HBVdb

Dataset for nucleotide sequence X of genotype D

[Download (right click)] [Alignment] [Repertoires]

1704 sequence(s)

>gnl|hbvcds|AB048701_X_P-D Feature FT:CDS AB048701_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggccctgtcgtcctcttctccacctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB078031_X_P-D Feature FT:CDS AB078031_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB078032_X_P-D Feature FT:CDS AB078032_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB078033_X_P-D Feature FT:CDS AB078033_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB090268_X_P-D Feature FT:CDS AB090268_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB090269_X_P-D Feature FT:CDS AB090269_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaatctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgctttacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggtatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB090270_X_P-D Feature FT:CDS AB090270_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB104709_X_P-D Feature FT:CDS AB104709_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB104710_X_P-D Feature FT:CDS AB104710_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacgtattgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB104711_X_P-D Feature FT:CDS AB104711_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB104712_X_P-D Feature FT:CDS AB104712_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccatccagtattgcacaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB109475_X_P-D Feature FT:CDS AB109475_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB109476_X_P-D Feature FT:CDS AB109476_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB109477_X_P-D Feature FT:CDS AB109477_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB109478_X_P-D Feature FT:CDS AB109478_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|AB109479_X_P-D Feature FT:CDS AB109479_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB110075_X_P-D Feature FT:CDS AB110075_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116266_X_P-D Feature FT:CDS AB116266_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtcgtccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119251_X_P-D Feature FT:CDS AB119251_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
tcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119252_X_P-D Feature FT:CDS AB119252_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119253_X_P-D Feature FT:CDS AB119253_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccactccttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119254_X_P-D Feature FT:CDS AB119254_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119255_X_P-D Feature FT:CDS AB119255_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB119256_X_P-D Feature FT:CDS AB119256_X_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgagacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactccctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB120308_X_P-D Feature FT:CDS AB120308_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB126581_X_P-D Feature FT:CDS AB126581_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttggat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB188241_X_P-D Feature FT:CDS AB188241_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB188242_X_P-D Feature FT:CDS AB188242_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB188244_X_P-D Feature FT:CDS AB188244_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205126_X_P-D Feature FT:CDS AB205126_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205127_X_P-D Feature FT:CDS AB205127_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205128_X_P-D Feature FT:CDS AB205128_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB210820_X_P-D Feature FT:CDS AB210820_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgattgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB210821_X_P-D Feature FT:CDS AB210821_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB210822_X_P-D Feature FT:CDS AB210822_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222709_X_P-D Feature FT:CDS AB222709_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222710_X_P-D Feature FT:CDS AB222710_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222711_X_P-D Feature FT:CDS AB222711_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222712_X_P-D Feature FT:CDS AB222712_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222713_X_P-D Feature FT:CDS AB222713_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtatttgttt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246347_X_P-D Feature FT:CDS AB246347_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246348_X_P-D Feature FT:CDS AB246348_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB267090_X_P-D Feature FT:CDS AB267090_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270537_X_P-D Feature FT:CDS AB270537_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL22F). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgtgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactctcggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270539_X_P-D Feature FT:CDS AB270539_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatattgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270540_X_P-D Feature FT:CDS AB270540_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL241F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270541_X_P-D Feature FT:CDS AB270541_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgtttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270542_X_P-D Feature FT:CDS AB270542_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcctggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|AB270543_X_P-D Feature FT:CDS AB270543_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaawggtctttttat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270546_X_P-D Feature FT:CDS AB270546_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270547_X_P-D Feature FT:CDS AB270547_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270548_X_P-D Feature FT:CDS AB270548_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactgtctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttktat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270549_X_P-D Feature FT:CDS AB270549_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL79F). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB270550_X_P-D Feature FT:CDS AB270550_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcctgcgg
acgacccgtctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB330367_X_P-D Feature FT:CDS AB330367_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgattgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB330369_X_P-D Feature FT:CDS AB330369_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtcc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB330370_X_P-D Feature FT:CDS AB330370_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtcc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471856_X_P-D Feature FT:CDS AB471856_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471857_X_P-D Feature FT:CDS AB471857_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493846_X_P-D Feature FT:CDS AB493846_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgacct
tgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtactag
gaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB555496_X_P-D Feature FT:CDS AB555496_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctgtcgtcccctcatccgtttgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttcttcacctctgcctaa
>gnl|hbvcds|AB555497_X_P-D Feature FT:CDS AB555497_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgattgggactctatcgtcccctcctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagactagattaatgatctatgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB555500_X_P-D Feature FT:CDS AB555500_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgattgggactctatcgtcccctcctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagactagattaatgatctatgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB555501_X_P-D Feature FT:CDS AB555501_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtcccctcctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB583680_X_P-D Feature FT:CDS AB583680_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgttc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674404_X_P-D Feature FT:CDS AB674404_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE39). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674405_X_P-D Feature FT:CDS AB674405_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674406_X_P-D Feature FT:CDS AB674406_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674407_X_P-D Feature FT:CDS AB674407_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtmc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674408_X_P-D Feature FT:CDS AB674408_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcmtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674409_X_P-D Feature FT:CDS AB674409_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD40). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatactttaaagactgtttgtttaaggaatgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674410_X_P-D Feature FT:CDS AB674410_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD27). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674411_X_P-D Feature FT:CDS AB674411_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674413_X_P-D Feature FT:CDS AB674413_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674414_X_P-D Feature FT:CDS AB674414_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE33). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactcgattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674415_X_P-D Feature FT:CDS AB674415_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC24). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctmtcgtccccttctccgtttgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccatgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674416_X_P-D Feature FT:CDS AB674416_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggaaytgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagatccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674417_X_P-D Feature FT:CDS AB674417_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggagctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674418_X_P-D Feature FT:CDS AB674418_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggagctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674419_X_P-D Feature FT:CDS AB674419_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgaagctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674420_X_P-D Feature FT:CDS AB674420_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttaggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674422_X_P-D Feature FT:CDS AB674422_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674423_X_P-D Feature FT:CDS AB674423_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674424_X_P-D Feature FT:CDS AB674424_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgagcgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674425_X_P-D Feature FT:CDS AB674425_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacgtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgagcaatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagtcgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674426_X_P-D Feature FT:CDS AB674426_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD50). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggacgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgtttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674427_X_P-D Feature FT:CDS AB674427_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674428_X_P-D Feature FT:CDS AB674428_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674429_X_P-D Feature FT:CDS AB674429_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD89). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgyaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674430_X_P-D Feature FT:CDS AB674430_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC2). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB674431_X_P-D Feature FT:CDS AB674431_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggaatgggaggagttgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF043593_X_P-D Feature FT:CDS AF043593_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF043594_X_P-D Feature FT:CDS AF043594_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121239_X_P-D Feature FT:CDS AF121239_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121240_X_C-D Feature FT:CDS AF121240_X_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121241_X_P-D Feature FT:CDS AF121241_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121242_X_P-D Feature FT:CDS AF121242_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF151735_X_P-D Feature FT:CDS AF151735_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF280817_X_P-D Feature FT:CDS AF280817_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ131956_X_P-D Feature FT:CDS AJ131956_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ344116_X_P-D Feature FT:CDS AJ344116_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627215_X_P-D Feature FT:CDS AJ627215_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctataatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627216_X_P-D Feature FT:CDS AJ627216_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctataatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627218_X_P-D Feature FT:CDS AJ627218_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctatcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627219_X_P-D Feature FT:CDS AJ627219_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627220_X_P-D Feature FT:CDS AJ627220_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctttcgtccccttctccgactgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AJ627222_X_P-D Feature FT:CDS AJ627222_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttycgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaacgactgggaggagttgggggaggagagtagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AJ627223_X_P-D Feature FT:CDS AJ627223_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctttcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627224_X_P-D Feature FT:CDS AJ627224_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaacgacctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AM422939_X_P-D Feature FT:CDS AM422939_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY090452_X_P-D Feature FT:CDS AY090452_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacggggcgcatctct
ctttacgcgagctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagacgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AY090453_X_P-D Feature FT:CDS AY090453_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161150_X_P-D Feature FT:CDS AY161150_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161151_X_P-D Feature FT:CDS AY161151_X_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161152_X_P-D Feature FT:CDS AY161152_X_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161153_X_P-D Feature FT:CDS AY161153_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161154_X_P-D Feature FT:CDS AY161154_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161155_X_P-D Feature FT:CDS AY161155_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161156_X_P-D Feature FT:CDS AY161156_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161157_X_P-D Feature FT:CDS AY161157_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttcttcacctctgcctaa
>gnl|hbvcds|AY161158_X_P-D Feature FT:CDS AY161158_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccctgaggcatgcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggtggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161159_X_P-D Feature FT:CDS AY161159_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161160_X_P-D Feature FT:CDS AY161160_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaaggctgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233291_X_P-D Feature FT:CDS AY233291_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggtctctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233292_X_P-D Feature FT:CDS AY233292_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233294_X_P-D Feature FT:CDS AY233294_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233296_X_P-D Feature FT:CDS AY233296_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY236160_X_P-D Feature FT:CDS AY236160_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY236162_X_P-D Feature FT:CDS AY236162_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY236164_X_P-D Feature FT:CDS AY236164_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY373431_X_P-D Feature FT:CDS AY373431_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY661792_X_P-D Feature FT:CDS AY661792_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaagtattgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY661793_X_P-D Feature FT:CDS AY661793_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaagtattgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721605_X_P-D Feature FT:CDS AY721605_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721606_X_P-D Feature FT:CDS AY721606_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721607_X_P-D Feature FT:CDS AY721607_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721608_X_P-D Feature FT:CDS AY721608_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721609_X_P-D Feature FT:CDS AY721609_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721610_X_P-D Feature FT:CDS AY721610_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FK1.6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgttaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtggcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagattaaaggtctttgtaa
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721611_X_P-D Feature FT:CDS AY721611_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY721612_X_P-D Feature FT:CDS AY721612_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaaagcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY741794_X_P-D Feature FT:CDS AY741794_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY741795_X_P-D Feature FT:CDS AY741795_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY741796_X_P-D Feature FT:CDS AY741796_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY741797_X_P-D Feature FT:CDS AY741797_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccctgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY741798_X_P-D Feature FT:CDS AY741798_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgac
cgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttg
tattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY796030_X_P-D Feature FT:CDS AY796030_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcccgtcgcatggag
accaccgtgaacgcccaccgagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY796031_X_P-D Feature FT:CDS AY796031_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggattttttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacccattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY796032_X_P-D Feature FT:CDS AY796032_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaaccattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY945307_X_P-D Feature FT:CDS AY945307_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ111986_X_P-D Feature FT:CDS DQ111986_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ304547_X_P-D Feature FT:CDS DQ304547_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaaaactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ304548_X_P-D Feature FT:CDS DQ304548_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcaccgctgcctaa
>gnl|hbvcds|DQ304549_X_P-D Feature FT:CDS DQ304549_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ304550_X_P-D Feature FT:CDS DQ304550_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcatctctgccgaa
>gnl|hbvcds|DQ304551_X_P-D Feature FT:CDS DQ304551_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcatctctgccgaa
>gnl|hbvcds|DQ315776_X_P-D Feature FT:CDS DQ315776_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315778_X_P-D Feature FT:CDS DQ315778_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI0388). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctga
>gnl|hbvcds|DQ329356_X_P-D Feature FT:CDS DQ329356_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgcgcgtccgatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttagggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ329357_X_P-D Feature FT:CDS DQ329357_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgcgcgtccgatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttagggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336674_X_P-D Feature FT:CDS DQ336674_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336675_X_P-D Feature FT:CDS DQ336675_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336676_X_P-D Feature FT:CDS DQ336676_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336677_X_P-D Feature FT:CDS DQ336677_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336678_X_P-D Feature FT:CDS DQ336678_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336679_X_P-D Feature FT:CDS DQ336679_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336680_X_P-D Feature FT:CDS DQ336680_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336681_X_P-D Feature FT:CDS DQ336681_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336682_X_P-D Feature FT:CDS DQ336682_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctcagtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactccctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336683_X_P-D Feature FT:CDS DQ336683_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336684_X_P-D Feature FT:CDS DQ336684_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336685_X_P-D Feature FT:CDS DQ336685_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336686_X_P-D Feature FT:CDS DQ336686_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagggctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336687_X_P-D Feature FT:CDS DQ336687_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagggctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336688_X_P-D Feature FT:CDS DQ336688_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagggctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336689_X_P-D Feature FT:CDS DQ336689_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagggctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336690_X_P-D Feature FT:CDS DQ336690_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggggcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ336692_X_P-D Feature FT:CDS DQ336692_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagggctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ399006_X_P-D Feature FT:CDS DQ399006_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate G1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgtcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464168_X_P-D Feature FT:CDS DQ464168_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggccgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464169_X_P-D Feature FT:CDS DQ464169_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggccgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctggacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttagggcatacttcaaagactgtttgtttaaagactgggaagagttggggaaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464170_X_P-D Feature FT:CDS DQ464170_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464172_X_P-D Feature FT:CDS DQ464172_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464173_X_P-D Feature FT:CDS DQ464173_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|DQ464174_X_P-D Feature FT:CDS DQ464174_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctttgcctaa
>gnl|hbvcds|DQ464175_X_P-D Feature FT:CDS DQ464175_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgcgcaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaagggcttacataagaggactattggactctttgcaatgtcaacgaccga
ctttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|DQ464178_X_P-D Feature FT:CDS DQ464178_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccacttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctttgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaantttttcacctctgcctaa
>gnl|hbvcds|DQ464181_X_P-D Feature FT:CDS DQ464181_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagtgtagattaatgatctttgtac
ttggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ464182_X_P-D Feature FT:CDS DQ464182_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ486021_X_P-D Feature FT:CDS DQ486021_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ486022_X_P-D Feature FT:CDS DQ486022_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ486023_X_P-D Feature FT:CDS DQ486023_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatcttccgtccccttctccgtctgccgtttcgcccaaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaagctgtgcagctctcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatatcgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgacgga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagataaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ486025_X_P-D Feature FT:CDS DQ486025_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF103275_X_P-D Feature FT:CDS EF103275_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF103276_X_P-D Feature FT:CDS EF103276_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccggtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatactccaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF103277_X_P-D Feature FT:CDS EF103277_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaaagcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF103279_X_P-D Feature FT:CDS EF103279_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctggtaggctgtgctgccaacgggatcttgcgcgggacgtcctttgtttacgtcccgtgggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
acccccgtgaacgcccaccaattcttgctcaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgttggttttatgactgggaggagtggggggaggagattagattacaggagtttgtat
tagaaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgaagtctgcctaa
>gnl|hbvcds|EF103280_X_P-D Feature FT:CDS EF103280_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgccgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594771_X_P-D Feature FT:CDS EF594771_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0515). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgttaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaagagttgggggaagagattagattaaaggtctttgttt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594772_X_P-D Feature FT:CDS EF594772_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0526). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctga
>gnl|hbvcds|EF594773_X_P-D Feature FT:CDS EF594773_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 05120). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594774_X_P-D Feature FT:CDS EF594774_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0522). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594775_X_P-D Feature FT:CDS EF594775_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0347). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaagcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594776_X_P-D Feature FT:CDS EF594776_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 036). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttagataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU155893_X_P-D Feature FT:CDS EU155893_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaaygaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|EU414135_X_P-D Feature FT:CDS EU414135_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagacygtttgtttaaagactgggaggagttgggggaggagattagattaaagrtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414136_X_P-D Feature FT:CDS EU414136_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414138_X_P-D Feature FT:CDS EU414138_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414139_X_P-D Feature FT:CDS EU414139_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414140_X_P-D Feature FT:CDS EU414140_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaatgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccktgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414141_X_P-D Feature FT:CDS EU414141_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaawgrtstttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414142_X_P-D Feature FT:CDS EU414142_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaakcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagawtagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414143_X_P-D Feature FT:CDS EU414143_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594382_X_P-D Feature FT:CDS EU594382_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594396_X_P-D Feature FT:CDS EU594396_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctatgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594397_X_P-D Feature FT:CDS EU594397_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594398_X_P-D Feature FT:CDS EU594398_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|EU594399_X_P-D Feature FT:CDS EU594399_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594400_X_P-D Feature FT:CDS EU594400_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594401_X_P-D Feature FT:CDS EU594401_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594402_X_P-D Feature FT:CDS EU594402_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594403_X_P-D Feature FT:CDS EU594403_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594404_X_P-D Feature FT:CDS EU594404_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594405_X_P-D Feature FT:CDS EU594405_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594407_X_P-D Feature FT:CDS EU594407_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594408_X_P-D Feature FT:CDS EU594408_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594409_X_P-D Feature FT:CDS EU594409_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594410_X_P-D Feature FT:CDS EU594410_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594411_X_P-D Feature FT:CDS EU594411_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594412_X_P-D Feature FT:CDS EU594412_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594415_X_P-D Feature FT:CDS EU594415_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594416_X_P-D Feature FT:CDS EU594416_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594421_X_P-D Feature FT:CDS EU594421_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594422_X_P-D Feature FT:CDS EU594422_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594423_X_P-D Feature FT:CDS EU594423_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594424_X_P-D Feature FT:CDS EU594424_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594425_X_P-D Feature FT:CDS EU594425_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594426_X_P-D Feature FT:CDS EU594426_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594427_X_P-D Feature FT:CDS EU594427_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594428_X_P-D Feature FT:CDS EU594428_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594430_X_P-D Feature FT:CDS EU594430_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594431_X_P-D Feature FT:CDS EU594431_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594432_X_P-D Feature FT:CDS EU594432_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594433_X_P-D Feature FT:CDS EU594433_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594434_X_P-D Feature FT:CDS EU594434_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttatataagaggactcttggactctctacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaaatggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787436_X_P-D Feature FT:CDS EU787436_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattgaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787437_X_P-D Feature FT:CDS EU787437_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctctgtctaccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787438_X_P-D Feature FT:CDS EU787438_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787439_X_P-D Feature FT:CDS EU787439_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 89). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787440_X_P-D Feature FT:CDS EU787440_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787441_X_P-D Feature FT:CDS EU787441_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787442_X_P-D Feature FT:CDS EU787442_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787443_X_P-D Feature FT:CDS EU787443_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787445_X_P-D Feature FT:CDS EU787445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787446_X_P-D Feature FT:CDS EU787446_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU787447_X_P-D Feature FT:CDS EU787447_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatggtctttgtat
taggagactgtaagcataaattggtctgcgcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU921418_X_P-D Feature FT:CDS EU921418_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttggggctctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgacct
tgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtactag
gaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU921419_X_P-D Feature FT:CDS EU921419_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccgacct
tgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtactag
gaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939680_X_P-D Feature FT:CDS EU939680_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939681_X_P-D Feature FT:CDS EU939681_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349205_X_P-D Feature FT:CDS FJ349205_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349206_X_P-D Feature FT:CDS FJ349206_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349208_X_P-D Feature FT:CDS FJ349208_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349209_X_P-D Feature FT:CDS FJ349209_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349211_X_P-D Feature FT:CDS FJ349211_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H34). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349213_X_P-D Feature FT:CDS FJ349213_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgactgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349214_X_P-D Feature FT:CDS FJ349214_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349215_X_P-D Feature FT:CDS FJ349215_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagactaaaggcctttgtgc
taggaggctgtatggataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349216_X_P-D Feature FT:CDS FJ349216_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349217_X_P-D Feature FT:CDS FJ349217_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H129). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagctccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349218_X_P-D Feature FT:CDS FJ349218_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349219_X_P-D Feature FT:CDS FJ349219_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtac
tcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349220_X_P-D Feature FT:CDS FJ349220_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349228_X_P-D Feature FT:CDS FJ349228_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349229_X_P-D Feature FT:CDS FJ349229_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349230_X_P-D Feature FT:CDS FJ349230_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgcaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349231_X_P-D Feature FT:CDS FJ349231_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactcbctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349232_X_P-D Feature FT:CDS FJ349232_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349233_X_P-D Feature FT:CDS FJ349233_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctgtcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349234_X_P-D Feature FT:CDS FJ349234_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349235_X_P-D Feature FT:CDS FJ349235_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386590_X_P-D Feature FT:CDS FJ386590_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562309_X_P-D Feature FT:CDS FJ562309_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggwctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562338_X_P-D Feature FT:CDS FJ562338_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgaggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacctaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692506_X_P-D Feature FT:CDS FJ692506_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692507_X_P-D Feature FT:CDS FJ692507_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692532_X_P-D Feature FT:CDS FJ692532_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692533_X_P-D Feature FT:CDS FJ692533_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttaggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876242_X_P-D Feature FT:CDS FJ876242_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LCNX48). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggacgatagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876253_X_P-D Feature FT:CDS FJ876253_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHNX26). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876254_X_P-D Feature FT:CDS FJ876254_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHNX45). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagctgggggaggacgatagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876255_X_P-D Feature FT:CDS FJ876255_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHNX69). Partial genome (Contains: HBe, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattataagtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876256_X_P-D Feature FT:CDS FJ876256_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHNX82). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggacgatagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876257_X_P-D Feature FT:CDS FJ876257_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHNX93). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899792_X_P-D Feature FT:CDS FJ899792_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904395_X_P-D Feature FT:CDS FJ904395_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904399_X_P-D Feature FT:CDS FJ904399_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtatttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904402_X_P-D Feature FT:CDS FJ904402_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904410_X_P-D Feature FT:CDS FJ904410_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904412_X_P-D Feature FT:CDS FJ904412_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904415_X_P-D Feature FT:CDS FJ904415_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904418_X_P-D Feature FT:CDS FJ904418_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactcgctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904419_X_P-D Feature FT:CDS FJ904419_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904420_X_P-D Feature FT:CDS FJ904420_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904421_X_P-D Feature FT:CDS FJ904421_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904422_X_P-D Feature FT:CDS FJ904422_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaawtcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904424_X_P-D Feature FT:CDS FJ904424_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904426_X_P-D Feature FT:CDS FJ904426_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagatctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|FJ904427_X_P-D Feature FT:CDS FJ904427_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaacga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaarttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904429_X_P-D Feature FT:CDS FJ904429_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgtataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcayywttttcacctctgcctaa
>gnl|hbvcds|FJ904431_X_P-D Feature FT:CDS FJ904431_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904432_X_P-D Feature FT:CDS FJ904432_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904433_X_C-D Feature FT:CDS FJ904433_X_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcctgggggtctctcgtccccttctctgcctgccgttccgaccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatacaactttttcacctctgcctaa
>gnl|hbvcds|FJ904435_X_P-D Feature FT:CDS FJ904435_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcctggggatctatcgtcctcttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904438_X_P-D Feature FT:CDS FJ904438_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatttttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904439_X_P-D Feature FT:CDS FJ904439_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccctcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgcggttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904443_X_P-D Feature FT:CDS FJ904443_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904445_X_P-D Feature FT:CDS FJ904445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcgtggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904446_X_P-D Feature FT:CDS FJ904446_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ167301_X_P-D Feature FT:CDS GQ167301_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ167302_X_P-D Feature FT:CDS GQ167302_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ctgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183448_X_P-D Feature FT:CDS GQ183448_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183449_X_P-D Feature FT:CDS GQ183449_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183450_X_P-D Feature FT:CDS GQ183450_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183451_X_P-D Feature FT:CDS GQ183451_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183452_X_P-D Feature FT:CDS GQ183452_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183453_X_P-D Feature FT:CDS GQ183453_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183454_X_P-D Feature FT:CDS GQ183454_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183455_X_P-D Feature FT:CDS GQ183455_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183456_X_P-D Feature FT:CDS GQ183456_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183457_X_P-D Feature FT:CDS GQ183457_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183458_X_P-D Feature FT:CDS GQ183458_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183459_X_P-D Feature FT:CDS GQ183459_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183460_X_P-D Feature FT:CDS GQ183460_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtcggtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183461_X_P-D Feature FT:CDS GQ183461_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183462_X_P-D Feature FT:CDS GQ183462_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183463_X_P-D Feature FT:CDS GQ183463_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtgggggagtgagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183464_X_P-D Feature FT:CDS GQ183464_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183465_X_P-D Feature FT:CDS GQ183465_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183466_X_P-D Feature FT:CDS GQ183466_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183467_X_P-D Feature FT:CDS GQ183467_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183468_X_P-D Feature FT:CDS GQ183468_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183469_X_P-D Feature FT:CDS GQ183469_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183470_X_P-D Feature FT:CDS GQ183470_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183471_X_P-D Feature FT:CDS GQ183471_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
caggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183472_X_P-D Feature FT:CDS GQ183472_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183473_X_P-D Feature FT:CDS GQ183473_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183474_X_P-D Feature FT:CDS GQ183474_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183475_X_P-D Feature FT:CDS GQ183475_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183476_X_P-D Feature FT:CDS GQ183476_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acaacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183477_X_P-D Feature FT:CDS GQ183477_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgattgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183478_X_P-D Feature FT:CDS GQ183478_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183479_X_P-D Feature FT:CDS GQ183479_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183480_X_P-D Feature FT:CDS GQ183480_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183481_X_P-D Feature FT:CDS GQ183481_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183482_X_P-D Feature FT:CDS GQ183482_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183483_X_P-D Feature FT:CDS GQ183483_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183484_X_P-D Feature FT:CDS GQ183484_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ183485_X_P-D Feature FT:CDS GQ183485_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ184322_X_P-D Feature FT:CDS GQ184322_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcagactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatatcagaggactcttggactctctgtgatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgattt
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ205380_X_P-D Feature FT:CDS GQ205380_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ205382_X_P-D Feature FT:CDS GQ205382_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaagatcttacataagaggactcttggactctccgcaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ205384_X_P-D Feature FT:CDS GQ205384_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttaggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcgcctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ205385_X_P-D Feature FT:CDS GQ205385_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|GQ205388_X_P-D Feature FT:CDS GQ205388_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctcagcaatgtcaacgaccga
tcttgagccatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ205389_X_P-D Feature FT:CDS GQ205389_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377589_X_P-D Feature FT:CDS GQ377589_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477452_X_P-D Feature FT:CDS GQ477452_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477453_X_P-D Feature FT:CDS GQ477453_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaagagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477454_X_P-D Feature FT:CDS GQ477454_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P68). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|GQ477455_X_P-D Feature FT:CDS GQ477455_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttgaaagactgggaggagtcgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477456_X_P-D Feature FT:CDS GQ477456_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477457_X_P-D Feature FT:CDS GQ477457_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477458_X_P-D Feature FT:CDS GQ477458_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagaatagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477459_X_P-D Feature FT:CDS GQ477459_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ922000_X_P-D Feature FT:CDS GQ922000_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3552). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtyccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccgccaagtcttgcccaaggtcttacataagaggactcttggactctctacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ922001_X_P-D Feature FT:CDS GQ922001_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3654). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccgccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ922002_X_P-D Feature FT:CDS GQ922002_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3624). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccgccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcccaccagcaccatgcaactttttcacctttgcctaa
>gnl|hbvcds|GQ922003_X_P-D Feature FT:CDS GQ922003_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacrtcctttgtttacgtcccctcagcgctgaatcccgcgg
acgacccrtctcggggccgcttgggcccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcatgtcgcatggar
accaccgtgagcgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ922004_X_P-D Feature FT:CDS GQ922004_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3284). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccatctcgrggccgcttgggtccctgtcgtcctcttctctgcctgccgttccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcatgtcgcatggag
accaccgtgagcgcccaccacagcttgcccaaggtcttatataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcccaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ922005_X_P-D Feature FT:CDS GQ922005_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B2894). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcccctgtcgtcctcttctctgcctgccgttccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcatgtcgcatggag
accaccgtgagagcccaccgcagcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaattaaattaaaggtctttgtcc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924652_X_P-D Feature FT:CDS GQ924652_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU357846_X_P-D Feature FT:CDS GU357846_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456635_X_P-D Feature FT:CDS GU456635_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tcggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456636_X_P-D Feature FT:CDS GU456636_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacattttcacctctgcctaa
