgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactctacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|EU239222_FT00000_P-E Feature FT:source EU239222_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcagaatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtatcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacattagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatataagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctaaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcagtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgttggggggaccttatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattactgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctacagcatatagaccaccaaatgcccctatctta
tcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttactcttctactttacctgtctttaatcctaattggaaaactccatcttttcctgacattcatttgca
ccaggacatcattaacaaatgtgtacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctactaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcgtcttatataaaagggaaactacacgtag
cgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363566_FT00000_P-E Feature FT:source HM363566_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcactgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccgacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcgaaacttattgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtcacggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgtctac
gggtcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcatgtttcacatcaccatactgcactcaggcaagccattctt
tgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaagaccaagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tccacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatccccactggaaaactccatcttttcctgatattcatttgca
ccaggacattattgacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactgcacgtag
tgcctcattttttgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcacagcgaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaaccaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN507848_FT00000_P-E Feature FT:source MN507848_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttctacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacttcacctttgagggacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363565_FT00000_P-E Feature FT:source HM363565_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggaccccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaattcc
gaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggccggaaattgcacttgtactcccatcccatcatcatgggctttcggaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtcaacaataccggaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtcccggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctttgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccacgctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcttgacttctttccttcagtaaaagatcttctagataccg
cctcagctctatatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgaatttagccacctgggtgggtgcaaatttggacgacccaggatctagggaccaagtagtcag
ttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagata
ctgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccattgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcctgatattcatttgca
ccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaaattagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttatccttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccgccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KF170741_FT00000_P-E Feature FT:source KF170741_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttcagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttggggatcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaaatcttgcccaaggtcttgcataagaggactcttggactctctgcaa
tgtcaacgaccgtccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggatctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatcccaacccccccccttggagtattccttccactcacaaggtgggaaat
tttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580651_FT00000_P-E Feature FT:source MH580651_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|FJ349239_FT00000_P-E Feature FT:source FJ349239_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctacgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccaaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatcgttacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacattgccagcagatccg
cctcctgcctccaccaatcggcaatcagggaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161811_FT00000_P-E Feature FT:source GQ161811_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgcatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcygccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggackgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatygacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagcaagagatcttctagatacyg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtggaaatttggaagatccagcatccagggaccttgtagtcgg
ttatgtcaacactaatatgggcataaggttcaggcaattattgtggtttcacatttcttgtctcacttttggaagacaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccttcttttcctgatattcatttgca
ccaggacattattaagaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacagtgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363586_FT00000_P-E Feature FT:source HM363586_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaaaattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggcatacatttaaattccaacaaaacaaaaagatggggatattccctccagttcatgg
gttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctctgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactgttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctttgtatcgggatgccttagaatcgcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccgtcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatcctgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccactaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacaaaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594763_FT00000_P-E Feature FT:source FN594763_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgatttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcacaatactgcactcaggcaagccattctt
tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaacaccaa
ccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgcttatagaccaccaaatgcccctatctta
tcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatacttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaagagaaactacacgtag
cgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161779_FT00000_P-E Feature FT:source GQ161779_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
ggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccttacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatccaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcttttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctcaacaaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagttaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MW455161_FT00000_P-E Feature FT:source MW455161_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2678_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggaaagaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcctgacattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccctattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactgcacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494702_FT00000_P-E Feature FT:source AM494702_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattg
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatcgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FN594765_FT00000_P-E Feature FT:source FN594765_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgcctgtcctct
aactccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtgtccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttmggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttggggatccttrccacaggaccacatcagattgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcactttytcgccaacttacaaggcctttc
tgtttaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggaccgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctrcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttcygtggagttactctcktttttgccgtctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttggaatcttctgagcattgttcacctcaccacactgcactcaggcaagccattctt
tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagcatccagggaccaagtagtcag
ttatgtcaacactaatatgggagtaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctygaatgg
gggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcaaagcaaacaccag
maatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggatcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagycctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactcctcctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MZ962197_FT00000_P-E Feature FT:source MZ962197_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate DS173_ocHBVe_GC). Complete genome. [Riboviria] (length=3212 residues).