>gnl|hbvcds|GU456637_X_P-D Feature FT:CDS GU456637_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T49). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactcactgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456638_X_P-D Feature FT:CDS GU456638_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgttt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|GU456639_X_P-D Feature FT:CDS GU456639_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T129). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaatccttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456640_X_P-D Feature FT:CDS GU456640_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456641_X_P-D Feature FT:CDS GU456641_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456642_X_P-D Feature FT:CDS GU456642_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T70). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttggggctctctcgcccccttctccgtctaccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|GU456643_X_P-D Feature FT:CDS GU456643_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctcatccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagagtgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456644_X_P-D Feature FT:CDS GU456644_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T58). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctaccgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacatgagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456645_X_P-D Feature FT:CDS GU456645_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctactccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaagttgtttgttt
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456646_X_P-D Feature FT:CDS GU456646_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456647_X_P-D Feature FT:CDS GU456647_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456648_X_P-D Feature FT:CDS GU456648_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456649_X_P-D Feature FT:CDS GU456649_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456650_X_P-D Feature FT:CDS GU456650_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctgcttcgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctggaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456651_X_P-D Feature FT:CDS GU456651_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactatctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456652_X_P-D Feature FT:CDS GU456652_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctggaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456653_X_P-D Feature FT:CDS GU456653_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456654_X_P-D Feature FT:CDS GU456654_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456655_X_P-D Feature FT:CDS GU456655_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456656_X_P-D Feature FT:CDS GU456656_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456657_X_P-D Feature FT:CDS GU456657_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456658_X_P-D Feature FT:CDS GU456658_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456659_X_P-D Feature FT:CDS GU456659_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456660_X_P-D Feature FT:CDS GU456660_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456661_X_P-D Feature FT:CDS GU456661_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T99). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456662_X_P-D Feature FT:CDS GU456662_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T23). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456663_X_P-D Feature FT:CDS GU456663_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456664_X_P-D Feature FT:CDS GU456664_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456665_X_P-D Feature FT:CDS GU456665_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatcattgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtag
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456666_X_P-D Feature FT:CDS GU456666_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456667_X_P-D Feature FT:CDS GU456667_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T120). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456668_X_P-D Feature FT:CDS GU456668_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcccctactccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456669_X_P-D Feature FT:CDS GU456669_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccgcttctccgtctgccatttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagattgtttgtttaaggactgggaggagtcgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456670_X_P-D Feature FT:CDS GU456670_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaactttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456671_X_P-D Feature FT:CDS GU456671_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T56). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456672_X_P-D Feature FT:CDS GU456672_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T73). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456673_X_P-D Feature FT:CDS GU456673_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456674_X_P-D Feature FT:CDS GU456674_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgaccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacattttcacctctgcctaa
>gnl|hbvcds|GU456675_X_P-D Feature FT:CDS GU456675_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagatatttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456676_X_P-D Feature FT:CDS GU456676_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T98). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggycgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgccaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456677_X_P-D Feature FT:CDS GU456677_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|GU456678_X_P-D Feature FT:CDS GU456678_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactggraggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456679_X_P-D Feature FT:CDS GU456679_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T63). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcgactttttcacctctgcctaa
>gnl|hbvcds|GU456680_X_P-D Feature FT:CDS GU456680_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagagaactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456681_X_P-D Feature FT:CDS GU456681_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456682_X_P-D Feature FT:CDS GU456682_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacggctaccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaattgggggaggagcttagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagtcccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456683_X_P-D Feature FT:CDS GU456683_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU456684_X_P-D Feature FT:CDS GU456684_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaggctagattattgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750151_X_P-D Feature FT:CDS HM750151_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750152_X_P-D Feature FT:CDS HM750152_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate QHN-99). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctactcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750153_X_P-D Feature FT:CDS HM750153_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggtataaattggtctgcgcatcagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750154_X_P-D Feature FT:CDS HM750154_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XGW-23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattggattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750155_X_P-D Feature FT:CDS HM750155_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750156_X_P-D Feature FT:CDS HM750156_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcgaagactgtttgtttaagaactgggaggagtcgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ236014_X_P-D Feature FT:CDS HQ236014_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ236015_X_P-D Feature FT:CDS HQ236015_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ236016_X_P-D Feature FT:CDS HQ236016_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccattccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700439_X_P-D Feature FT:CDS HQ700439_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD03_1999). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700440_X_P-D Feature FT:CDS HQ700440_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaccgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700441_X_P-D Feature FT:CDS HQ700441_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700442_X_P-D Feature FT:CDS HQ700442_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700443_X_P-D Feature FT:CDS HQ700443_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700444_X_P-D Feature FT:CDS HQ700444_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN19_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700445_X_P-D Feature FT:CDS HQ700445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700446_X_P-D Feature FT:CDS HQ700446_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtcttkgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700447_X_P-D Feature FT:CDS HQ700447_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700448_X_P-D Feature FT:CDS HQ700448_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700449_X_P-D Feature FT:CDS HQ700449_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700450_X_P-D Feature FT:CDS HQ700450_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE09_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700451_X_P-D Feature FT:CDS HQ700451_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700453_X_P-D Feature FT:CDS HQ700453_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA35_1984). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700454_X_P-D Feature FT:CDS HQ700454_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgcccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700455_X_P-D Feature FT:CDS HQ700455_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgcccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700458_X_P-D Feature FT:CDS HQ700458_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE35_1997). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggccttatcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcrtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700459_X_P-D Feature FT:CDS HQ700459_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagctccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700463_X_P-D Feature FT:CDS HQ700463_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HI43_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700464_X_P-D Feature FT:CDS HQ700464_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_KA40_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700466_X_P-D Feature FT:CDS HQ700466_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700467_X_P-D Feature FT:CDS HQ700467_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1999). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgtaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700468_X_P-D Feature FT:CDS HQ700468_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI27_1984). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaytagrttaatgatytttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700469_X_P-D Feature FT:CDS HQ700469_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700470_X_P-D Feature FT:CDS HQ700470_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700471_X_P-D Feature FT:CDS HQ700471_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO70_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatcccggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700472_X_P-D Feature FT:CDS HQ700472_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO77_1997). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700473_X_P-D Feature FT:CDS HQ700473_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtygggggaggagattaggttaawggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|HQ700474_X_P-D Feature FT:CDS HQ700474_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaatcgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|HQ700477_X_P-D Feature FT:CDS HQ700477_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1984). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttatat
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700478_X_P-D Feature FT:CDS HQ700478_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1994). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700479_X_P-D Feature FT:CDS HQ700479_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA11_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700480_X_P-D Feature FT:CDS HQ700480_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactatctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700481_X_P-D Feature FT:CDS HQ700481_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactatctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700482_X_P-D Feature FT:CDS HQ700482_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA40_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700483_X_P-D Feature FT:CDS HQ700483_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA120_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggcctcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700484_X_P-D Feature FT:CDS HQ700484_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA229_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700487_X_P-D Feature FT:CDS HQ700487_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TU25_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700488_X_P-D Feature FT:CDS HQ700488_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700489_X_P-D Feature FT:CDS HQ700489_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1999). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700510_X_P-D Feature FT:CDS HQ700510_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_128225_2003). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700511_X_P-D Feature FT:CDS HQ700511_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_164317_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700512_X_P-D Feature FT:CDS HQ700512_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagrttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700513_X_P-D Feature FT:CDS HQ700513_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_16600_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700514_X_P-D Feature FT:CDS HQ700514_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_1664337_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctatgcctaa
>gnl|hbvcds|HQ700553_X_P-D Feature FT:CDS HQ700553_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833465_X_P-D Feature FT:CDS HQ833465_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833466_X_P-D Feature FT:CDS HQ833466_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB26). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggartcgggggaggagamtaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833467_X_P-D Feature FT:CDS HQ833467_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgyaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833468_X_P-D Feature FT:CDS HQ833468_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833469_X_P-D Feature FT:CDS HQ833469_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833470_X_P-D Feature FT:CDS HQ833470_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ833471_X_P-D Feature FT:CDS HQ833471_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctcccatttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754588_X_P-D Feature FT:CDS JF754588_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK61). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaac
gaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagmttagattaaagttgt
ttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754590_X_P-D Feature FT:CDS JF754590_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754591_X_P-D Feature FT:CDS JF754591_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754592_X_P-D Feature FT:CDS JF754592_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggca
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754593_X_P-D Feature FT:CDS JF754593_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK170). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcacacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754594_X_P-D Feature FT:CDS JF754594_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagattgggaggagttgggggaggatagtagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754595_X_P-D Feature FT:CDS JF754595_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754596_X_P-D Feature FT:CDS JF754596_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754597_X_P-D Feature FT:CDS JF754597_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754598_X_P-D Feature FT:CDS JF754598_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK104). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttgggggaggagattagattaaagatytttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754599_X_P-D Feature FT:CDS JF754599_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK173). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754600_X_P-D Feature FT:CDS JF754600_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttcttcgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccatttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754601_X_P-D Feature FT:CDS JF754601_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754602_X_P-D Feature FT:CDS JF754602_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754603_X_P-D Feature FT:CDS JF754603_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttaggggaggagattagattaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754604_X_P-D Feature FT:CDS JF754604_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754605_X_P-D Feature FT:CDS JF754605_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK77). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagrttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754606_X_P-D Feature FT:CDS JF754606_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK73). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcgggggcgcttgggactctctcgtccccttctacgtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754607_X_P-D Feature FT:CDS JF754607_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatacaactttttcacctctgcctaa
>gnl|hbvcds|JF754608_X_P-D Feature FT:CDS JF754608_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK63). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatccattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754609_X_P-D Feature FT:CDS JF754609_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK45). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754610_X_P-D Feature FT:CDS JF754610_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK157). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatccattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754611_X_P-D Feature FT:CDS JF754611_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK152). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctgtcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtrt
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754612_X_P-D Feature FT:CDS JF754612_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK148). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754614_X_P-D Feature FT:CDS JF754614_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754615_X_P-D Feature FT:CDS JF754615_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcctgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactccctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754617_X_P-D Feature FT:CDS JF754617_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatttttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754618_X_P-D Feature FT:CDS JF754618_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK129). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754619_X_P-D Feature FT:CDS JF754619_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatytttgtac
taggaggctgtaggcataaattggtctgcgcaccagaaccmtgcgactttttcacctctgcctaa
>gnl|hbvcds|JF754621_X_P-D Feature FT:CDS JF754621_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK161). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754622_X_P-D Feature FT:CDS JF754622_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754623_X_P-D Feature FT:CDS JF754623_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK171). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754624_X_P-D Feature FT:CDS JF754624_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754625_X_P-D Feature FT:CDS JF754625_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK25). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcactgaatcccgcgg
acgatccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcctggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|JF754626_X_P-D Feature FT:CDS JF754626_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaattgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754627_X_P-D Feature FT:CDS JF754627_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754628_X_P-D Feature FT:CDS JF754628_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754629_X_P-D Feature FT:CDS JF754629_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK176). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagatatttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcgactttttcacctctgcctaa
>gnl|hbvcds|JF754630_X_P-D Feature FT:CDS JF754630_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK175). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttatcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatctttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754631_X_P-D Feature FT:CDS JF754631_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754632_X_P-D Feature FT:CDS JF754632_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK186). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagactgaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcgactttttcacctctgcctaa
>gnl|hbvcds|JF754633_X_P-D Feature FT:CDS JF754633_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK128). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatccattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754634_X_P-D Feature FT:CDS JF754634_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctmcgtctgccgtttcgaccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF754635_X_P-D Feature FT:CDS JF754635_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911682_X_P-D Feature FT:CDS JF911682_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BA81). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcttgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911683_X_P-D Feature FT:CDS JF911683_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BA79). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtaacatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtcc
taggaggctgtaggcataaatttgtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911685_X_P-D Feature FT:CDS JF911685_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BA76). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911687_X_P-D Feature FT:CDS JF911687_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BA46). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgacctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF911690_X_P-D Feature FT:CDS JF911690_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BA47). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtcccctactccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040750_X_P-D Feature FT:CDS JN040750_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919078). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgtttgcccaaggtcttacataagaggactcttggactccctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040751_X_P-D Feature FT:CDS JN040751_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919047). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtttgcgcaccagcaccatgcaagtttttcacctctgcctaa
>gnl|hbvcds|JN040752_X_P-D Feature FT:CDS JN040752_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919033). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagattagattaatgatctatgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040753_X_P-D Feature FT:CDS JN040753_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919064). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctcactctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcatcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040754_X_P-D Feature FT:CDS JN040754_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919045). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040755_X_P-D Feature FT:CDS JN040755_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919086). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040756_X_P-D Feature FT:CDS JN040756_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919039). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccggcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040757_X_P-D Feature FT:CDS JN040757_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919056). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagcggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040758_X_P-D Feature FT:CDS JN040758_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919037). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040759_X_P-D Feature FT:CDS JN040759_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919063). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040760_X_P-D Feature FT:CDS JN040760_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919059). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040761_X_P-D Feature FT:CDS JN040761_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctggaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040762_X_P-D Feature FT:CDS JN040762_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattacaggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|JN040765_X_P-D Feature FT:CDS JN040765_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040766_X_P-D Feature FT:CDS JN040766_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgccaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040767_X_P-D Feature FT:CDS JN040767_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040768_X_P-D Feature FT:CDS JN040768_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919051). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040769_X_P-D Feature FT:CDS JN040769_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919015). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040770_X_P-D Feature FT:CDS JN040770_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040771_X_P-D Feature FT:CDS JN040771_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919013). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040772_X_P-D Feature FT:CDS JN040772_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919065). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040773_X_P-D Feature FT:CDS JN040773_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919084). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaactgggggaggagcttagattagagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040774_X_P-D Feature FT:CDS JN040774_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919088). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagttgtttgttt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaa
>gnl|hbvcds|JN040775_X_P-D Feature FT:CDS JN040775_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919049). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040776_X_P-D Feature FT:CDS JN040776_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919043). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcgactttttcacctctgcctaa
>gnl|hbvcds|JN040777_X_P-D Feature FT:CDS JN040777_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccatttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040778_X_P-D Feature FT:CDS JN040778_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919038). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040779_X_P-D Feature FT:CDS JN040779_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919070). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgtccctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040780_X_P-D Feature FT:CDS JN040780_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919072). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040781_X_P-D Feature FT:CDS JN040781_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919029). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040782_X_P-D Feature FT:CDS JN040782_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919041). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtcccctcatccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagaatgggaggaattgggggaggagaatagattaatggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040783_X_P-D Feature FT:CDS JN040783_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040784_X_P-D Feature FT:CDS JN040784_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919030). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040785_X_P-D Feature FT:CDS JN040785_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040786_X_P-D Feature FT:CDS JN040786_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919035). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctgtgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040787_X_P-D Feature FT:CDS JN040787_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919040). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctgtgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040788_X_P-D Feature FT:CDS JN040788_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919024). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctgtgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040790_X_P-D Feature FT:CDS JN040790_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919054). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040791_X_P-D Feature FT:CDS JN040791_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919082). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040792_X_P-D Feature FT:CDS JN040792_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919079). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040793_X_P-D Feature FT:CDS JN040793_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919083). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040794_X_P-D Feature FT:CDS JN040794_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919075). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactatctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040795_X_P-D Feature FT:CDS JN040795_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919003). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagttctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040796_X_P-D Feature FT:CDS JN040796_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactctcggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaa
>gnl|hbvcds|JN040797_X_P-D Feature FT:CDS JN040797_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040799_X_P-D Feature FT:CDS JN040799_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919080). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040800_X_P-D Feature FT:CDS JN040800_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919012). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040801_X_P-D Feature FT:CDS JN040801_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919042). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040802_X_P-D Feature FT:CDS JN040802_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgagcgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagattgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040804_X_P-D Feature FT:CDS JN040804_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919028). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040805_X_P-D Feature FT:CDS JN040805_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919058). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactcactgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040806_X_P-D Feature FT:CDS JN040806_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919066). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040807_X_P-D Feature FT:CDS JN040807_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919034). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040808_X_P-D Feature FT:CDS JN040808_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040809_X_P-D Feature FT:CDS JN040809_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgttatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040810_X_P-D Feature FT:CDS JN040810_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919060). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040811_X_P-D Feature FT:CDS JN040811_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacccccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattacatttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040812_X_P-D Feature FT:CDS JN040812_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919027). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040813_X_P-D Feature FT:CDS JN040813_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919025). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttcttcgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040814_X_P-D Feature FT:CDS JN040814_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040815_X_P-D Feature FT:CDS JN040815_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919073). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040816_X_P-D Feature FT:CDS JN040816_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919016). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040817_X_P-D Feature FT:CDS JN040817_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919020). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040818_X_P-D Feature FT:CDS JN040818_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919081). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040819_X_P-D Feature FT:CDS JN040819_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919067). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggattggggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040820_X_P-D Feature FT:CDS JN040820_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919010). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtccaccgtttcgtccgaccacggggcgcaactct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040821_X_P-D Feature FT:CDS JN040821_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919085). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040822_X_P-D Feature FT:CDS JN040822_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919044). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttcaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactcggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040823_X_P-D Feature FT:CDS JN040823_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919005). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040824_X_P-D Feature FT:CDS JN040824_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919071). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaagtcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggatattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040826_X_P-D Feature FT:CDS JN040826_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919055). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtcttccgtttcgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040828_X_P-D Feature FT:CDS JN040828_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919069). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcttggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagtttagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040829_X_P-D Feature FT:CDS JN040829_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN040830_X_P-D Feature FT:CDS JN040830_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919052). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|JN257148_X_P-D Feature FT:CDS JN257148_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMF). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257149_X_P-D Feature FT:CDS JN257149_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSFN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccktctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagytgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257150_X_P-D Feature FT:CDS JN257150_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABS). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagabtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257151_X_P-D Feature FT:CDS JN257151_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHHR). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257152_X_P-D Feature FT:CDS JN257152_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRJB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257153_X_P-D Feature FT:CDS JN257153_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttgggactctmtcgtcccctymtccgtctgccgtttcgcccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtactgccaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257155_X_P-D Feature FT:CDS JN257155_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJHM1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257159_X_P-D Feature FT:CDS JN257159_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMRW). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtcccctcctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactkcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccgacct
tgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattamagttgtttgtattag
gaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257160_X_P-D Feature FT:CDS JN257160_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257161_X_P-D Feature FT:CDS JN257161_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257162_X_P-D Feature FT:CDS JN257162_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSDQ). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctrcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgyctgccgtttcaaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagrttamwgatmtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257163_X_P-D Feature FT:CDS JN257163_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAZI). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257165_X_P-D Feature FT:CDS JN257165_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257166_X_P-D Feature FT:CDS JN257166_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL2). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257167_X_P-D Feature FT:CDS JN257167_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHMM1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctatcgtccccttmtacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaccgcccaccarttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|JN257169_X_P-D Feature FT:CDS JN257169_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAFF). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257170_X_P-D Feature FT:CDS JN257170_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJWB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcctaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagacctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257171_X_P-D Feature FT:CDS JN257171_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
cctggaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257172_X_P-D Feature FT:CDS JN257172_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcdtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtamtgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257173_X_P-D Feature FT:CDS JN257173_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcdtcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtamtgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257176_X_P-D Feature FT:CDS JN257176_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaattgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257177_X_P-D Feature FT:CDS JN257177_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaattgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctak
>gnl|hbvcds|JN257178_X_P-D Feature FT:CDS JN257178_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHTRK). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|JN257179_X_P-D Feature FT:CDS JN257179_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMJD1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaccgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaawggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257181_X_P-D Feature FT:CDS JN257181_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHNDA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257182_X_P-D Feature FT:CDS JN257182_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMSL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257183_X_P-D Feature FT:CDS JN257183_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacaatgcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257185_X_P-D Feature FT:CDS JN257185_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257187_X_P-D Feature FT:CDS JN257187_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL1). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccattacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatytttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257188_X_P-D Feature FT:CDS JN257188_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccattacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatytttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257190_X_P-D Feature FT:CDS JN257190_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHYHY). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctccgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|JN257193_X_P-D Feature FT:CDS JN257193_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257194_X_P-D Feature FT:CDS JN257194_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257195_X_P-D Feature FT:CDS JN257195_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgcccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtactgccaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257196_X_P-D Feature FT:CDS JN257196_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABR1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257199_X_P-D Feature FT:CDS JN257199_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSOD2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257200_X_P-D Feature FT:CDS JN257200_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMNM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgamcgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257201_X_P-D Feature FT:CDS JN257201_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFAD). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257202_X_P-D Feature FT:CDS JN257202_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSLI). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtktacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaatgcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257203_X_P-D Feature FT:CDS JN257203_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctstgcaatgtcaacgaccga
ccttgaggcatacttyaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagktstttgtat
taggaggctgtaggcataaattggtstgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257205_X_P-D Feature FT:CDS JN257205_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatatcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257209_X_P-D Feature FT:CDS JN257209_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMR2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257211_X_P-D Feature FT:CDS JN257211_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHBRH1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgamcgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcccctctgcctat
>gnl|hbvcds|JN257214_X_P-D Feature FT:CDS JN257214_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctmtcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN257215_X_P-D Feature FT:CDS JN257215_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctmtcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN574723_X_P-D Feature FT:CDS JN574723_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FPX4). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN574725_X_P-D Feature FT:CDS JN574725_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FPX6). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN574728_X_P-D Feature FT:CDS JN574728_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FPX9). Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|JN574729_X_P-D Feature FT:CDS JN574729_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FPX21). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642126_X_P-D Feature FT:CDS JN642126_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagttaagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642128_X_P-D Feature FT:CDS JN642128_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgatgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgcccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642129_X_P-D Feature FT:CDS JN642129_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642130_X_P-D Feature FT:CDS JN642130_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642131_X_P-D Feature FT:CDS JN642131_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagcgaactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642132_X_P-D Feature FT:CDS JN642132_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642133_X_P-D Feature FT:CDS JN642133_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaccgcccaccagttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642134_X_P-D Feature FT:CDS JN642134_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642135_X_P-D Feature FT:CDS JN642135_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagaccgtttgtttaaggactgggaggagttgggggaggagcttagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|JN642136_X_P-D Feature FT:CDS JN642136_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccattcaactttttcacctctgcctaa
>gnl|hbvcds|JN642138_X_P-D Feature FT:CDS JN642138_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642140_X_P-D Feature FT:CDS JN642140_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642142_X_P-D Feature FT:CDS JN642142_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaatccttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642143_X_P-D Feature FT:CDS JN642143_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctccgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|JN642144_X_P-D Feature FT:CDS JN642144_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcacgtccccttctccgtctgcggtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctccgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|JN642145_X_P-D Feature FT:CDS JN642145_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642146_X_P-D Feature FT:CDS JN642146_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctcagtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|JN642147_X_P-D Feature FT:CDS JN642147_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaatctttcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagttgggggaggaacttagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642148_X_P-D Feature FT:CDS JN642148_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaaccgccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642149_X_P-D Feature FT:CDS JN642149_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642150_X_P-D Feature FT:CDS JN642150_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatcattgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacgcttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642151_X_P-D Feature FT:CDS JN642151_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcatcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642153_X_P-D Feature FT:CDS JN642153_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccactgtttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642154_X_P-D Feature FT:CDS JN642154_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642155_X_P-D Feature FT:CDS JN642155_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb49). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642156_X_P-D Feature FT:CDS JN642156_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642157_X_P-D Feature FT:CDS JN642157_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaggttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642158_X_P-D Feature FT:CDS JN642158_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctatcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtattgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642159_X_P-D Feature FT:CDS JN642159_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642161_X_P-D Feature FT:CDS JN642161_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaatgcctgcccaaggtcttacataagaggactcttggactctctgtaatgtcaaccgccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642162_X_P-D Feature FT:CDS JN642162_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb58). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctcacgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642163_X_P-D Feature FT:CDS JN642163_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctcacgtccccttctccgtctgctgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctccgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642164_X_P-D Feature FT:CDS JN642164_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb60). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642165_X_P-D Feature FT:CDS JN642165_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctgtgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642166_X_P-D Feature FT:CDS JN642166_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaccgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN642167_X_P-D Feature FT:CDS JN642167_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664909_X_P-D Feature FT:CDS JN664909_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB36_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctgtcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttagcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664910_X_P-D Feature FT:CDS JN664910_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB43_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664911_X_P-D Feature FT:CDS JN664911_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB47_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664912_X_P-D Feature FT:CDS JN664912_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB49_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664913_X_P-D Feature FT:CDS JN664913_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN01_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctatcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacgctgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664914_X_P-D Feature FT:CDS JN664914_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN48_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664917_X_P-D Feature FT:CDS JN664917_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SKR_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664918_X_P-D Feature FT:CDS JN664918_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2198_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664919_X_P-D Feature FT:CDS JN664919_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2320_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctcacgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664920_X_P-D Feature FT:CDS JN664920_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1903_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664921_X_P-D Feature FT:CDS JN664921_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN47_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664922_X_P-D Feature FT:CDS JN664922_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664924_X_P-D Feature FT:CDS JN664924_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN32_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgatccttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctccggaaagcttgagctcttctttttcacctctgcctaa