ttacacagcattccaccaagctctgcaggatcccagagtaagacacctgtatcttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacgtcaggattcctagaacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgccctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
tcctactacatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgcatccct
catactgctgttcagaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccgcaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcactttctcaccgacttacaaggccttcc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctatgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggaccttgtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattttttcctgacattcatttgca
ccaggacattattaacagatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagaaaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacttcaatcccacccaagaccactggaccgcagccaacaaggtaggagtgggagcattcgggccgg
ggttcactgccccacacggaggtcttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatctg
cctcctgcctccaccaaacggcagtcaggaaggcagcctaccccactcactccacctttgagagacactcatcctctggc
catgcagtggaa
>gnl|hbvnuc|HM363584_FT00000_P-E Feature FT:source HM363584_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttggggatcattaccacaggatcacatcagattgaaaatcaaagactgttttagaaaactccct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctggggcttctcatctgccggaccgtgtgcacttcccttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagtaagagatcttctagatactg
cctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctcttacggtaaatgaaaaacggagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatattttcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcacataacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MF772362_FT00000_P-E Feature FT:source MF772362_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcctcttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagagacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgacattcatttgca
ccaggacatcattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagacaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggcctg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580652_FT00000_P-E Feature FT:source MH580652_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaattttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaaagacgattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttacccctagagaagggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgg
gggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363575_FT00000_P-E Feature FT:source HM363575_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaagatggggatattctctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatca
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagatactg
gctcatctctgtatggggatgccttacaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttaattatgc
ctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattccgagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|HM363588_FT00000_P-E Feature FT:source HM363588_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cttcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagagaatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaactacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KU736898_FT00000_P-E Feature FT:source KU736898_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaacttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtcttcgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagacccccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaatttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatcctgataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494689_FT00000_P-E Feature FT:source AM494689_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgcaggatcccatagtaartcctgctggtggctccagttccggaacagtgaaccctg
ttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaacctccagtc
actcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatc
atcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgtt
caaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcc
tcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgtctggctttc
agttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttataccgctgttaccaattttct
tttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgggttatgtaattg
gaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgttttagaaaactccctgttaaccggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgcttt
aatgcctctgtatgcgtgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttttgtgtaaacaat
acctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgttgttctctcccggaaatatacatcatttc
catggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcg
gacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatgga
gaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagactagattaatgatctttgta
ctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagc
tactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcctcagctctgt
atcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgctggggggaa
ctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagttatgtcaatac
taatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccgtcatagagt
atttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatctacacttccg
gagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaattttacggggctt
tactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttacaccaggacattat
tgacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagattaaacttagttatgcctgctagatttt
ttcccatctctacaaaatattttcccctagagaaaggcataaagccttattatcccgataatgtagttaatcattacttt
caaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtagcgcctcattttg
tgggtcaccttattcttgggaaccagagctacatcatggggctttcttggacggtccctctcgaatgggggaagaatcat
tccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaatccagattg
ggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggttcactcccc
cacacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacattgccagcagatccgcctcctgcctcc
accaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcaatggaa
>gnl|hbvnuc|FN594761_FT00000_P-E Feature FT:source FN594761_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcgaaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttataccgctgt
waccaattttctgttgtctttgggtatacatttaaattccaacaaaacaaaaagatggggatattccctgaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaatcaaagactgttttagaaaactccct
gttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgwccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatygacccttataa
agaatttggagctwctgkggagttactctcgtttttgccttctgacttctttccttcagtaagagatctactagataccg
cctcagctctctgtcggggtgccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
tgctggggggatcttatgaacctagctacctgggtgggtgcaaatttggaagacccagcatccagggacctagtagtcgg
ttatgtcaatactactgtgggactaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagacg
tcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagcttataggccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatctagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtgggagcatttgggccgg
ggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580625_FT00000_P-E Feature FT:source MH580625_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcaaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacagataattccgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagttag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagttatgc
ctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaaacgacacgtag
cgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacaccaa
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgttgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaataactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|GQ161807_FT00000_P-E Feature FT:source GQ161807_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatggaa
agcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatgg
gttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcccattgattggaaagtatgtcaacgcatcgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggaccgacaattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacacaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
tgctggggggatctaatgactctagctacctgggtgggtgcaaatttagaagatccagcatccagggaccaagtagtcag
ttatgtcaatgataatatagccctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacaaaatatttgcccttagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
tgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctagaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattcggcccgg
ggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaagaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MH580618_FT00000_P-E Feature FT:source MH580618_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcctgctggtggctccagttccggaacag
tgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagc
atcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgca
gagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccccaa
cctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttc
ctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaat
tccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcat
gttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgg
gagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttac
caattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgggtt
atgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgttttagaaaactccctgtt
aaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtggata
tcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgt
gtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccact
ggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcct
agccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaatata
catcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctg
aatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctccgactgccgttccagccgaccacggg
gcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacg
tcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttacataagaggactcttggactctctgcaatgt
caacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaag
gtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatc
tcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaaga
atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccgcct
cagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctttgc
tggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcagtta
tgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaaccg
tcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatcttatca
acacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaatttt
acggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgcacca
ggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgcctg
ctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtggttaat
cattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaagagaaactacacgtagcgc
ctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatggggg
aagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccagaaa
tccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcattcgggccggggt
tcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccaacagatccgcct
cctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|MN507846_FT00000_P-E Feature FT:source MN507846_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaa
agcatcacatcaggattcctacaacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggcttttagttatatggatgatgtggtattgggggccaaaactgtacaccatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctacatttcatgg
gttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataattctgtcgttctctcccggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagcatccagggacctagtggtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtgggagcatttgggccgg
ggttcactcccccgcacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacacgcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|AM494698_FT00000_P-E Feature FT:source AM494698_FT00000_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Complete genome. [Hepadnaviridae] (length=3191 residues).
ttccacaacattccaccaagctctgcaggatccccctgctggtggctccagttccggaacagtgaaccctgttccgacta
ctgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattccta
ggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtg
gacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgcagtccccaacctccagtcactcaccaa
cctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgcta
tgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccac
cagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctt
cggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgt
ttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccattgcctggctttcagttatatg
gatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtcttt
gggta