>gnl|hbvcds|JN664926_X_P-D Feature FT:CDS JN664926_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN63_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgatcga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664927_X_P-D Feature FT:CDS JN664927_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE20_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664928_X_P-D Feature FT:CDS JN664928_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE27_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664930_X_P-D Feature FT:CDS JN664930_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEN9_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664931_X_P-D Feature FT:CDS JN664931_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB6_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtcccaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggtctcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664932_X_P-D Feature FT:CDS JN664932_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2235_CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664936_X_P-D Feature FT:CDS JN664936_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate E3529_LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664937_X_P-D Feature FT:CDS JN664937_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN45_LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664938_X_P-D Feature FT:CDS JN664938_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN46_LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664939_X_P-D Feature FT:CDS JN664939_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN71_LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664941_X_P-D Feature FT:CDS JN664941_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB21_LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttcttcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN664947_X_P-D Feature FT:CDS JN664947_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB41_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctcggtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaagatcttatataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatactttcaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|JN664948_X_P-D Feature FT:CDS JN664948_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN64_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccgtgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688678_X_P-D Feature FT:CDS JN688678_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV007). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcgactttttcacctctgcctaa
>gnl|hbvcds|JN688679_X_P-D Feature FT:CDS JN688679_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV010). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688683_X_P-D Feature FT:CDS JN688683_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV087). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtrctgccaactggatcctkcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccytctcggggycgcttgggactctctcgtccccttctccgtctgccgttccrrccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgrttcacctctgcacgtcggatggag
accaccgtgaacgcccatcaaatcttgcccaaggtcttacataagaggactcttggactttcaggaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688685_X_P-D Feature FT:CDS JN688685_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV097). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttatatragaggactcttggactctctgcaatgtcracgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688695_X_P-D Feature FT:CDS JN688695_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV128). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtay
taggaggctgtaggcataaattggtttgcgcaccagcaacatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688708_X_P-D Feature FT:CDS JN688708_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV142). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccytctcggggycgcttgggactytctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaycaaatcytgcccaaggtcttayataagaggactcttgaactctttgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagnttattgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688710_X_P-D Feature FT:CDS JN688710_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV144). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctttgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtttgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688711_X_P-D Feature FT:CDS JN688711_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctttacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtttgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688712_X_P-D Feature FT:CDS JN688712_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV163). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgggg
accaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN688713_X_P-D Feature FT:CDS JN688713_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV173). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcatcatgtcgaatg
gagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactctkggactctctgcaatgtcaacgac
cgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtagattaatgatctttg
tactaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|JN688722_X_P-D Feature FT:CDS JN688722_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV228). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactststgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|JN792903_X_P-D Feature FT:CDS JN792903_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 310000127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792904_X_P-D Feature FT:CDS JN792904_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002943). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttatataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagattgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792905_X_P-D Feature FT:CDS JN792905_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000345). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792906_X_P-D Feature FT:CDS JN792906_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002958). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792907_X_P-D Feature FT:CDS JN792907_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000473). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792908_X_P-D Feature FT:CDS JN792908_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002951). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgaccattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgac
cgaccttgaggcatacttcaaagactgtttgtttaaagaatgggaggatttgggggaggagcttagattaaaggtctttg
tactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792909_X_P-D Feature FT:CDS JN792909_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000479). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792910_X_P-D Feature FT:CDS JN792910_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 109001205). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792911_X_P-D Feature FT:CDS JN792911_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002952). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctatcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaaagctcatcaatgcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792912_X_P-D Feature FT:CDS JN792912_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 307000449). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ032005_X_P-D Feature FT:CDS JQ032005_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M16). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggttcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttggat
taggaggatgtaagcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ032006_X_P-D Feature FT:CDS JQ032006_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M17). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccacggggtacctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgccatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattacaggtgtttgtat
taggaggctgtaggaatatcttggtctgcgcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|JQ032007_X_P-D Feature FT:CDS JQ032007_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M23). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ272897_X_P-D Feature FT:CDS JQ272897_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_MDQ10). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ518361_X_P-D Feature FT:CDS JQ518361_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttatccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ687530_X_P-D Feature FT:CDS JQ687530_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 200). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaagagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccaccgccatgcaattttttcacctctgcctaa
>gnl|hbvcds|JQ687531_X_P-D Feature FT:CDS JQ687531_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 205). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtcattgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707476_X_P-D Feature FT:CDS JQ707476_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707477_X_P-D Feature FT:CDS JQ707477_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C11). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707478_X_P-D Feature FT:CDS JQ707478_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707479_X_P-D Feature FT:CDS JQ707479_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707480_X_P-D Feature FT:CDS JQ707480_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707481_X_P-D Feature FT:CDS JQ707481_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707482_X_P-D Feature FT:CDS JQ707482_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C17-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707483_X_P-D Feature FT:CDS JQ707483_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707484_X_P-D Feature FT:CDS JQ707484_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C19). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707485_X_P-D Feature FT:CDS JQ707485_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707486_X_P-D Feature FT:CDS JQ707486_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707487_X_P-D Feature FT:CDS JQ707487_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707488_X_P-D Feature FT:CDS JQ707488_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707489_X_P-D Feature FT:CDS JQ707489_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707490_X_P-D Feature FT:CDS JQ707490_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707491_X_P-D Feature FT:CDS JQ707491_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707492_X_P-D Feature FT:CDS JQ707492_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C30). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707493_X_P-D Feature FT:CDS JQ707493_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggccgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707494_X_P-D Feature FT:CDS JQ707494_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707495_X_P-D Feature FT:CDS JQ707495_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C33). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707496_X_P-D Feature FT:CDS JQ707496_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C34-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707497_X_P-D Feature FT:CDS JQ707497_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcacagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707498_X_P-D Feature FT:CDS JQ707498_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C37). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707499_X_P-D Feature FT:CDS JQ707499_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707500_X_P-D Feature FT:CDS JQ707500_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707501_X_P-D Feature FT:CDS JQ707501_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C41). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707502_X_P-D Feature FT:CDS JQ707502_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707503_X_P-D Feature FT:CDS JQ707503_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707504_X_P-D Feature FT:CDS JQ707504_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C44). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707505_X_P-D Feature FT:CDS JQ707505_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707506_X_P-D Feature FT:CDS JQ707506_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C46). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707507_X_P-D Feature FT:CDS JQ707507_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707508_X_P-D Feature FT:CDS JQ707508_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttcttcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707509_X_P-D Feature FT:CDS JQ707509_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C7). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatactgcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707510_X_P-D Feature FT:CDS JQ707510_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C8). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcggtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaaggtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatcaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707511_X_P-D Feature FT:CDS JQ707511_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C9). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707512_X_P-D Feature FT:CDS JQ707512_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C1-22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707513_X_P-D Feature FT:CDS JQ707513_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707514_X_P-D Feature FT:CDS JQ707514_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707515_X_P-D Feature FT:CDS JQ707515_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707516_X_P-D Feature FT:CDS JQ707516_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707517_X_P-D Feature FT:CDS JQ707517_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707518_X_P-D Feature FT:CDS JQ707518_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C17-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707519_X_P-D Feature FT:CDS JQ707519_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707520_X_P-D Feature FT:CDS JQ707520_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707521_X_P-D Feature FT:CDS JQ707521_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707522_X_P-D Feature FT:CDS JQ707522_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707523_X_P-D Feature FT:CDS JQ707523_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707524_X_P-D Feature FT:CDS JQ707524_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707525_X_P-D Feature FT:CDS JQ707525_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707526_X_P-D Feature FT:CDS JQ707526_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttccgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707527_X_P-D Feature FT:CDS JQ707527_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707528_X_P-D Feature FT:CDS JQ707528_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707529_X_P-D Feature FT:CDS JQ707529_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707530_X_P-D Feature FT:CDS JQ707530_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcgctcgtccccttctctgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagattacaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707682_X_P-D Feature FT:CDS JQ707682_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707683_X_P-D Feature FT:CDS JQ707683_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707684_X_P-D Feature FT:CDS JQ707684_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707685_X_P-D Feature FT:CDS JQ707685_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707686_X_P-D Feature FT:CDS JQ707686_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707687_X_P-D Feature FT:CDS JQ707687_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707688_X_P-D Feature FT:CDS JQ707688_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcccctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707689_X_P-D Feature FT:CDS JQ707689_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707690_X_P-D Feature FT:CDS JQ707690_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707691_X_P-D Feature FT:CDS JQ707691_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707692_X_P-D Feature FT:CDS JQ707692_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707693_X_P-D Feature FT:CDS JQ707693_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707694_X_P-D Feature FT:CDS JQ707694_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707695_X_P-D Feature FT:CDS JQ707695_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707696_X_P-D Feature FT:CDS JQ707696_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707697_X_P-D Feature FT:CDS JQ707697_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707698_X_P-D Feature FT:CDS JQ707698_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707699_X_P-D Feature FT:CDS JQ707699_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707700_X_P-D Feature FT:CDS JQ707700_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_36-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707701_X_P-D Feature FT:CDS JQ707701_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707702_X_P-D Feature FT:CDS JQ707702_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707703_X_P-D Feature FT:CDS JQ707703_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctgtcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707704_X_P-D Feature FT:CDS JQ707704_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707705_X_P-D Feature FT:CDS JQ707705_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707706_X_P-D Feature FT:CDS JQ707706_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_8-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ927384_X_P-D Feature FT:CDS JQ927384_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KM2109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcgaggccgcttgggactctaccgtcccctkctacgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096954_X_P-D Feature FT:CDS JX096954_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1-3242). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtcc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096955_X_P-D Feature FT:CDS JX096955_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2-3051). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096956_X_P-D Feature FT:CDS JX096956_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5-6154). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096957_X_P-D Feature FT:CDS JX096957_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6-2646). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagaccgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096958_X_P-D Feature FT:CDS JX096958_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7-1276). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX470760_X_P-D Feature FT:CDS JX470760_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H-IDU6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX898689_X_P-D Feature FT:CDS JX898689_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX898691_X_P-D Feature FT:CDS JX898691_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX898692_X_P-D Feature FT:CDS JX898692_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX898694_X_P-D Feature FT:CDS JX898694_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX898697_X_P-D Feature FT:CDS JX898697_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtsctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgcatgttggccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC012652_X_P-D Feature FT:CDS KC012652_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttttac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774436_X_P-D Feature FT:CDS KC774436_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1008). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccggctgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774437_X_P-D Feature FT:CDS KC774437_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774440_X_P-D Feature FT:CDS KC774440_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1028). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774444_X_P-D Feature FT:CDS KC774444_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1038). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccggcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagcggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774445_X_P-D Feature FT:CDS KC774445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1040). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgttaggctgtgctgccaactggatcgtgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggattctcttgtccctttgtccgtttgccgtttcgtcggaccccggggcgcacctct
ctttacgcggactccccgtttgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtggcatggag
accaccgtgaacgcccaccaattcttgcccaaggtattacataagaggactcttggactcttcgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774459_X_P-D Feature FT:CDS KC774459_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1111). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagctgggggaggagattagattaatggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774460_X_P-D Feature FT:CDS KC774460_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1112). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttccaggggccggctgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774462_X_P-D Feature FT:CDS KC774462_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxa2047). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaatgtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774477_X_P-D Feature FT:CDS KC774477_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxn1031). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcttgtccccttctccgtctgccgtttcgtccgaccccggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattctttcccaaggtcttacataagaggactcttggactctttgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttcaggactgggaggagttgggggaggagaatagatttaaggtctttgtat
taggaggctgtaggcataaaatggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875275_X_P-D Feature FT:CDS KC875275_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV39). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875276_X_P-D Feature FT:CDS KC875276_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaatgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875277_X_P-D Feature FT:CDS KC875277_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875278_X_P-D Feature FT:CDS KC875278_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattagtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875279_X_P-D Feature FT:CDS KC875279_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaacgttttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875280_X_P-D Feature FT:CDS KC875280_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875281_X_P-D Feature FT:CDS KC875281_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875282_X_P-D Feature FT:CDS KC875282_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accagcgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875283_X_P-D Feature FT:CDS KC875283_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875284_X_P-D Feature FT:CDS KC875284_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaatgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875285_X_P-D Feature FT:CDS KC875285_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875286_X_P-D Feature FT:CDS KC875286_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacgtct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875287_X_P-D Feature FT:CDS KC875287_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875288_X_P-D Feature FT:CDS KC875288_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875289_X_P-D Feature FT:CDS KC875289_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875290_X_P-D Feature FT:CDS KC875290_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875291_X_P-D Feature FT:CDS KC875291_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875292_X_P-D Feature FT:CDS KC875292_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875293_X_P-D Feature FT:CDS KC875293_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV69). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875294_X_P-D Feature FT:CDS KC875294_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV70). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875295_X_P-D Feature FT:CDS KC875295_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV81). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875296_X_P-D Feature FT:CDS KC875296_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875297_X_P-D Feature FT:CDS KC875297_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875298_X_P-D Feature FT:CDS KC875298_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV76). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875299_X_P-D Feature FT:CDS KC875299_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875300_X_P-D Feature FT:CDS KC875300_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875301_X_P-D Feature FT:CDS KC875301_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875302_X_P-D Feature FT:CDS KC875302_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875303_X_P-D Feature FT:CDS KC875303_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875304_X_P-D Feature FT:CDS KC875304_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacccggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875305_X_P-D Feature FT:CDS KC875305_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875306_X_P-D Feature FT:CDS KC875306_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875307_X_P-D Feature FT:CDS KC875307_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV74). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875308_X_P-D Feature FT:CDS KC875308_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV72). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875309_X_P-D Feature FT:CDS KC875309_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875310_X_P-D Feature FT:CDS KC875310_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875311_X_P-D Feature FT:CDS KC875311_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccgtctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875312_X_P-D Feature FT:CDS KC875312_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctgtgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875313_X_P-D Feature FT:CDS KC875313_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875314_X_P-D Feature FT:CDS KC875314_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875315_X_P-D Feature FT:CDS KC875315_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccggcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tacgaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875316_X_P-D Feature FT:CDS KC875316_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttgtcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
tcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875317_X_P-D Feature FT:CDS KC875317_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875318_X_P-D Feature FT:CDS KC875318_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV40). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctacgtctgccgttccgaccgaccacggggcgcacctct
ctttacacggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875319_X_P-D Feature FT:CDS KC875319_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875320_X_P-D Feature FT:CDS KC875320_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875321_X_P-D Feature FT:CDS KC875321_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875322_X_P-D Feature FT:CDS KC875322_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875323_X_P-D Feature FT:CDS KC875323_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875324_X_P-D Feature FT:CDS KC875324_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaagtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875325_X_P-D Feature FT:CDS KC875325_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875326_X_P-D Feature FT:CDS KC875326_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV37). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875328_X_P-D Feature FT:CDS KC875328_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875329_X_P-D Feature FT:CDS KC875329_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875330_X_P-D Feature FT:CDS KC875330_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV87). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875331_X_P-D Feature FT:CDS KC875331_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875332_X_P-D Feature FT:CDS KC875332_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875333_X_P-D Feature FT:CDS KC875333_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875334_X_P-D Feature FT:CDS KC875334_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875335_X_P-D Feature FT:CDS KC875335_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875336_X_P-D Feature FT:CDS KC875336_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875337_X_P-D Feature FT:CDS KC875337_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875340_X_P-D Feature FT:CDS KC875340_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KC875341_X_P-D Feature FT:CDS KC875341_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV67). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KC875342_X_P-D Feature FT:CDS KC875342_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgaaatcttgcccaagatcttatataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KF018197_X_P-D Feature FT:CDS KF018197_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF018208_X_P-D Feature FT:CDS KF018208_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF018210_X_P-D Feature FT:CDS KF018210_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataaaaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF018211_X_P-D Feature FT:CDS KF018211_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF061167_X_P-D Feature FT:CDS KF061167_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_1a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataattgggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KF061168_X_P-D Feature FT:CDS KF061168_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_3a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataattgggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF061169_X_P-D Feature FT:CDS KF061169_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_7a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataattgggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF061170_X_P-D Feature FT:CDS KF061170_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_13a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF170739_X_P-D Feature FT:CDS KF170739_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SDAC_024). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattagattacagttgtttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF192830_X_P-D Feature FT:CDS KF192830_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF192831_X_P-D Feature FT:CDS KF192831_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF192832_X_P-D Feature FT:CDS KF192832_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF192834_X_P-D Feature FT:CDS KF192834_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP63). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471640_X_P-D Feature FT:CDS KF471640_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471641_X_P-D Feature FT:CDS KF471641_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-66). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctcagtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattagaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471642_X_P-D Feature FT:CDS KF471642_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatacgactttttcacctctgcctaa
>gnl|hbvcds|KF471644_X_P-D Feature FT:CDS KF471644_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|KF471645_X_P-D Feature FT:CDS KF471645_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-50). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccatgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471646_X_P-D Feature FT:CDS KF471646_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttactatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471647_X_P-D Feature FT:CDS KF471647_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471649_X_P-D Feature FT:CDS KF471649_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471650_X_P-D Feature FT:CDS KF471650_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471652_X_P-D Feature FT:CDS KF471652_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-20). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
tatgaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471653_X_P-D Feature FT:CDS KF471653_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-18). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacggctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471654_X_P-D Feature FT:CDS KF471654_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471655_X_P-D Feature FT:CDS KF471655_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471656_X_P-D Feature FT:CDS KF471656_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471657_X_P-D Feature FT:CDS KF471657_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471658_X_P-D Feature FT:CDS KF471658_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG_4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagtggggagaggagtttagacttatgtgctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471659_X_P-D Feature FT:CDS KF471659_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF471660_X_P-D Feature FT:CDS KF471660_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccgg
ccttgaggcatacttcaaagactgtttgcttaaagactgggaggagttgggggaggagagtagactttgtctatttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584160_X_P-D Feature FT:CDS KF584160_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584161_X_P-D Feature FT:CDS KF584161_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584162_X_P-D Feature FT:CDS KF584162_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584163_X_P-D Feature FT:CDS KF584163_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584164_X_P-D Feature FT:CDS KF584164_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584165_X_P-D Feature FT:CDS KF584165_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Da). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF584166_X_P-D Feature FT:CDS KF584166_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Db). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679989_X_P-D Feature FT:CDS KF679989_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-49). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679990_X_P-D Feature FT:CDS KF679990_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgtttgggactctcacgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679992_X_P-D Feature FT:CDS KF679992_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679993_X_P-D Feature FT:CDS KF679993_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679994_X_P-D Feature FT:CDS KF679994_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679995_X_P-D Feature FT:CDS KF679995_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctgcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagattgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679996_X_P-D Feature FT:CDS KF679996_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679997_X_P-D Feature FT:CDS KF679997_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF679998_X_P-D Feature FT:CDS KF679998_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-63). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922432_X_P-D Feature FT:CDS KF922432_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate N011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ470885_X_P-D Feature FT:CDS KJ470885_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8136). Partial genome (Contains: HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctatcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|KJ470889_X_P-D Feature FT:CDS KJ470889_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8034). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|KJ470893_X_P-D Feature FT:CDS KJ470893_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8118). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ470894_X_P-D Feature FT:CDS KJ470894_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8066). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccttgcctaa
>gnl|hbvcds|KJ470895_X_P-D Feature FT:CDS KJ470895_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8120). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccttgcctaa
>gnl|hbvcds|KJ470896_X_P-D Feature FT:CDS KJ470896_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaytagattaaaggtgtttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ647350_X_P-D Feature FT:CDS KJ647350_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV197). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tcggaggctgtaggcataaattggtttgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ647352_X_P-D Feature FT:CDS KJ647352_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV219). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttggggctctctcgtcctcttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ647353_X_P-D Feature FT:CDS KJ647353_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV230). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcgaggtcgcttgggactctctcgtccccttctccgtctgccgttccrsccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtygcatggag
accaccgtgaacgcccaycaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ647355_X_P-D Feature FT:CDS KJ647355_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV247). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttgacctctttgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtttgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843187_X_P-D Feature FT:CDS KJ843187_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ag26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997852_X_P-D Feature FT:CDS KJ997852_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997853_X_P-D Feature FT:CDS KJ997853_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997854_X_P-D Feature FT:CDS KJ997854_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcgcttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997855_X_P-D Feature FT:CDS KJ997855_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997857_X_P-D Feature FT:CDS KJ997857_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997858_X_P-D Feature FT:CDS KJ997858_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcgcttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997859_X_P-D Feature FT:CDS KJ997859_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997860_X_P-D Feature FT:CDS KJ997860_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactctaggactctctgtaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ997861_X_P-D Feature FT:CDS KJ997861_X_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggagtctctgtaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcatagattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM519455_X_P-D Feature FT:CDS KM519455_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_WT_SA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagaccgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524338_X_P-D Feature FT:CDS KM524338_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV136_EP-CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctccgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524339_X_P-D Feature FT:CDS KM524339_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV064_EP-CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctatctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524340_X_P-D Feature FT:CDS KM524340_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV094_EP-CHB). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524341_X_P-D Feature FT:CDS KM524341_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV128_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataacaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524342_X_P-D Feature FT:CDS KM524342_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DR003_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524344_X_P-D Feature FT:CDS KM524344_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK070_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524345_X_P-D Feature FT:CDS KM524345_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK082_EP-CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524346_X_P-D Feature FT:CDS KM524346_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK096_EP-CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524347_X_P-D Feature FT:CDS KM524347_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK102_EP-CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctttatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccctgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524348_X_P-D Feature FT:CDS KM524348_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK129_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524349_X_P-D Feature FT:CDS KM524349_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-015_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524350_X_P-D Feature FT:CDS KM524350_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-017_HIV-HBV). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524351_X_P-D Feature FT:CDS KM524351_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-020_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524352_X_P-D Feature FT:CDS KM524352_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-025_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcatccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524353_X_P-D Feature FT:CDS KM524353_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-031_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccctgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524354_X_P-D Feature FT:CDS KM524354_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-058_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524355_X_P-D Feature FT:CDS KM524355_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-092_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524356_X_P-D Feature FT:CDS KM524356_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-123_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524358_X_P-D Feature FT:CDS KM524358_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV.I-057_HIV-HBV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM524361_X_P-D Feature FT:CDS KM524361_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV.I-112_HIV-HBV). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM577668_X_P-D Feature FT:CDS KM577668_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcgccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KM577669_X_P-D Feature FT:CDS KM577669_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcgcgtccccttctccgcctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KM577670_X_P-D Feature FT:CDS KM577670_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagagaactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattgaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KM577671_X_P-D Feature FT:CDS KM577671_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-9). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactaggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606744_X_P-D Feature FT:CDS KM606744_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggaccctctcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606745_X_P-D Feature FT:CDS KM606745_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606752_X_P-D Feature FT:CDS KM606752_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba100). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattagactaaaggtctttgtac
taagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606753_X_P-D Feature FT:CDS KM606753_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtatttgttt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606754_X_P-D Feature FT:CDS KM606754_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba120). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggaccctgtcgtcctcgtctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606755_X_P-D Feature FT:CDS KM606755_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba139). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtctcttgggaccctgtcgtcctcgtctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP090177_X_P-D Feature FT:CDS KP090177_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP090178_X_P-D Feature FT:CDS KP090178_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP090179_X_P-D Feature FT:CDS KP090179_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtcggccgttccgaccgcccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acctccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP090180_X_P-D Feature FT:CDS KP090180_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP090181_X_P-D Feature FT:CDS KP090181_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168419_X_P-D Feature FT:CDS KP168419_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KN109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcgaggccgcttgggactctaccgtccccttctacgcctcccgtttcgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP317981_X_P-D Feature FT:CDS KP317981_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2X[RAMEZANI]). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagactaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP317982_X_P-D Feature FT:CDS KP317982_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 11X[RAMEZANI]). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP317983_X_P-D Feature FT:CDS KP317983_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12X[RAMEZANI]). Partial genome (Contains: HBe, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactgaatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP322599_X_P-D Feature FT:CDS KP322599_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2811). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP322600_X_P-D Feature FT:CDS KP322600_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2812). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP322601_X_P-D Feature FT:CDS KP322601_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2813). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995100_X_P-D Feature FT:CDS KP995100_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 49-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905423_X_P-D Feature FT:CDS KR905423_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctgcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagattgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905424_X_P-D Feature FT:CDS KR905424_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151620_X_P-D Feature FT:CDS KT151620_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 121). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccamttcttgcccaaggtcttacataagaggactcttggactctctgyaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccrgcaccatgcamctttttcacctctgcctaa
>gnl|hbvcds|KT235615_X_P-D Feature FT:CDS KT235615_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-07149). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtcccctcctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KT235619_X_P-D Feature FT:CDS KT235619_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-09014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235620_X_P-D Feature FT:CDS KT235620_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-09024). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235621_X_P-D Feature FT:CDS KT235621_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-09059). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235623_X_P-D Feature FT:CDS KT235623_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-09079). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235624_X_P-D Feature FT:CDS KT235624_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-1037). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235626_X_P-D Feature FT:CDS KT235626_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-1069). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235629_X_P-D Feature FT:CDS KT235629_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-1120). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235630_X_P-D Feature FT:CDS KT235630_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-1135). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235631_X_P-D Feature FT:CDS KT235631_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-1292). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235632_X_P-D Feature FT:CDS KT235632_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-12106). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT235637_X_P-D Feature FT:CDS KT235637_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AEI-09068). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT347090_X_P-D Feature FT:CDS KT347090_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGMTMG). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtgc
taggagcctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366465_X_P-D Feature FT:CDS KT366465_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.49). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366491_X_P-D Feature FT:CDS KT366491_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttcttcgtctgtcgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366493_X_P-D Feature FT:CDS KT366493_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.41). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttatcgtccccttcttcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366494_X_P-D Feature FT:CDS KT366494_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366495_X_P-D Feature FT:CDS KT366495_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366496_X_P-D Feature FT:CDS KT366496_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366497_X_P-D Feature FT:CDS KT366497_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366498_X_P-D Feature FT:CDS KT366498_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366499_X_P-D Feature FT:CDS KT366499_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtcccactctacgtctgccctttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366500_X_P-D Feature FT:CDS KT366500_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366501_X_P-D Feature FT:CDS KT366501_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366502_X_P-D Feature FT:CDS KT366502_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366506_X_P-D Feature FT:CDS KT366506_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366507_X_P-D Feature FT:CDS KT366507_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366508_X_P-D Feature FT:CDS KT366508_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatgtctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366509_X_P-D Feature FT:CDS KT366509_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366510_X_P-D Feature FT:CDS KT366510_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366511_X_P-D Feature FT:CDS KT366511_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749821_X_P-D Feature FT:CDS KT749821_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749823_X_P-D Feature FT:CDS KT749823_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL3). Non-functional genomic sequence. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgctgcacgtcgcatg
gagaccaccgtgaacgcccatacattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgac
cgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttg
ttttaggaggctgtaggcataaaatggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749827_X_P-D Feature FT:CDS KT749827_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749828_X_P-D Feature FT:CDS KT749828_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749845_X_P-D Feature FT:CDS KT749845_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL24). Partial genome (Contains: HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcatcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT963508_X_P-D Feature FT:CDS KT963508_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgctccttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668433_X_P-D Feature FT:CDS KU668433_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV071). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668434_X_P-D Feature FT:CDS KU668434_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV072). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattgggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668435_X_P-D Feature FT:CDS KU668435_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668436_X_P-D Feature FT:CDS KU668436_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttttttcagcaagattaa
>gnl|hbvcds|KU668437_X_P-D Feature FT:CDS KU668437_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668438_X_P-D Feature FT:CDS KU668438_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV111). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668439_X_P-D Feature FT:CDS KU668439_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV124). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgaaatcttgcccaagatcttacataagaggactcttggactctcagcaatgtcaacgaccga
tcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668441_X_P-D Feature FT:CDS KU668441_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV170). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgtttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668442_X_P-D Feature FT:CDS KU668442_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV175). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668444_X_P-D Feature FT:CDS KU668444_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV180). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagccccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668445_X_P-D Feature FT:CDS KU668445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV181). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668446_X_P-D Feature FT:CDS KU668446_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV183). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668447_X_P-D Feature FT:CDS KU668447_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV191). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccgcaatgtcaacgaccga
tcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtcttcgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctcagcttaa
>gnl|hbvcds|KU668448_X_P-D Feature FT:CDS KU668448_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV192). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccgcaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU668449_X_P-D Feature FT:CDS KU668449_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV207). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736924_X_P-D Feature FT:CDS KU736924_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736925_X_P-D Feature FT:CDS KU736925_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736926_X_P-D Feature FT:CDS KU736926_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736927_X_P-D Feature FT:CDS KU736927_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagcggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196208_X_P-D Feature FT:CDS KX196208_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL093). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196209_X_P-D Feature FT:CDS KX196209_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL094). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196210_X_P-D Feature FT:CDS KX196210_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL095). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196211_X_P-D Feature FT:CDS KX196211_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL096). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196212_X_P-D Feature FT:CDS KX196212_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL097). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196213_X_P-D Feature FT:CDS KX196213_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL098). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196214_X_P-D Feature FT:CDS KX196214_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL099). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaatgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196215_X_P-D Feature FT:CDS KX196215_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0100). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196216_X_P-D Feature FT:CDS KX196216_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196217_X_P-D Feature FT:CDS KX196217_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196218_X_P-D Feature FT:CDS KX196218_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196219_X_P-D Feature FT:CDS KX196219_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196220_X_P-D Feature FT:CDS KX196220_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196221_X_P-D Feature FT:CDS KX196221_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196222_X_P-D Feature FT:CDS KX196222_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0107). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196224_X_P-D Feature FT:CDS KX196224_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196225_X_P-D Feature FT:CDS KX196225_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0110). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196226_X_P-D Feature FT:CDS KX196226_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0111). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196227_X_P-D Feature FT:CDS KX196227_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0112). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196228_X_P-D Feature FT:CDS KX196228_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196229_X_P-D Feature FT:CDS KX196229_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgaaatcttgcccaagatcttatataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KX196230_X_P-D Feature FT:CDS KX196230_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0115). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196231_X_P-D Feature FT:CDS KX196231_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196232_X_P-D Feature FT:CDS KX196232_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0117). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196233_X_P-D Feature FT:CDS KX196233_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0118). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196234_X_P-D Feature FT:CDS KX196234_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0119). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196235_X_P-D Feature FT:CDS KX196235_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0120). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX196236_X_P-D Feature FT:CDS KX196236_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX260231_X_P-D Feature FT:CDS KX260231_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR-32). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX276856_X_P-D Feature FT:CDS KX276856_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtagtgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctytgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcamctctgcctaa
>gnl|hbvcds|KX276857_X_P-D Feature FT:CDS KX276857_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccactycttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagaatgggaggagttgggggaggagattagattaaygrtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357622_X_P-D Feature FT:CDS KX357622_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GD104ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcagtgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357637_X_P-D Feature FT:CDS KX357637_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK20ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357638_X_P-D Feature FT:CDS KX357638_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA95ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactgtctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357639_X_P-D Feature FT:CDS KX357639_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GD82ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactcattcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423692_X_P-D Feature FT:CDS KX423692_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1/Human/IND/Kerala-15HB04/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423693_X_P-D Feature FT:CDS KX423693_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB07/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423695_X_P-D Feature FT:CDS KX423695_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB15/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatrtcaacgaccga
ccttgaggcatacttcaaagactstttrtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423696_X_P-D Feature FT:CDS KX423696_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB17/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttstac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423698_X_P-D Feature FT:CDS KX423698_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB45/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423702_X_P-D Feature FT:CDS KX423702_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB95/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423706_X_P-D Feature FT:CDS KX423706_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D5/Human/IND/Kerala-14HB17/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaagatcttacataagaggactcttggactctccacactgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423707_X_P-D Feature FT:CDS KX423707_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D5/Human/IND/Kerala-14HB18/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaagatcttacataagaggactcttggactctccacactgtcaacaaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423710_X_P-D Feature FT:CDS KX423710_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-14HB40/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423711_X_P-D Feature FT:CDS KX423711_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1/Human/IND/Kerala-14HB46/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctttgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423713_X_P-D Feature FT:CDS KX423713_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1/Human/IND/Kerala-14HB58/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423715_X_P-D Feature FT:CDS KX423715_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-14HB81/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423717_X_P-D Feature FT:CDS KX423717_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-14HB101/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423718_X_P-D Feature FT:CDS KX423718_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-14HB15/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423719_X_P-D Feature FT:CDS KX423719_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-14HB20/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgtttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423721_X_P-D Feature FT:CDS KX423721_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D/Human/IND/Kerala-14HB24/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtcc
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423722_X_P-D Feature FT:CDS KX423722_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D5/Human/IND/Kerala-15HB22/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaagatyttacataagaggactcttggactctccacactgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX423723_X_P-D Feature FT:CDS KX423723_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2/Human/IND/Kerala-15HB27/2015). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX712265_X_P-D Feature FT:CDS KX712265_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D/Human/IND/Kerala-14HB73/2014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827290_X_P-D Feature FT:CDS KX827290_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno1.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctaccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827291_X_P-D Feature FT:CDS KX827291_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno2.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcctaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827292_X_P-D Feature FT:CDS KX827292_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno3.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaatgtcagcgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827300_X_P-D Feature FT:CDS KX827300_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno21.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggatgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcgtggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagattaaaggtctttgcac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827301_X_P-D Feature FT:CDS KX827301_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno30.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accgccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382412_X_P-D Feature FT:CDS KY382412_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_1896). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382414_X_P-D Feature FT:CDS KY382414_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_wt). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY629630_X_P-D Feature FT:CDS KY629630_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TYM13097). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctctgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtatttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY629633_X_P-D Feature FT:CDS KY629633_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagytdtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY629634_X_P-D Feature FT:CDS KY629634_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggatgagattagattaatgatttatgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|L27106_X_P-D Feature FT:CDS L27106_X_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccgcccatctattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgac
cgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggataatagattaatgatttatg
tattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC365689_X_P-D Feature FT:CDS LC365689_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HB17-0791). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LT992444_X_P-D Feature FT:CDS LT992444_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA51). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccnnnnn
nnnnnnnnnnnnnnnnnngcttgggactatgtcgtcctcttctccgtctgccgttccggccgacyacggggcgcacctct
ctttaygcggactyccygtctgtgcyttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LT992454_X_P-D Feature FT:CDS LT992454_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA222). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|M32138_X_P-D Feature FT:CDS M32138_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF115849_X_P-D Feature FT:CDS MF115849_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM289). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggaccctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttgtactctctgtagtaaagtc
aacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatga
tctttgtactaggaggctgtaggcataaattgatctgctcaccaccaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115851_X_P-D Feature FT:CDS MF115851_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM55). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggccgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgccccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115857_X_P-D Feature FT:CDS MF115857_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM19). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctcc
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115858_X_P-D Feature FT:CDS MF115858_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM25). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtaggtttatataagaggactcttggactctctgtaatgtc
aacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatga
tctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaattttttcacatctgcc
>gnl|hbvcds|MF115865_X_P-D Feature FT:CDS MF115865_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM19c1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctggcaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctcc
ctttacgcggactccctgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccggcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115866_X_P-D Feature FT:CDS MF115866_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM19c2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctggcaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115867_X_P-D Feature FT:CDS MF115867_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM19c3). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctggcaggctgtgctgccaactggaccctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcgcctcc
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgcttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115868_X_P-D Feature FT:CDS MF115868_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM25c1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgccaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115869_X_P-D Feature FT:CDS MF115869_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM25c2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtatgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115870_X_P-D Feature FT:CDS MF115870_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM25c3). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagccccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115923_X_P-D Feature FT:CDS MF115923_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM289c1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattctcgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaataggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF115924_X_P-D Feature FT:CDS MF115924_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM289c2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctcc
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaac
gatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaatgggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|MF488704_X_P-D Feature FT:CDS MF488704_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-PCP229). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctccgcctaa
>gnl|hbvcds|MF618339_X_P-D Feature FT:CDS MF618339_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF618341_X_P-D Feature FT:CDS MF618341_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgcgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF618342_X_P-D Feature FT:CDS MF618342_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV053). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF618343_X_P-D Feature FT:CDS MF618343_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV054). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctgtcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaagatcttacataagaggactcttggactctccacaatgtcaacgaccga
tcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|MF618348_X_P-D Feature FT:CDS MF618348_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV137). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacattagtggtctcttggacacttcgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF618349_X_P-D Feature FT:CDS MF618349_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925358_X_P-D Feature FT:CDS MF925358_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925363_X_P-D Feature FT:CDS MF925363_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV07). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925364_X_P-D Feature FT:CDS MF925364_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV08). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925366_X_P-D Feature FT:CDS MF925366_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgccgcagactggaagctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925379_X_P-D Feature FT:CDS MF925379_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgttctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccccttcttcgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctgatattgcccaaggtattgcataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925383_X_P-D Feature FT:CDS MF925383_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcctgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925390_X_P-D Feature FT:CDS MF925390_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV34). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttcttcgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattacagttgtttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925391_X_P-D Feature FT:CDS MF925391_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcggccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925393_X_P-D Feature FT:CDS MF925393_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776378_X_P-D Feature FT:CDS MG776378_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-3). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggg
accaccgtgaacgcccacctatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776379_X_P-D Feature FT:CDS MG776379_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-4). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccatcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776382_X_P-D Feature FT:CDS MG776382_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-9). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776383_X_P-D Feature FT:CDS MG776383_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-10). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776384_X_P-D Feature FT:CDS MG776384_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-11). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776386_X_P-D Feature FT:CDS MG776386_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-13). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|MG776387_X_P-D Feature FT:CDS MG776387_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-16). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaccgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776389_X_P-D Feature FT:CDS MG776389_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-18). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776390_X_P-D Feature FT:CDS MG776390_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-19). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|MG776391_X_P-D Feature FT:CDS MG776391_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-20). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776392_X_P-D Feature FT:CDS MG776392_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-21). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccatcggagctgaatcccgcgg
acgacccttcgcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcatctct
ctttacgcgagctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776393_X_P-D Feature FT:CDS MG776393_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-22). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776394_X_P-D Feature FT:CDS MG776394_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-23). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776395_X_P-D Feature FT:CDS MG776395_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-24). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776396_X_P-D Feature FT:CDS MG776396_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-25). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttcttcatctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776397_X_P-D Feature FT:CDS MG776397_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-28). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtctacgtcccgtcagtgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcccgtcccctgctgcgtctgccgttccgcccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggaggttagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776398_X_P-D Feature FT:CDS MG776398_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-30). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggg
accaccgtgaacgcccacctatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776399_X_P-D Feature FT:CDS MG776399_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-32). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776400_X_P-D Feature FT:CDS MG776400_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-33). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776401_X_P-D Feature FT:CDS MG776401_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-34). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776402_X_P-D Feature FT:CDS MG776402_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-35). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacttttgcgtaa
>gnl|hbvcds|MG776404_X_P-D Feature FT:CDS MG776404_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-38). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776405_X_P-D Feature FT:CDS MG776405_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-39). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776406_X_P-D Feature FT:CDS MG776406_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-40). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|MG776407_X_P-D Feature FT:CDS MG776407_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-41). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|MG776409_X_P-D Feature FT:CDS MG776409_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-45). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776410_X_P-D Feature FT:CDS MG776410_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-47). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776411_X_P-D Feature FT:CDS MG776411_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-48). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776412_X_P-D Feature FT:CDS MG776412_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-52). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccatttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776415_X_P-D Feature FT:CDS MG776415_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-59). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaagtttttcacctctgcctaa
>gnl|hbvcds|MG776416_X_P-D Feature FT:CDS MG776416_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-60). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776417_X_P-D Feature FT:CDS MG776417_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-61). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776418_X_P-D Feature FT:CDS MG776418_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-62). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776419_X_P-D Feature FT:CDS MG776419_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-64). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgggatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattattgatctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776420_X_P-D Feature FT:CDS MG776420_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-68). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagagaactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776421_X_P-D Feature FT:CDS MG776421_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-69). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776423_X_P-D Feature FT:CDS MG776423_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-73). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776424_X_P-D Feature FT:CDS MG776424_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-75). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776428_X_P-D Feature FT:CDS MG776428_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-83). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtgtaccgtttcgaccgacaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776430_X_P-D Feature FT:CDS MG776430_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-91). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776433_X_P-D Feature FT:CDS MG776433_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-101). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctcgcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcgactttttcacctctgcctaa
>gnl|hbvcds|MG776434_X_P-D Feature FT:CDS MG776434_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-102). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776435_X_P-D Feature FT:CDS MG776435_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-105). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagacctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776436_X_P-D Feature FT:CDS MG776436_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-107). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaatgtttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggaattgggggaggagactagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776437_X_P-D Feature FT:CDS MG776437_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-111). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776438_X_P-D Feature FT:CDS MG776438_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-119). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtttgcgcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776439_X_P-D Feature FT:CDS MG776439_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA_123). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagatgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776440_X_P-D Feature FT:CDS MG776440_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-124). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgcctgccgtttcggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776441_X_P-D Feature FT:CDS MG776441_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-125). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcctgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcgtctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtctagattacagatgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776442_X_P-D Feature FT:CDS MG776442_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-134). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggttcatgtag
ggagggcctgtaggcataaattggttctggcgccaaccccatggaactttttcacctctgcctaa
>gnl|hbvcds|MG776443_X_P-D Feature FT:CDS MG776443_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-138). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcccttctgcctaa
>gnl|hbvcds|MG776444_X_P-D Feature FT:CDS MG776444_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-142). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776445_X_P-D Feature FT:CDS MG776445_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-143). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776448_X_P-D Feature FT:CDS MG776448_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-153). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776449_X_P-D Feature FT:CDS MG776449_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-158). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776450_X_P-D Feature FT:CDS MG776450_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-160). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776451_X_P-D Feature FT:CDS MG776451_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-162). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776452_X_P-D Feature FT:CDS MG776452_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-170). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776453_X_P-D Feature FT:CDS MG776453_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-172). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776454_X_P-D Feature FT:CDS MG776454_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-175). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776455_X_P-D Feature FT:CDS MG776455_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-178). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776457_X_P-D Feature FT:CDS MG776457_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-183). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776459_X_P-D Feature FT:CDS MG776459_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-187). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtcttcgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776460_X_P-D Feature FT:CDS MG776460_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-188). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776461_X_P-D Feature FT:CDS MG776461_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-193). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776462_X_P-D Feature FT:CDS MG776462_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-195). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcgtaa
>gnl|hbvcds|MG776464_X_P-D Feature FT:CDS MG776464_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-202). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtccttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcccctctgcgtaa
>gnl|hbvcds|MG776466_X_P-D Feature FT:CDS MG776466_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-213). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgggatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattattgatctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776468_X_P-D Feature FT:CDS MG776468_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-217). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776469_X_P-D Feature FT:CDS MG776469_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-220). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776470_X_P-D Feature FT:CDS MG776470_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-221). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagctgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776471_X_P-D Feature FT:CDS MG776471_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-224). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776473_X_P-D Feature FT:CDS MG776473_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-228). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggtcgttaggctgtgctgccaacaggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactctcggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776474_X_P-D Feature FT:CDS MG776474_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-231). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776476_X_P-D Feature FT:CDS MG776476_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-235). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataggaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaattgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776477_X_P-D Feature FT:CDS MG776477_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-236). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaagtagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776478_X_P-D Feature FT:CDS MG776478_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-240). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776479_X_P-D Feature FT:CDS MG776479_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-246). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776480_X_P-D Feature FT:CDS MG776480_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-250). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776481_X_P-D Feature FT:CDS MG776481_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-254). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776482_X_P-D Feature FT:CDS MG776482_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-255). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776483_X_P-D Feature FT:CDS MG776483_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-256). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgccactttttcacctctgcctaa
>gnl|hbvcds|MG776484_X_P-D Feature FT:CDS MG776484_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-257). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctcccgtccccttctgcgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776486_X_P-D Feature FT:CDS MG776486_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-264). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776487_X_P-D Feature FT:CDS MG776487_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-267). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacccctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccgg
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776488_X_P-D Feature FT:CDS MG776488_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-268). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776490_X_P-D Feature FT:CDS MG776490_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-273). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776491_X_P-D Feature FT:CDS MG776491_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-274). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776492_X_P-D Feature FT:CDS MG776492_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-276). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaagtagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776493_X_P-D Feature FT:CDS MG776493_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sa-277). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776495_X_P-D Feature FT:CDS MG776495_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-282). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776496_X_P-D Feature FT:CDS MG776496_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-283). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattacagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776497_X_P-D Feature FT:CDS MG776497_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-285). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactatatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaatcgggggaggagattagattaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776498_X_P-D Feature FT:CDS MG776498_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-286). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctcgcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactattggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776499_X_P-D Feature FT:CDS MG776499_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-289). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776500_X_P-D Feature FT:CDS MG776500_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-294). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccagggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcttaa
>gnl|hbvcds|MG776501_X_P-D Feature FT:CDS MG776501_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-295). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776502_X_P-D Feature FT:CDS MG776502_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-297). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776504_X_P-D Feature FT:CDS MG776504_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-299). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776505_X_P-D Feature FT:CDS MG776505_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-309). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcacttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagattaaagatctttgtct
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776506_X_P-D Feature FT:CDS MG776506_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-311). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776507_X_P-D Feature FT:CDS MG776507_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-313). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776509_X_P-D Feature FT:CDS MG776509_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-321). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacacaagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776510_X_P-D Feature FT:CDS MG776510_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-328). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776511_X_P-D Feature FT:CDS MG776511_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-329). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776513_X_P-D Feature FT:CDS MG776513_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-335). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776514_X_P-D Feature FT:CDS MG776514_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-336). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776516_X_P-D Feature FT:CDS MG776516_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-339). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgggatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattattgatctttgtgt
taggaggctgtaggcataaattggtctgcacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776518_X_P-D Feature FT:CDS MG776518_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-342). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaatcaaattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776520_X_P-D Feature FT:CDS MG776520_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-346). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgcccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctgggtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776522_X_P-D Feature FT:CDS MG776522_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-348). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcstttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgycgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcscatggag
accaccgtgaacgcccgccaattcttgcccaaggtcttacataaaaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776523_X_P-D Feature FT:CDS MG776523_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-351). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgggatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattattgatctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776524_X_P-D Feature FT:CDS MG776524_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-354). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggatattagattaaagccatttgtat
taggaggccgcaacaataaatccgtcccctttccagcaccccacaactttatcacctctgcctaa
>gnl|hbvcds|MG776525_X_P-D Feature FT:CDS MG776525_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-357). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaaagaattatgtat
tcggaggctgtaggcataaaccggtgttcgcgcccacaccaccaagctttttcacattcgcctaa
>gnl|hbvcds|MG776527_X_P-D Feature FT:CDS MG776527_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-360). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776528_X_P-D Feature FT:CDS MG776528_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-365). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
acctccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776529_X_P-D Feature FT:CDS MG776529_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-367). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtatgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggagactgtaggcataaattagtatgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776530_X_P-D Feature FT:CDS MG776530_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-368). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtatgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggagactgtaggcataaattagtatgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776532_X_P-D Feature FT:CDS MG776532_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-372). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagattaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776533_X_P-D Feature FT:CDS MG776533_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-373). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776535_X_P-D Feature FT:CDS MG776535_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-376). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggttatgatgt
tgggaggctgtatgggtaagttggtctgctcaccggcaccttgcaactttttcacctccgcctaa
>gnl|hbvcds|MG776536_X_P-D Feature FT:CDS MG776536_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-377). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776537_X_P-D Feature FT:CDS MG776537_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-378). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776538_X_P-D Feature FT:CDS MG776538_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-380). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776539_X_P-D Feature FT:CDS MG776539_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-385). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776541_X_P-D Feature FT:CDS MG776541_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-388). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagattaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776543_X_P-D Feature FT:CDS MG776543_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-390). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctatgcacgttgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattacagttgtttgtat
taggaggctgtaggcataaattggtatgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776544_X_P-D Feature FT:CDS MG776544_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-397). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctacgtttgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatcaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776545_X_P-D Feature FT:CDS MG776545_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-400). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaagttgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776546_X_P-D Feature FT:CDS MG776546_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-404). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776547_X_P-D Feature FT:CDS MG776547_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-406). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|MG776548_X_P-D Feature FT:CDS MG776548_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-408). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776549_X_P-D Feature FT:CDS MG776549_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-409). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagattaatggtttatgtat
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MG776553_X_P-D Feature FT:CDS MG776553_X_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SA-433). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactc